Histone Chaperone Deficiency in Arabidopsis Plants Triggers Adaptive Epigenetic Changes in Histone Variants and Modifications.

At the molecular scale, adaptive advantages during plant growth and development rely on modulation of gene expression, primarily provided by epigenetic machinery. One crucial part of this machinery is histone posttranslational modifications, which form a flexible system, driving transient changes in chromatin, and defining particular epigenetic states. Posttranslational modifications work in concert with replication-independent histone variants further adapted for transcriptional regulation and chromatin repair. However, little is known about how such complex regulatory pathways are orchestrated and interconnected in cells. In this work, we demonstrate the utility of mass spectrometry-based approaches to explore how different epigenetic layers interact in Arabidopsis mutants lacking certain histone chaperones. We show that defects in histone chaperone function (e.g., chromatin assembly factor-1 or nucleosome assembly protein 1 mutations) translate into an altered epigenetic landscape, which aids the plant in mitigating internal instability. We observe changes in both the levels and distribution of H2A.W.7, altogether with partial repurposing of H3.3 and changes in the key repressive (H3K27me1/2) or euchromatic marks (H3K36me1/2). These shifts in the epigenetic profile serve as a compensatory mechanism in response to impaired integration of the H3.1 histone in the fas1 mutants. Altogether, our findings suggest that maintaining genome stability involves a two-tiered approach. The first relies on flexible adjustments in histone marks, while the second level requires the assistance of chaperones for histone variant replacement.

Histone Variant macroH2A1.1 Enhances Nonhomologous End Joining-dependent DNA Double-strand-break Repair and Reprogramming Efficiency of Human iPSCs.

DNA damage repair (DDR) is a safeguard for genome integrity maintenance. Increasing DDR efficiency could increase the yield of induced pluripotent stem cells (iPSC) upon reprogramming from somatic cells. The epigenetic mechanisms governing DDR during iPSC reprogramming are not completely understood. Our goal was to evaluate the splicing isoforms of histone variant macroH2A1, macroH2A1.1, and macroH2A1.2, as potential regulators of DDR during iPSC reprogramming. GFP-Trap one-step isolation of mtagGFP-macroH2A1.1 or mtagGFP-macroH2A1.2 fusion proteins from overexpressing human cell lines, followed by liquid chromatography-tandem mass spectrometry analysis, uncovered macroH2A1.1 exclusive interaction with Poly-ADP Ribose Polymerase 1 (PARP1) and X-ray cross-complementing protein 1 (XRCC1). MacroH2A1.1 overexpression in U2OS-GFP reporter cells enhanced specifically nonhomologous end joining (NHEJ) repair pathway, while macroH2A1.1 knock-out (KO) mice showed an impaired DDR capacity. The exclusive interaction of macroH2A1.1, but not macroH2A1.2, with PARP1/XRCC1, was confirmed in human umbilical vein endothelial cells (HUVEC) undergoing reprogramming into iPSC through episomal vectors. In HUVEC, macroH2A1.1 overexpression activated transcriptional programs that enhanced DDR and reprogramming. Consistently, macroH2A1.1 but not macroH2A1.2 overexpression improved iPSC reprogramming. We propose the macroH2A1 splicing isoform macroH2A1.1 as a promising epigenetic target to improve iPSC genome stability and therapeutic potential.

Trimethylacetic Anhydride-Based Derivatization Facilitates Quantification of Histone Marks at the MS1 Level.

Histone post-translational modifications (hPTMs) are epigenetic marks that strongly affect numerous processes, including cell cycling and protein interactions. They have been studied by both antibody- and MS-based methods for years, but the analyses are still challenging, mainly because of the diversity of histones and their modifications arising from high contents of reactive amine groups in their amino acid sequences. Here, we introduce use of trimethylacetic anhydride (TMA) as a new reagent for efficient histone derivatization, which is a requirement for bottom-up proteomic hPTM analysis. TMA can derivatize unmodified amine groups of lysine residues and amine groups generated at peptide N-termini by trypsin digestion. The derivatization is facilitated by microwave irradiation, which also reduces incubation times to minutes. We demonstrate that histone derivatization with TMA reliably provides high yields of fully derivatized peptides and thus is an effective alternative to conventional methods. TMA afforded more than 98% and 99% labeling efficiencies for histones H4 and H3, respectively, thereby enabling accurate quantification of peptide forms. Trimethylacetylation substantially improves chromatographic separation of peptide forms, which is essential for direct quantification based on signals extracted from MS1 data. For this purpose, software widely applied by the proteomics community can be used without additional computational development. Thorough comparison with widely applied propionylation highlights the advantages of TMA-based histone derivatization for monitoring hPTMs in biological samples.

Disruption of NAP1 genes in Arabidopsis thaliana suppresses the fas1 mutant phenotype, enhances genome stability and changes chromatin compaction.

Histone chaperones mediate the assembly and disassembly of nucleosomes and participate in essentially all DNA-dependent cellular processes. In Arabidopsis thaliana, loss-of-function of FAS1 or FAS2 subunits of the H3-H4 histone chaperone complex CHROMATIN ASSEMBLY FACTOR 1 (CAF-1) has a dramatic effect on plant morphology, growth and overall fitness. CAF-1 dysfunction can lead to altered chromatin compaction, systematic loss of repetitive elements or increased DNA damage, clearly demonstrating its severity. How chromatin composition is maintained without functional CAF-1 remains elusive. Here we show that disruption of the H2A-H2B histone chaperone NUCLEOSOME ASSEMBLY PROTEIN 1 (NAP1) suppresses the FAS1 loss-of-function phenotype. The quadruple mutant fas1 nap1;1 nap1;2 nap1;3 shows wild-type growth, decreased sensitivity to genotoxic stress and suppression of telomere and 45S rDNA loss. Chromatin of fas1 nap1;1 nap1;2 nap1;3 plants is less accessible to micrococcal nuclease and the nuclear H3.1 and H3.3 histone pools change compared to fas1. Consistently, association between NAP1 and H3 occurs in the cytoplasm and nucleus in vivo in protoplasts. Altogether we show that NAP1 proteins play an essential role in DNA repair in fas1, which is coupled to nucleosome assembly through modulation of H3 levels in the nucleus.

Different Modes of Action of Genetic and Chemical Downregulation of Histone Deacetylases with Respect to Plant Development and Histone Modifications.

A high degree of developmental plasticity enables plants to adapt to continuous, often unfavorable and unpredictable changes in their environment. At the molecular level, adaptive advantages for plants are primarily provided by epigenetic machinery including DNA methylation, histone modifications, and the activity of noncoding RNA molecules. Using a mass spectrometry-based proteomic approach, we examined the levels of acetylated histone peptide forms in Arabidopsis plants with a loss of function of histone deacetylase 6 (HDA6), and in plants germinated in the presence of HDA inhibitors trichostatin A (TSA) and sodium butyrate (NaB). Our analyses revealed particular lysine sites at histone sequences targeted by the HDA6 enzyme, and by TSA- and NaB-sensitive HDAs. Compared with plants exposed to drugs, more dramatic changes in the overall profiles of histone post-translational modifications were identified in hda6 mutants. However, loss of HDA6 was not sufficient by itself to induce hyperacetylation to the maximum degree, implying complementary activities of other HDAs. In contrast to hda6 mutants that did not exhibit any obvious phenotypic defects, the phenotypes of seedlings exposed to HDA inhibitors were markedly affected, showing that the effect of these drugs on early plant development is not limited to the modulation of histone acetylation levels.

Post-Translational Modifications of Histones in Human Sperm.

We examined the levels and distribution of post-translationally modified histones and protamines in human sperm. Using western blot immunoassay, immunofluorescence, mass spectrometry (MS), and FLIM-FRET approaches, we analyzed the status of histone modifications and the protamine P2. Among individual samples, we observed variability in the levels of H3K9me1, H3K9me2, H3K27me3, H3K36me3, and H3K79me1, but the level of acetylated (ac) histones H4 was relatively stable in the sperm head fractions, as demonstrated by western blot analysis. Sperm heads with lower levels of P2 exhibited lower levels of H3K9ac, H3K9me1, H3K27me3, H3K36me3, and H3K79me1. A very strong correlation was observed between the levels of P2 and H3K9me2. FLIM-FRET analysis additionally revealed that acetylated histones H4 are not only parts of sperm chromatin but also appear in a non-integrated form. Intriguingly, H4ac and H3K27me3 were detected in sperm tail fractions via western blot analysis. An appearance of specific histone H3 and H4 acetylation and H3 methylation in sperm tail fractions was also confirmed by both LC-MS/MS and MALDI-TOF MS analysis. Taken together, these data indicate that particular post-translational modifications of histones are uniquely distributed in human sperm, and this distribution varies among individuals and among the sperm of a single individual.

Cell differentiation along multiple pathways accompanied by changes in histone acetylation status.

Post-translational modification of histones is fundamental to the regulation of basic nuclear processes and subsequent cellular events, including differentiation. In this study, we analyzed acetylated forms of histones H2A, H2B, and H4 during induced differentiation in mouse (mESCs) and human (hESCs) embryonic stem cells and during induced enterocytic differentiation of colon cancer cells in vitro. Endoderm-like differentiation of mESCs induced by retinoic acid and enterocytic differentiation induced by histone deacetylase inhibitor sodium butyrate were accompanied by increased mono-, di-, and tri-acetylation of histone H2B and a pronounced increase in di- and tri-acetylation of histone H4. In enterocytes, mono-acetylation of histone H2A also increased and tetra-acetylation of histone H4 appeared only after induction of this differentiation pathway. During differentiation of hESCs, we observed increased mono-acetylation and decreased tri-acetylation of H2B. Mono-, di-, and tri-acetylation of H4 were reduced, manifested by a significant increase in nonacetylated H4 histones. Levels of acetylated histones increased during induced differentiation in mESCs and during histone deacetylase (HDAC) inhibitor-induced enterocytic differentiation, whereas differentiation of human ESCs was associated with reduced acetylation of histones H2B and H4.

Preventing the mixed detergent micelle effect in two-dimensional electrophoresis on Tris-Tricine gels.

Application of Tris-N-[Tris(hydroxymethyl)methyl]glycine gels for 2DE is hampered by formation of mixed CHAPS-SDS micelles resulting in typical swirling pattern in the low mass range, which makes reliable quantitative and qualitative gel evaluation impossible. Modification of 2DE strip equilibration procedure prevented the direct interaction between both detergents during equilibration process, thus substantially improving gel separation.

Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene.

An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.

Unraveling Epigenetic Changes in A. thaliana Calli: Impact of HDAC Inhibitors.

The ability for plant regeneration from dedifferentiated cells opens up the possibility for molecular bioengineering to produce crops with desirable traits. Developmental and environmental signals that control cell totipotency are regulated by gene expression via dynamic chromatin remodeling. Using a mass spectrometry-based approach, we investigated epigenetic changes to the histone proteins during callus formation from roots and shoots of Arabidopsis thaliana seedlings. Increased levels of the histone H3.3 variant were found to be the major and most prominent feature of 20-day calli, associated with chromatin relaxation. The methylation status in root- and shoot-derived calli reached the same level during long-term propagation, whereas differences in acetylation levels provided a long-lasting imprint of root and shoot origin. On the other hand, epigenetic signs of origin completely disappeared during 20 days of calli propagation in the presence of histone deacetylase inhibitors (HDACi), sodium butyrate, and trichostatin A. Each HDACi affected the state of post-translational histone modifications in a specific manner; NaB-treated calli were epigenetically more similar to root-derived calli, and TSA-treated calli resembled shoot-derived calli.

The Highest Density of Phosphorylated Histone H1 Appeared in Prophase and Prometaphase in Parallel with Reduced H3K9me3, and HDAC1 Depletion Increased H1.2/H1.3 and H1.4 Serine 38 Phosphorylation.

BACKGROUND: Variants of linker histone H1 are tissue-specific and are responsible for chromatin compaction accompanying cell differentiation, mitotic chromosome condensation, and apoptosis. Heterochromatinization, as the main feature of these processes, is also associated with pronounced trimethylation of histones H3 at the lysine 9 position (H3K9me3). METHODS: By confocal microscopy, we analyzed cell cycle-dependent levels and distribution of phosphorylated histone H1 (H1ph) and H3K9me3. By mass spectrometry, we studied post-translational modifications of linker histones. RESULTS: Phosphorylated histone H1, similarly to H3K9me3, has a comparable level in the G1, S, and G2 phases of the cell cycle. A high density of phosphorylated H1 was inside nucleoli of mouse embryonic stem cells (ESCs). H1ph was also abundant in prophase and prometaphase, while H1ph was absent in anaphase and telophase. H3K9me3 surrounded chromosomal DNA in telophase. This histone modification was barely detectable in the early phases of mitosis. Mass spectrometry revealed several ESC-specific phosphorylation sites of H1. HDAC1 depletion did not change H1 acetylation but potentiated phosphorylation of H1.2/H1.3 and H1.4 at serine 38 positions. CONCLUSIONS: Differences in the level and distribution of H1ph and H3K9me3 were revealed during mitotic phases. ESC-specific phosphorylation sites were identified in a linker histone.

Quantitative Analysis of Posttranslational Modifications of Plant Histones.

Reshaping of the chromatin landscape under oxidative stress is of paramount importance for mounting an effective stress response. Unbiased systemic identification and quantification of histone marks is crucial for understanding the epigenetic component of plant responses to adverse environmental conditions. We describe a detailed method for isolation of plant histones and subsequent bottom-up proteomics approach for characterization of acetylation and methylation status. By performing label-free quantitative mass spectrometry analysis, relative abundances of histone marks can be statistically compared between experimental conditions.

Quantitative Acetylomics Uncover Acetylation-Mediated Pathway Changes Following Histone Deacetylase Inhibition in Anaplastic Large Cell Lymphoma.

Histone deacetylases (HDACs) target acetylated lysine residues in histone and non-histone proteins. HDACs are implicated in the regulation of genomic stability, cell cycle, cell death and differentiation and thus critically involved in tumorigenesis. Further, HDACs regulate T-cell development and HDAC inhibitors (HDACis) have been approved for clinical use in some T-cell malignancies. Still, the exact targets and mechanisms of HDAC inhibition in cancer are understudied. We isolated tumor cell lines from a transgenic mouse model of anaplastic large cell lymphoma (ALCL), a rare T-cell lymphoma, and abrogated HDAC activity by treatment with the HDACis Vorinostat and Entinostat or Cre-mediated deletion of Hdac1. Changes in overall protein expression as well as histone and protein acetylation were measured following Hdac1 deletion or pharmacological inhibition using label-free liquid chromatography mass spectrometry (LC-MS/MS). We found changes in overall protein abundance and increased acetylation of histones and non-histone proteins, many of which were newly discovered and associated with major metabolic and DNA damage pathways. For non-histone acetylation, we mapped a total of 1204 acetylated peptides corresponding to 603 proteins, including chromatin modifying proteins and transcription factors. Hyperacetylated proteins were involved in processes such as transcription, RNA metabolism and DNA damage repair (DDR). The DDR pathway was majorly affected by hyperacetylation following HDAC inhibition. This included acetylation of H2AX, PARP1 and previously unrecognized acetylation sites in TP53BP1. Our data provide a comprehensive view of the targets of HDAC inhibition in malignant T cells with general applicability and could have translational impact for the treatment of ALCL with HDACis alone or in combination therapies.

Phosphorylation within Intrinsic Disordered Region Discriminates Histone Variant macroH2A1 Splicing Isoforms-macroH2A1.1 and macroH2A1.2.

Background: Gene expression in eukaryotic cells can be governed by histone variants, which replace replication-coupled histones, conferring unique chromatin properties. MacroH2A1 is a histone H2A variant containing a domain highly similar to H2A and a large non-histone (macro) domain. MacroH2A1, in turn, is present in two alternatively exon-spliced isoforms: macroH2A1.1 and macroH2A1.2, which regulate cell plasticity and proliferation in a remarkably distinct manner. The N-terminal and the C-terminal tails of H2A histones stem from the nucleosome core structure and can be target sites for several post-translational modifications (PTMs). MacroH2A1.1 and macroH2A1.2 isoforms differ only in a few amino acids and their ability to bind NAD-derived metabolites, a property allegedly conferring their different functions in vivo. Some of the modifications on the macroH2A1 variant have been identified, such as phosphorylation (T129, S138) and methylation (K18, K123, K239). However, no study to our knowledge has analyzed extensively, and in parallel, the PTM pattern of macroH2A1.1 and macroH2A1.2 in the same experimental setting, which could facilitate the understanding of their distinct biological functions in health and disease. Methods: We used a mass spectrometry-based approach to identify the sites for phosphorylation, acetylation, and methylation in green fluorescent protein (GFP)-tagged macroH2A1.1 and macroH2A1.2 expressed in human hepatoma cells. The impact of selected PTMs on macroH2A1.1 and macroH2A1.2 structure and function are demonstrated using computational analyses. Results: We identified K7 as a new acetylation site in both macroH2A1 isoforms. Quantitative comparison of histone marks between the two isoforms revealed significant differences in the levels of phosphorylated T129 and S170. Our computational analysis provided evidence that the phosphorylation status in the intrinsically disordered linker region in macroH2A1 isoforms might represent a key regulatory element contributing to their distinct biological responses. Conclusions: Taken together, our results report different PTMs on the two macroH2A1 splicing isoforms as responsible for their distinct features and distribution in the cell.

DNA Damage Changes Distribution Pattern and Levels of HP1 Protein Isoforms in the Nucleolus and Increases Phosphorylation of HP1ß-Ser88.

The family of heterochromatin protein 1 (HP1) isoforms is essential for chromatin packaging, regulation of gene expression, and repair of damaged DNA. Here we document that γ-radiation reduced the number of HP1α-positive foci, but not HP1ß and HP1γ foci, located in the vicinity of the fibrillarin-positive region of the nucleolus. The additional analysis confirmed that γ-radiation has the ability to significantly decrease the level of HP1α in rDNA promoter and rDNA encoding 28S rRNA. By mass spectrometry, we showed that treatment by γ-rays enhanced the HP1ß serine 88 phosphorylation (S88ph), but other analyzed modifications of HP1ß, including S161ph/Y163ph, S171ph, and S174ph, were not changed in cells exposed to γ-rays or treated by the HDAC inhibitor (HDACi). Interestingly, a combination of HDACi and γ-radiation increased the level of HP1α and HP1γ. The level of HP1ß remained identical before and after the HDACi/γ-rays treatment, but HDACi strengthened HP1ß interaction with the KRAB-associated protein 1 (KAP1) protein. Conversely, HP1γ did not interact with KAP1, although approximately 40% of HP1γ foci co-localized with accumulated KAP1. Especially HP1γ foci at the periphery of nucleoli were mostly absent of KAP1. Together, DNA damage changed the morphology, levels, and interaction properties of HP1 isoforms. Also, γ-irradiation-induced hyperphosphorylation of the HP1ß protein; thus, HP1ß-S88ph could be considered as an important marker of DNA damage.

Cytokinin-induced photomorphogenesis in dark-grown Arabidopsis: a proteomic analysis.

High concentrations of cytokinins (CKs) in the cultivation medium can induce partial photomorphogenesis in dark-grown Arabidopsis seedlings. However, no significant increases in endogenous CK levels have been found in de-etiolated mutants, suggesting that either parallel pathways are involved in the light and CK responses, or changes in the sensitivity to CKs occur during photomorphogenesis. Here it is shown that even modest increases in endogenous CK levels induced by transgenic expression of the CK biosynthetic gene, ipt, can lead to many typical features of light-induced de-etiolation, including inhibition of hypocotyl elongation and partial cotyledon opening. In addition, significant changes in expression of 37 proteins (mostly related to chloroplast biogenesis, a major element of light-induced photomorphogenesis) were detected by image and mass spectrometric analysis of two-dimensionally separated proteins. The identified chloroplast proteins were all up-regulated in response to increased CKs, and more than half are up-regulated at the transcript level during light-induced photomorphogenesis according to previously published transcriptomic data. Four of the up-regulated chloroplast proteins identified here have also been shown to be up-regulated during light-induced photomorphogenesis in previous proteomic analyses. In contrast, all differentially regulated mitochondrial proteins (the second largest group of differentially expressed proteins) were down-regulated. Changes in the levels of several tubulins are consistent with the observed morphological alterations. Further, 10 out of the 37 differentially expressed proteins detected have not been linked to either photomorphogenesis or CK action in light-grown Arabidopsis seedlings in previously published transcriptomic or proteomic analyses.

Filter-Aided Sample Preparation Procedure for Mass Spectrometric Analysis of Plant Histones.

Characterization of histone post-translational modifications (PTMs) is still challenging, and robust histone sample preparation is essential for convincing evaluation of PTMs by mass spectrometry. An effective protocol for extracting plant histone proteins must also avoid excessive co-extraction of the numerous potential interfering compounds, including those related to secondary metabolism. Currently, the co-existence of histone marks is addressed mostly by shotgun proteomic analysis following chemical derivatization of histone lysine residues. Here, we report a straightforward approach for plant histone sample preparation for mass spectrometry, based on filter-aided sample preparation coupled with histone propionylation. The approach offers savings in sample handling and preparation time, enables removal of interfering compounds from the sample, and does not require either precipitation or dialysis of histone extract. We show the comparison of two protocol variants for derivatization of histone proteins, in-solution propionylation in the vial and propionylation on the filter unit. For both protocols, we obtained identical abundances of post-translationally modified histone peptides. Although shorter time is required for histone protein labeling on the filter unit, in-solution derivatization slightly outweighed filter-based variant by lower data variability. Nevertheless, both protocol variants appear to be efficient and convenient approach for preparation of plant histones for mass spectrometric analysis.

Irradiation by γ-rays reduces the level of H3S10 phosphorylation and weakens the G2 phase-dependent interaction between H3S10 phosphorylation and γH2AX.

Histone posttranslational modifications regulate diverse nuclear functions, including DNA repair. Here, we use mass spectrometry, western blotting, immunohistochemistry and advanced confocal microscopy in order to show radiation-specific changes in the histone signature. We studied wild-type mouse embryonic stem cells (mESCs) and mESCs with a depletion of histone deacetylase 1 (HDAC1), which plays a role in DNA repair. Irradiation by γ-rays increased the S139 phosphorylation of histone H2AX but reduced the level of the H3K9-R17 peptide, which contains S10 phosphorylation (H3S10ph). On an individual cellular level, H3S10ph was low in highly γH2AX-positive UV laser-induced DNA lesions, and this nuclear distribution pattern was not changed by HDAC1 depletion. Despite this fact, spontaneous γH2AX-positive DNA lesions colocalized with large H3S10ph-positive nuclear bodies that appear in the G2 phase of the cell cycle. Similarly, by FLIM-FRET analysis, we observed an interaction between H3S10ph and γH2AX in the G2 phase. However, this interaction was reduced when cells were exposed to γ-rays. A mutual link between H3S10ph and γH2AX was not observed in the G1 phase of the cell cycle. Together, our data show that despite the fact that H3S10ph is not directly involved in DNA repair, a decrease in H3S10 phosphorylation and weakened interaction between H3S10ph and γH2AX is a result of radiation-induced damage of the genome. In this case, γ-irradiation also decreased the number of cells in the G1 phase, characterized by no interaction between H3S10ph and γH2AX.

Variations of Histone Modification Patterns: Contributions of Inter-plant Variability and Technical Factors.

Inter-individual variability of conspecific plants is governed by differences in their genetically determined growth and development traits, environmental conditions, and adaptive responses under epigenetic control involving histone post-translational modifications. The apparent variability in histone modifications among plants might be increased by technical variation introduced in sample processing during epigenetic analyses. Thus, to detect true variations in epigenetic histone patterns associated with given factors, the basal variability among samples that is not associated with them must be estimated. To improve knowledge of relative contribution of biological and technical variation, mass spectrometry was used to examine histone modification patterns (acetylation and methylation) among Arabidopsis thaliana plants of ecotypes Columbia 0 (Col-0) and Wassilewskija (Ws) homogenized by two techniques (grinding in a cryomill or with a mortar and pestle). We found little difference in histone modification profiles between the ecotypes. However, in comparison of the biological and technical components of variability, we found consistently higher inter-individual variability in histone mark levels among Ws plants than among Col-0 plants (grown from seeds collected either from single plants or sets of plants). Thus, more replicates of Ws would be needed for rigorous analysis of epigenetic marks. Regarding technical variability, the cryomill introduced detectably more heterogeneity in the data than the mortar and pestle treatment, but mass spectrometric analyses had minor apparent effects. Our study shows that it is essential to consider inter-sample variance and estimate suitable numbers of biological replicates for statistical analysis for each studied organism when investigating changes in epigenetic histone profiles.

Epigenetic aspects of HP1 exchange kinetics in apoptotic chromatin.

Apoptotic bodies are the most condensed form of chromatin. In general, chromatin structure and function are mostly dictated by histone post-translational modifications. Thus, we have analyzed the histone signature in apoptotic cells, characterized by pronounced chromatin condensation. Here, H2B mono-acetylation, and H3K9 and H4 acetylation was significantly decreased in apoptotic cells, which maintained a high level of H3K9 methylation. This phenotype was independent of p53 function and distinct levels of anti-apoptotic Bcl2 protein. Interestingly, after etoposide treatment of leukemia and multiple myeloma cells, H3K9 and H4 hypoacetylation was accompanied by increased H3K9me2, but not H3K9me1 or H3K9me3. In adherent mouse fibroblasts, a high level of H3K9me3 and histone deacetylation in apoptotic bodies was likely responsible for the pronounced (∼40%) recovery of GFP-HP1α and GFP-HP1ß after photobleaching. HP1 mobility in apoptotic cells appeared to be unique because limited exchange after photobleaching was observed for other epigenetically important proteins, including GFP-JMJD2b histone demethylase (∼10% fluorescence recovery) or Polycomb group-related GFP-BMI1 protein (∼20% fluorescence recovery). These findings imply a novel fact that only certain subset of proteins in apoptotic bodies is dynamic.