Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 3 de 3
Filtrar
Más filtros

Banco de datos
Tipo del documento
Asunto de la revista
País de afiliación
Intervalo de año de publicación
1.
BMC Plant Biol ; 23(1): 215, 2023 Apr 25.
Artículo en Inglés | MEDLINE | ID: mdl-37098482

RESUMEN

BACKGROUND: Melatonin is considered to be a polyfunctional master regulator in animals and higher plants. Exogenous melatonin inhibits plant infection by multiple diseases; however, the role of melatonin in Cucumber green mottle mosaic virus (CGMMV) infection remains unknown. RESULTS: In this study, we demonstrated that exogenous melatonin treatment can effectively control CGMMV infection. The greatest control effect was achieved by 3 days of root irrigation at a melatonin concentration of 50 µM. Exogenous melatonin showed preventive and therapeutic effects against CGMMV infection at early stage in tobacco and cucumber. We utilized RNA sequencing technology to compare the expression profiles of mock-inoculated, CGMMV-infected, and melatonin+CGMMV-infected tobacco leaves. Defense-related gene CRISP1 was specifically upregulated in response to melatonin, but not to salicylic acid (SA). Silencing CRISP1 enhanced the preventive effects of melatonin on CGMMV infection, but had no effect on CGMMV infection. We also found exogenous melatonin has preventive effects against another Tobamovirus, Pepper mild mottle virus (PMMoV) infection. CONCLUSIONS: Together, these results indicate that exogenous melatonin controls two Tobamovirus infections and inhibition of CRISP1 enhanced melatonin control effects against CGMMV infection, which may lead to the development of a novel melatonin treatment for Tobamovirus control.


Asunto(s)
Melatonina , Tobamovirus , Reguladores del Crecimiento de las Plantas , Cisteína , Melatonina/farmacología , Tobamovirus/genética , Nicotiana/genética , Enfermedades de las Plantas/genética
2.
Plant Dis ; 2022 Apr 20.
Artículo en Inglés | MEDLINE | ID: mdl-35442054

RESUMEN

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.

3.
Mol Plant Pathol ; 24(3): 208-220, 2023 03.
Artículo en Inglés | MEDLINE | ID: mdl-36528386

RESUMEN

The movement protein (MP) and coat protein (CP) of tobamoviruses play critical roles in viral cell-to-cell and long-distance movement, respectively. Cucumber green mottle mosaic virus (CGMMV) is a member of the genus Tobamovirus. The functions of CGMMV MP and CP during viral infection remain largely unclear. Here, we show that CGMMV MP can interact with CP in vivo, and the amino acids at positions 79-128 in MP are vital for the MP-CP interaction. To confirm this finding, we mutated five conserved residues within the residue 79-128 region and six other conserved residues flanking this region, followed by in vivo interaction assays. The results showed that the conserved threonine residue at the position 107 in MP (MPT107 ) is important for the MP-CP interaction. Substitution of T107 with alanine (MPT107A ) delayed CGMMV systemic infection in Nicotiana benthamiana plants, but increased CGMMV local accumulation. Substitutions of another 10 conserved residues, not responsible for the MP-CP interaction, with alanine inhibited or abolished CGMMV systemic infection, suggesting that these 10 conserved residues are possibly required for the MP movement function through a CP-independent manner. Moreover, two movement function-associated point mutants (MPF17A and MPD97A ) failed to cause systemic infection in plants without impacting on the MP-CP interaction. Furthermore, we have found that co-expression of CGMMV MP and CP increased CP accumulation independent of the interaction. MP and CP interaction inhibits the salicylic acid-associated defence response at an early infection stage. Taken together, we propose that the suppression of host antiviral defence through the MP-CP interaction facilitates virus systemic infection.


Asunto(s)
Tobamovirus , Proteínas de la Cápside/genética , Nicotiana , Enfermedades de las Plantas
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA