Virome Analysis of Aconitum carmichaelii Reveals Infection by Eleven Viruses, including Two Potentially New Species.

Aconitum carmichaelii is a herbaceous herb indigenous to China that has been cultivated for traditional medicine for centuries. Virus-like symptoms of A. carmichaelii plants were observed on leaves in some A. carmichaelii plantations in Zhanyi and Wuding Counties, Yunnan Province, southwest China. High-throughput sequencing (HTS) was performed on 28 symptomatic plants, and the results revealed infection with 11 viruses, including 2 novel viruses and 9 previously described viruses: Aconitum amalgavirus 1 (AcoAV-1), aconite virus A (AcVA), cucumber mosaic virus (CMV), currant latent virus (CuLV), apple stem grooving virus (ASGV), chilli veinal mottle virus (ChiVMV), tomato spotted wilt orthotospovirus (TSWV), tobacco vein distorting virus (TVDV), and potato leafroll virus (PLRV). Two novel viruses tentatively named Aconitum potyvirus 1 and Aconitum betapartitivirus 1, were supported by sequence and phylogenetic analysis results of their genomes. We proposed the names Potyvirus aconiti and Betapartitivirus aconiti. RT-PCR assays of 142 plants revealed the predominance and widespread distribution of CMV, AcVA, and AcoPV-1 in plantations. The detection of isolates of CuLV, ASGV, ChiVMV, TSWV, TVDV, and PLRV infections for the first time in A. carmichaelii expands their known host ranges.

Complete genome sequence of Aconitum amalgavirus 1, a distinct member of the genus Amalgavirus.

A novel virus named Aconitum amalgavirus 1 (AcoAV-1) was identified in Chinese aconite (Aconitum carmichaelii) plants. The complete genome of AcoAV-1 is 3,370 nucleotides long, containing two partially overlapping open reading frames encoding a putative coat protein and a RNA-dependent RNA polymerase, respectively. Its fusion protein shares 34.9%-50.7% amino acid sequence identity with other amalgaviruses. Phylogenetic analysis showed that this virus formed a clade with blueberry latent virus and four other related viruses, suggesting that it belongs to the genus Amalgavirus in the family Amalgaviridae.

Genomic characterization of a new enamovirus infecting common bean.

A novel enamovirus was identified in common bean plants with disease symptoms. Its genome of 5,781 nucleotides (nt) contains five open reading frames. This virus and other members of the genus Enamovirus share 50.4-68.4% nucleotide sequence identity in the complete genome and 19.9-51.9% amino acid sequence identity in the P0 protein, 24.9-52.5% in P1, 33.4-62.9% in P1-P2, 30.6-81.1% in P3, and 32.3-74.2% in P3-P5. Phylogenetic analysis showed that the virus is most closely related to alfalfa enamovirus 1 and pea enation mosaic virus 1 in the genus Enamovirus of the family Solemoviridae. These results suggest that this virus, tentatively named "bean enamovirus 1", should be classified as a member of a new species in the genus Enamovirus.

Complete genome sequence of a novel citrus virus with characteristics of members of the family Tymoviridae.

A novel positive-stranded RNA virus provisionally named "citrus virus C" (CVC) was discovered in citrus trees displaying mottling symptoms. Its genome comprises 7,215 nucleotides (nt), excluding the 3' poly(A) tail, and contains two open reading frames (ORFs) that encode a replication-associated polyprotein (RP) and a putative coat protein (CP). The CVC genome contains a 16-nt 'marafibox', which is highly conserved in most viruses belonging to the genus Marafivirus of the same family. Sequence analysis suggested that the virus is most closely related to grapevine Red Globe virus (GRGV), which is yet to be officially classified in the family Tymoviridae. The sequence identities between CVC and GRGV in the whole genome (50.7%, nt) and CP (49.4% for amino acid, and 53.9% for nt) are lower than the thresholds (80% in the genome and 90% in the CP) for species demarcation in the family. Therefore, it is legitimate to propose that CVC is a member of new species in the family Tymoviridae.

Camellia ringspot-associated virus 4, a proposed new foveavirus from Camellia japonica.

One large contig with high sequence similarity to Asian prunus virus 2 was identified by high-throughput sequencing from a camellia (Camellia japonica) tree with ringspot symptoms. The complete genome of this new virus was determined to be 8829 nucleotides long, excluding the 3' poly(A) tail. Its genome organization resembles that of known foveaviruses but contains an additional open reading frame in the 3'-terminal region. Phylogenetic analysis also places this virus with members of the genus Foveavirus in the family Betaflexiviridae in the same subgroup. The virus, which is provisionally named "camellia ringspot-associated virus 4″, shares 50-56% nucleotide sequence identity with other foveaviruses and should represent a new species in the genus.

First identification and molecular characterization of a new badnavirus infecting camellia.

A new badnavirus was identified in an ornamental camellia tree with yellow mottle symptom. The complete circular double-stranded DNA genome of this virus was found to consist of 8,203 bp. Its genome organization is typical of badnaviruses, containing three open reading frames (ORFs). ORFs 1 and 2 encode putative proteins with unknown functions. ORF3 encodes a large polyprotein that contains almost all of the conserved domains of badnaviruses. The virus shares 55-62% nucleotide sequence identities with other badnaviruses in the RT+RNase H region. Phylogenetic analyses placed it in group I of the genus Badnavirus. Therefore, this virus, which is tentatively named "camellia Lemon Glow virus", should represent a new species of the genus Badnavirus. This virus was found to be present in approximately a quarter of camellia trees tested.

First identification and molecular characterization of a novel cavemovirus infecting Epiphyllum spp.

A new virus with sequence similarities to members of the genus Cavemovirus in the family Caulimoviridae was identified in an Epiphyllum hybrid. The complete genome of the virus, tentatively named "epiphyllum virus 4" (EpV-4), was determined to be 7,296 nucleotides long. Its circular genome organization is typical of cavemoviruses, containing four open reading frames. This virus and the two known cavemoviruses share 67-69% and 72-75% overall nucleotide sequence identity in the replicase gene. Phylogenetic analysis placed EpV-4 in a same cluster with the two recognized cavemoviruses. Thus, EpV-4 should be considered a representative of a third species of the genus Cavemovirus. The virus was transmitted by grafting.

Discovery and molecular characterization of a novel trichovirus infecting sweet cherry.

Contigs with the highest sequence similarity (73%) to Apricot pseudo-chlorotic leaf spot virus (genus Trichovirus, family Betaflexiviridae) were identified by high-throughput sequencing from a symptomless sweet cherry accession. The complete genome sequence of this new virus is 7460 nucleotides, excluding the 3' poly(A) tail. Its genome organization is very similar to several trichoviruses infecting fruit trees, with three open reading frames encoding putative replicase, movement protein and coat protein (CP). The virus shares amino acid sequence identities of 60-73% at replicase and 53-76% at CP with other trichoviruses. Phylogenetic analyses group it and other trichoviruses in a cluster. These results support that this virus, which is tentatively named cherry latent virus 1, should be considered a new member in the genus Trichovirus.

Mulberry (Morus alba) is a new natural host of Citrus leaf blotch virus in China.

Mulberries (Morus spp., family Moraceae) are economically important deciduous woody plants. Their leaves are food for silkworms, and both the fruits and leaves have nutritional and medicinal values (Qin et al. 2012). The plants are widely distributed globally and have been cultivated in China for more than 5,000 years (Xie et al. 2014). In April 2019, virus-like symptoms of chlorotic leaf spots and, occasionally witches' broom were observed in trees of white mulberry (M. alba) in Shapingba district of Chongqing province. To investigate if any potential viral agent is associated with the symptoms, total RNA was extracted from leaves of one symptomatic tree using an RNAprep Pure Plant Plus Kit (TianGen, China). Ribosomal RNAs were depleted using a TruSeq RNA Sample Prep Kit (Illumina, USA), and the depleted RNA was used for construction of a cDNA library for sequencing using an Illumina HiSeq X-ten platform with pair-ended reads length layout 150 bp. Adaptors, low-quality reads and mulberry genomes-derived reads (He et al. 2013) were removed from a total of 25,433,798 reads using the CLC Genomics Workbench 11 (Qiagen, USA) and the clean reads of 936,562 were subjected to de novo assembly that generated 4,278 contigs (200-3,862 bp). These sequences were annotated by Blastx searches to local Viruses_NR and viroid datasets downloaded from GenBank. Finally, except three contigs (3,862 nt, 1,950 nt, and 1,179 nt) with 81.4-90% nucleotide sequence identities to citrus leaf blotch virus (CLBV, genus Citrivirus, family Betaflexiviridae), no other contigs were identified as viral-related. Total clean reads of 113,185 were mapped to the viral contigs with average coverage depth of 1,915, suggesting the presence of CLBV in the symptomatic tree. To recover the complete genome of CLBV, overlapping fragments were amplified by RT-PCR using virus-specific primer pairs. The 5' and 3' termini were determined by rapid amplification of cDNA ends (RACE kit, Invitrogen, USA). Five clones per amplicon were sequenced in two directions (Cao et al. 2018). The complete genome of the mulberry strain of CLBV (CLBV-ML, GenBank accession no. MT767171) is 8,776 nucleotides (nt) in length, excluding the poly (A) tail. CLBV-ML is similar to extant CLBV isolates in genome structure. BLASTn analysis showed that CLBV-ML had highest nucleotide sequence identities of 79.65-81.56% with Actinidia isolates (Liu et al. 2019) of CLBV at the whole genome. Phylogenetic analysis also placed it with the Actinidia isolates, indicating they are closely related. Thus, CLBV-ML is a highly divergent strain of CLBV. To study the occurrence of CLBV-ML, a total of 62 mulberry samples (42 with similar symptoms and 20 without symptoms) were randomly collected from Shapingba and tested by conventional RT-PCR using an isolate-specific primer pair (CLBV-F7182: ACCAATGACAATGCCACA; CLBV-R7857: TTATGAAACTCTTCCCACTT) designed in the CP gene to amplify a 676 bp fragment. The virus was detected in 37 symptomatic trees (88%) and 2 (10%) asymptomatic trees, suggesting the association of CLBV-ML with the symptoms. To the best of our knowledge, this is the first report of CLBV infection in mulberry which expands the host range of CBLV.

The occurrence of Pea enation mosaic virus 1 and Pea enation mosaic virus 2 from disease-affected pea fields in China.

Pea (Pisum sativum L.) is an economically important legume crop that is commonly used as dry beans, fresh peas, pods and shoots (Guo et al. 2009). Pea enation mosaic is an important virus disease of pea caused by two viruses in an obligate symbiosis, pea enation mosaic virus 1 (PEMV-1, Enamovirus, Luteoviridae) and pea enation mosaic virus 2 (PEMV-2, Umbravirus, Tombusviridae) (Hema et al. 2014). In November 2019, foliar yellow mosaic and vein enations symptoms were observed from pea plants in five fields of Honghe autonomous prefecture, Yunnan province, China. Incidence of symptomatic plants ranged from 20 to 40% and was distributed in both small and large fields. Leaves with typical virus-like symptoms were collected from five symptomatic pea plants in two fields and used for total RNA extraction. The five extracts of equimolar quantities were pooled into a sample and subjected to High Throughput Sequencing (HTS) by Illumina HiSeq system. Analyses of raw RNA reads were performed using CLC Genomics Workbench 12 (Qiagen). A total of 60,009,746 RNA reads were obtained from the sample, and de novo assembly of the reads using the CLC Genomics generated 88,105 contigs. BLASTN searches revealed the presence of contigs with high similarities to PEMV-1, PEMV-2, Pea seed-borne mosaic virus, and Bean yellow mosaic virus. To confirm the presence of PEMV-1 and PEMV-2 in the samples, two virus-specific primer pairs were designed based on the contig sequences obtained by HTS in this study. Primer pairs PEMV-1F/PEMV-1R (5'-ATGCCGACTAGATCGAAATC-3'/5'-TCAGAGGGAGGCATTCATTA-3') that flank the cp gene of PEMV-1 and PEMV-2F/PEMV-2R (5'-ATGACGATAATCATTAATG-3'/5'-TCACCCGTAGTGAGAGGCA-3') that target the ORF3 region of PEMV-2 were used to amplify the two viruses in RT-PCR. DNA fragments of the expected sizes (PEMV-1, 570 bp; PEMV-2, 693 bp) were amplified from all five samples. The RT-PCR products were cloned and sequenced. Sequence analysis showed that the 570-bp amplicon (MT481989) shared the highest nucleotide sequence identity of 98.95% with PEMV-1 (Z48507), while the 693-bp fragment (MT481990) had the highest nucleotide sequence identity of 97.4% with PEMV-2 isolate JKI (MK948534). One gram of the symptomatic leaves from each of the five plants was homogenized with 5 mL of 0.01 M phosphate-buffered saline (PBS buffer), pH 7.0. Each of the resulted saps was used to inoculate onto five healthy pea seedlings. A total of 25 healthy pea seedlings were inoculated, and 16 inoculated plants developed yellowing and mottling at 10 days post inoculation (dpi); no symptoms were observed on control plants inoculated only with PBS buffer. The formation of the typical enation was observed along the veins of lower side of the symptomatic leaves of the inoculated plants at 30 dpi. PEMV-1 and PEMV-2 infection were confirmed by RT-PCR assays using the specific primer pairs described above. Although the presence of the pea enation mosaic virus complex was suspected in China based on symptomatology (Brunt et al. 1997), to our knowledge, this is the first molecular confirmation of PEMV-1 and PEMV-2 occurrence in China. The co-infection of PEMV-1 and PEMV-2 usually cause severe yield losses; therefore, integration of detection and control measures is important in pea production regions where the two viruses occurred.

Molecular characterization of a new badnavirus infecting green Sichuan pepper (Zanthoxylum schinifolium).

A new virus with a circular double-stranded DNA genome was discovered in green Sichuan pepper with vein clearing symptoms. Its complete genome of 8,014 bp contains three open reading frames (ORF) on the plus strand, which is typical of members of the genus Badnavirus in the family Caulimoviridae. Sequence comparisons revealed that the new virus has the highest nucleotide sequence identity with grapevine vein-clearing virus (GVCV). In particular, the identity of the two viruses in the ORF3 RT-RNase H region is 71.9%, which is below the species demarcation cutoff of 80% for badnaviruses. Phylogenetic analysis also placed the new virus with GVCV in a cluster. The virus was tentatively named "green Sichuan pepper vein clearing-associated virus" (GSPVCaV). The geographical distribution and genetic diversity of GSPVCaV were studied. Another isolate was found to be highly divergent.

Development of a sensitive and reliable reverse transcription droplet digital PCR assay for the detection of citrus yellow vein clearing virus.

In 2009, a new viral disease of citrus caused by citrus yellow vein clearing virus (CYVCV) was first discovered in China. CYVCV is considered to be the most serious pathogen affecting lemon production. In this study, a sensitive and reliable reverse transcription droplet digital polymerase chain reaction (RT-ddPCR) assay was developed to detect and quantify CYVCV without references. The specificity of the assay was demonstrated by its failure to amplify other relevant citrus viruses. The quantitative linearity, sensitivity and accuracy of RT-ddPCR for detecting CYVCV were compared to those of real-time RT-PCR. The results showed that both methods had a high degree of linearity (R2 = 0.9776) and quantitative correlation. Furthermore, RT-ddPCR was found to be 100 times more sensitive than real-time RT-PCR, and it can therefore be used to detect CYVCV in individual arthropods. In summary, the results demonstrated that the RT-ddPCR assay is a promising approach for quantitative detection of CYVCV with high precision and accuracy.

Characterization of a new apple luteovirus identified by high-throughput sequencing.

BACKGROUND: 'Rapid Apple Decline' (RAD) is a newly emerging problem of young, dwarf apple trees in the Northeastern USA. The affected trees show trunk necrosis, cracking and canker before collapse in summer. In this study, we discovered and characterized a new luteovirus from apple trees in RAD-affected orchards using high-throughput sequencing (HTS) technology and subsequent Sanger sequencing. METHODS: Illumina NextSeq sequencing was applied to total RNAs prepared from three diseased apple trees. Sequence reads were de novo assembled, and contigs were annotated by BLASTx. RT-PCR and 5'/3' RACE sequencing were used to obtain the complete genome of a new virus. RT-PCR was used to detect the virus. RESULTS: Three common apple viruses and a new luteovirus were identified from the diseased trees by HTS and RT-PCR. Sequence analyses of the complete genome of the new virus show that it is a new species of the genus Luteovirus in the family Luteoviridae. The virus is graft transmissible and detected by RT-PCR in apple trees in a couple of orchards. CONCLUSIONS: A new luteovirus and/or three known viruses were found to be associated with RAD. Molecular characterization of the new luteovirus provides important information for further investigation of its distribution and etiological role.

Molecular characterization of a novel citrivirus from citrus using next-generation sequencing.

A novel positive-strand RNA virus infecting citrus with the tentative name "citrus leaf blotch virus 2" (CLBV-2), was identified in the present work. The complete genome sequence of CLBV-2 comprises 8,697 nucleotides (nt) excluding a poly(A) tail and three open reading frames (ORFs), showing the highest nucleotide sequence identity with the Actinidia strain (JN983456) of citrus leaf blotch virus (CLBV). The putative movement protein (ORF2), coat protein (ORF3), and 3' untranslated region (UTR) shared high sequence similarity with those of the extant CLBV isolates. In contrast, only low sequence similarity was observed in the 5' UTR and putative replicase polyprotein (ORF1) regions. The distant phylogenetic relationship between CLBV-2 and CLBV was deduced based on whole-genome nucleotide and whole-ORF1 amino acid sequence comparisons. Sequence comparisons suggest that CLBV-2 acquired an ORF2-ORF3-3' UTR region homologous to CLBV by recombination with of an unknown citrivirus. In view of the fact that this genomic recombination event appears to have occurred between members of different species in the genus Citrivirus, we propose that CLBV-2 should be considered a member of a distinct species.

Correction to: Molecular characterization of a novel citrivirus from citrus using next­generation sequencing.

Unfortunately, the Acknowledgement, ethical statement and the Conflict of interest statements were not included in the online publication and updated here in this Erratum.

Complete genome sequence of Paris mosaic necrosis virus, a distinct member of the genus Potyvirus.

The complete genomic sequence of a novel potyvirus was determined from Paris polyphylla var. yunnanensis. Its genomic RNA consists of 9,660 nucleotides (nt) excluding the 3'-terminal poly (A) tail, containing the typical open reading frame (ORF) of potyviruses and encoding a putative large polyprotein of 3030 amino acids. The virus shares 53.9-70.1% nt sequence identity and 43.9-73.2% amino acid sequence identity with other viruses classified within the genus Potyvirus. Proteolytic cleavage sites and conserved motifs of the potyviruses were identified in the polyprotein and within individual proteins. Phylogenetic analysis indicated that the virus is most closely related to members of the BCMV subgroup. The results suggest that the virus should be classified as a novel species within the genus Potyvirus, which we tentatively name "Paris mosaic necrosis virus".

Molecular characterization of a novel luteovirus infecting apple by next-generation sequencing.

A new single-stranded positive-sense RNA virus, which shares the highest nucleotide (nt) sequence identity of 53.4% with the genome sequence of cherry-associated luteovirus South Korean isolate (ChALV-SK, genus Luteovirus), was discovered in this work. It is provisionally named apple-associated luteovirus (AaLV). The complete genome sequence of AaLV comprises 5,890 nt and contains eight open reading frames (ORFs), in a very similar arrangement that is typical of members of the genus Luteovirus. When compared with other members of the family Luteoviridae, ORF1 of AaLV was found to encompass another ORF, ORF1a, which encodes a putative 32.9-kDa protein. The ORF1-ORF2 region (RNA-dependent RNA polymerase, RdRP) showed the greatest amino acid (aa) sequence identity (59.7%) to that of cherry-associated luteovirus Czech Republic isolate (ChALV-CZ, genus Luteovirus). The results of genome sequence comparisons and phylogenetic analysis, suggest that AaLV should be a member of a novel species in the genus Luteovirus. To our knowledge, it is the sixth member of the genus Luteovirus reported to naturally infect rosaceous plants.

Complete genome sequence of yam chlorotic necrosis virus, a novel macluravirus infecting yam.

The complete genome sequence of a novel member of the genus Macluravirus was determined from yam plants with chlorotic and necrotic symptoms in China. The genomic RNA consists of 8,261 nucleotides (nt) excluding the 3'-terminal poly(A) tail, containing one long open reading frame (ORF) encoding a large putative polyprotein of 2,627 amino acids. Its genomic structure is typical of macluraviruses, which lack the P1 protein, N-terminal HC-Pro, and D-A-G motif for aphid transmission that are found in potyviruses. The virus shares 56.3-63.8% sequence identity at the genome sequence level and 49.7-63.9% at the polyprotein sequence level with other members of the genus Macluravirus. Phylogenetic analysis based on the complete polyprotein sequence of representative members of the family Potyviridae clearly places the virus within the genus Macluravirus. These results suggest that the virus, tentatively named "yam chlorotic necrosis virus" (YCNV), should be considered a member of a novel species in the genus Macluravirus.

Molecular characterization and detection of a new closterovirus identified from blackcurrant by high-throughput sequencing.

Two large contigs with high sequence similarities to several closteroviruses were identified by high-throughput sequencing from a blackcurrant plant. The complete genome of this new virus was determined to be 17,320 nucleotides. Its genome contains ten open reading frames (ORF) that include, in the 5'-3' direction, a large ORF encoding a putative viral polyprotein (ORF 1a) and nine ORFs that encode RNA-dependent RNA polymerase (RdRp, ORF 1b), p6 (ORF 2), heat shock protein 70-like protein (Hsp70h, ORF 3), Hsp-90-like protein (p61, ORF 4), CP minor (ORF 5), CP (ORF 6), p17 (ORF 7), p11 (ORF 8), and p26 (ORF 9), respectively. BCCV-1 shares nucleotide sequence identities of 43-45% with other 9 closteroviruses at genome sequences. The amino acid sequence identities between BCCV-1 and the closteroviruses were 49-55% (RdRp), 37-41% (Hsp70h), 19-33% (p61), 26-38% (CPm), and 19-28% (CP), respectively. Phylogenetic analysis of Hsp70h sequences placed the new virus with members of genus Closterovirus in the same group. The results indicate that this new virus, which is provisionally named as Blackcurrant closterovirus 1, should represent a new species of the genus Closterovirus. A RT-PCR was developed and used to detect BCCV-1 in more germplasm accessions of Ribes spp.

Genome characterization of sweet potato symptomless virus 1: a mastrevirus with an unusual nonanucleotide sequence.

Complete genomic sequences of nine isolates of sweet potato symptomless virus 1 (SPSMV-1), a virus of the genus Mastrevirus in the family Geminiviridae, were determined from sweet potato accessions from different countries and found to be 2,559-2,602 nucleotides in length. These isolates shared 97-100% genome sequence identity and had an unusual nonanucleotide sequence (TAAGATTCC) in a large intergenic region as well as an additional open reading frame, C3, which is conserved in dicot-infecting mastreviruses.