Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 163
Filtrar
Más filtros

Banco de datos
País/Región como asunto
Tipo del documento
Intervalo de año de publicación
1.
EMBO J ; 40(22): e108065, 2021 11 15.
Artículo en Inglés | MEDLINE | ID: mdl-34487377

RESUMEN

The pyruvate kinase M2 isoform (PKM2) is preferentially expressed in cancer cells to regulate anabolic metabolism. Although PKM2 was recently reported to regulate lipid homeostasis, the molecular mechanism remains unclear. Herein, we discovered an ER transmembrane protein 33 (TMEM33) as a downstream effector of PKM2 that regulates activation of SREBPs and lipid metabolism. Loss of PKM2 leads to up-regulation of TMEM33, which recruits RNF5, an E3 ligase, to promote SREBP-cleavage activating protein (SCAP) degradation. TMEM33 is transcriptionally regulated by nuclear factor erythroid 2-like 1 (NRF1), whose cleavage and activation are controlled by PKM2 levels. Total plasma cholesterol levels are elevated by either treatment with PKM2 tetramer-promoting agent TEPP-46 or by global PKM2 knockout in mice, highlighting the essential function of PKM2 in lipid metabolism. Although depletion of PKM2 decreases cancer cell growth, global PKM2 knockout accelerates allografted tumor growth. Together, our findings reveal the cell-autonomous and systemic effects of PKM2 in lipid homeostasis and carcinogenesis, as well as TMEM33 as a bona fide regulator of lipid metabolism.


Asunto(s)
Proteínas Portadoras/metabolismo , Péptidos y Proteínas de Señalización Intracelular/metabolismo , Metabolismo de los Lípidos/fisiología , Proteínas de la Membrana/metabolismo , Hormonas Tiroideas/metabolismo , Animales , Neoplasias de la Mama/genética , Neoplasias de la Mama/metabolismo , Proteínas Portadoras/genética , Línea Celular Tumoral , Colesterol/sangre , Femenino , Regulación Neoplásica de la Expresión Génica , Homeostasis , Humanos , Péptidos y Proteínas de Señalización Intracelular/genética , Proteínas de la Membrana/genética , Ratones Noqueados , Proteína 1 de Unión a los Elementos Reguladores de Esteroles/metabolismo , Hormonas Tiroideas/genética , Ensayos Antitumor por Modelo de Xenoinjerto , Proteínas de Unión a Hormona Tiroide
2.
Anal Chem ; 96(23): 9379-9389, 2024 06 11.
Artículo en Inglés | MEDLINE | ID: mdl-38805056

RESUMEN

Over the years, a number of state-of-the-art data analysis tools have been developed to provide a comprehensive analysis of data collected from gas chromatography-mass spectrometry (GC-MS). Unfortunately, the time shift problem remains unsolved in these tools. Here, we developed a novel comprehensive data analysis strategy for GC-MS-based untargeted metabolomics (AntDAS-GCMS) to perform total ion chromatogram peak detection, peak resolution, time shift correction, component registration, statistical analysis, and compound identification. Time shift correction was specifically optimized in this work. The information on mass spectra and elution profiles of compounds was used to search for inherent landmarks within analyzed samples to resolve the time shift problem across samples efficiently and accurately. The performance of our AntDAS-GCMS was comprehensively investigated by using four complex GC-MS data sets with various types of time shift problems. Meanwhile, AntDAS-GCMS was compared with advanced GC-MS data analysis tools and classic time shift correction methods. Results indicated that AntDAS-GCMS could achieve the best performance compared to the other methods.


Asunto(s)
Cromatografía de Gases y Espectrometría de Masas , Metabolómica , Cromatografía de Gases y Espectrometría de Masas/métodos , Metabolómica/métodos , Animales , Factores de Tiempo , Análisis de Datos
3.
Cytotherapy ; 2024 Aug 08.
Artículo en Inglés | MEDLINE | ID: mdl-39207345

RESUMEN

BACKGROUND AIMS: The immunomodulatory capacity of mesenchymal stem/stromal cells (MSCs) is a key feature that makes them particularly valuable for regenerative medicine. However, this potential is affected by the chronological aging of the donors and the cell expansion procedures in culture. We have demonstrated that GATA binding protein 6 (GATA6) plays a pivotal role in the aging of MSCs and inhibiting GATA6 rejuvenates the characteristics of MSCs. METHODS: In this study, we compared the immunomodulatory capabilities of young and old MSC models, using induced pluripotent stem cells-derived rejuvenated MSCs (rMSCs) and their parental MSCs (pMSCs), respectively, to identify a key mechanism involved in the differential regulation of these capabilities. Additionally, we explored the role of GATA6 in mediating the mechanism. RESULTS: Our results demonstrated that rMSCs exhibited downregulated aging-associated regulators, including p53, p21 and GATA6, and showed enhanced suppression of T cell proliferation compared to pMSCs. Through analyzing our previous RNA-seq data and employing target gene knockdown, we determined both suppressors of cytokine signaling 3 (SOCS3) and interleukin 6 were involved in GATA6-induced regulation, collectively affecting the expression of programmed death ligand 1 (PDL1) in both pMSCs and rMSCs. CONCLUSIONS: Our findings underline the significance of the GATA6/SOCS3/PDL1 pathway in regulating aging-associated changes in MSC immunomodulatory activity, providing valuable insights into the potential use of rMSCs in the treatment of immune diseases and regenerative medicine.

4.
BMC Womens Health ; 24(1): 81, 2024 01 31.
Artículo en Inglés | MEDLINE | ID: mdl-38297248

RESUMEN

OBJECTIVE: To analyze recurrent factors in patients with clinical early-stage cervical cancer (ESCC) following hysterectomy and adjuvant radiotherapy. METHODS: We collected data from patients with ESCC, staged according to the 2009 Federation International of Gynecology and Obstetrics (FIGO) staging criteria, who underwent hysterectomy followed by adjuvant radiotherapy between 2012 and 2019. These patients were subsequently restaged using the 2018 FIGO criteria. Univariable and multivariable analyses, along with nomogram analyses, were conducted to explore factors associated with recurrence-free survival (RFS). RESULTS: A total of 310 patients met the inclusion criteria, with a median follow-up time of 46 months. Among them, 126 patients with ESCC were restaged to stage III C1 or III C2 after surgery due to lymph node metastasis (LNM) based on the 2018 FIGO staging criteria. Of these, 60 (19.3%) experienced relapse. The 1-, 3-, and 5-year RFS rates were 93.9%, 82.7%, and 79.3%, respectively. Multivariate analysis revealed that the number of positive lymph nodes (LNs), tumor diameter (TD) > 4 cm, and parametrial invasion (PI) were associated with recurrence. The nomogram indicated their predictive value for 3-year and 5-year RFS. Notably, the 5-year recurrence rate (RR) increased by 30.2% in patients with LNM, particularly those with ≥ 3 positive LNs (45.5%). Patients with stage III C2 exhibited a significantly higher RR than those with IIIC1 (56.5% vs. 24.3%, p < 0.001). The 5-year RFS for patients with TD > 4 cm was 65.8%, significantly lower than for those with TD ≤ 4 cm (88.2%). Subgroup analysis revealed higher 5-year RRs in patients with stage III C2 than that in patients with III-C1 (56.5% vs. 24.3%, p < 0.001), demonstrating a significant difference in the RFS survival curve. CONCLUSION: RR in patients with clinical ESCC after hysterectomy followed by adjuvant radiotherapy is correlated with the number of positive LNs, TD > 4 cm, and PI. Emphasis should be placed on the common high-risk factor of LNM association with recurrence after radical hysterectomy in ESCC.


Asunto(s)
Neoplasias del Cuello Uterino , Femenino , Humanos , Radioterapia Adyuvante , Resultado del Tratamiento , Supervivencia sin Enfermedad , Neoplasias del Cuello Uterino/patología , Estadificación de Neoplasias , Estudios Retrospectivos , Recurrencia Local de Neoplasia/patología , Histerectomía , Escisión del Ganglio Linfático
5.
Nucleic Acids Res ; 50(4): 1969-1992, 2022 02 28.
Artículo en Inglés | MEDLINE | ID: mdl-35137163

RESUMEN

CTR9 is the scaffold subunit in polymerase-associated factor complex (PAFc), a multifunctional complex employed in multiple steps of RNA Polymerase II (RNAPII)-mediated transcription. CTR9/PAFc is well known as an evolutionarily conserved elongation factor that regulates gene activation via coupling with histone modifications enzymes. However, little is known about its function to restrain repressive histone markers. Using inducible and stable CTR9 knockdown breast cancer cell lines, we discovered that the H3K27me3 levels are strictly controlled by CTR9. Quantitative profiling of histone modifications revealed a striking increase of H3K27me3 levels upon loss of CTR9. Moreover, loss of CTR9 leads to genome-wide expansion of H3K27me3, as well as increased recruitment of PRC2 on chromatin, which can be reversed by CTR9 restoration. Further, CTR9 depletion triggers a PRC2 subtype switch from the less active PRC2.2, to the more active PRC2.1 with higher methyltransferase activity. As a consequence, CTR9 depletion generates vulnerability that renders breast cancer cells hypersensitive to PRC2 inhibitors. Our findings that CTR9 demarcates PRC2-mediated H3K27me3 levels and genomic distribution provide a unique mechanism that explains the transition from transcriptionally active chromatin states to repressive chromatin states and sheds light on the biological functions of CTR9 in development and cancer.


Asunto(s)
Neoplasias de la Mama , Histonas , Fosfoproteínas , Factores de Transcripción , Neoplasias de la Mama/genética , Línea Celular Tumoral , Cromatina , Anomalías Craneofaciales , Femenino , Histonas/genética , Histonas/metabolismo , Humanos , Fosfoproteínas/genética , Complejo Represivo Polycomb 2/metabolismo , Factores de Transcripción/genética , Factores de Transcripción/metabolismo
6.
Aesthet Surg J ; 44(5): NP329-NP336, 2024 Apr 04.
Artículo en Inglés | MEDLINE | ID: mdl-38324894

RESUMEN

BACKGROUND: Gluteal ptosis results in a severe disturbance of gluteal aesthetics. Currently, satisfactory procedures for improving gluteal ptosis are lacking. OBJECTIVES: To improve gluteal ptosis, the authors propose a novel concept of combined liposuction of the lower gluteal region and fat grafting to the upper gluteal and infragluteal regions, and verify its efficacy and safety. METHODS: Patients who underwent liposuction of the lower gluteal region combined with fat grafting to the upper gluteal and infragluteal regions between January 2020 and July 2023 were retrospectively reviewed. Postoperative changes in the gluteal ptosis grade, complications, and patient satisfaction were evaluated. RESULTS: A total of 28 patients were enrolled in this study; 21 (75.0%) patients had gluteal ptosis grade 4 and 7 (25.0%) patients had gluteal ptosis grade 5. The median fat removal volume was 210 mL, and the median fat graft injected volume was 355 mL in the gluteal region and 180 mL in the infragluteal region. All patients showed improvement in gluteal ptosis; 16 (57.1%) patients improved by 1 grade and 12 (42.9%) patients showed a 2-grade improvement. All patients were satisfied with their posttreatment outcomes. Only 1 patient showed lateral translocation of the fat graft. No other complications were observed. CONCLUSIONS: Liposuction of the lower gluteal region combined with fat grafting to the upper gluteal and infragluteal regions is effective in improving gluteal ptosis, with a low risk of complications and high patient satisfaction.


Asunto(s)
Lipectomía , Procedimientos de Cirugía Plástica , Humanos , Lipectomía/efectos adversos , Lipectomía/métodos , Estudios Retrospectivos , Procedimientos de Cirugía Plástica/efectos adversos , Satisfacción del Paciente , Nalgas/cirugía , Tejido Adiposo/trasplante
7.
Mol Cell Probes ; 71: 101921, 2023 10.
Artículo en Inglés | MEDLINE | ID: mdl-37454877

RESUMEN

BACKGROUND: Formin-related protein-1(FRL1) has reportedly been overexpressed in a variety of malignancies, such as clear cell renal cell carcinoma (ccRCC). However, the clinical value and molecular mechanisms underlying ccRCC tumorigenesis and progression in association with FRL1 remain poorly understood. METHODS: Immunohistochemical analysis was performed on 119 paraffin-embedded RCC tissue samples to detect FRL1 expression and analyze its prognostic value. Colony formation, the CCK-8 assay, flow cytometry, and in vivo nude mice subcutaneous experiments were used to identify the effects of FRL1 on growth and proliferation. In vitro tests for wound healing, migration, and invasion were used to assess the involvement of FRL1 in invasion and metastatic potential. The process of epithelial-mesenchymal transition process (EMT) and the MMP2 expression were detected in stably transfected RCC cells via western blotting, as well as in tumor tissue paraffin sections from xenograft model. RESULTS: Both FRL1 mRNA and protein levels were noticeably elevated in ccRCC cell lines and samples. Aberrant overexpression of FRL1 was associated with unfavorable clinicopathological features of ccRCC and indicated poor prognosis. Ectopic overexpression of FRL1 increased the growth-promoting traits of ccRCC cells as well as the migratory and invasive capacity of RCC cells, whereas FRL1-silencing caused the opposite results. In addition, FRL1 promoted epithelial-mesenchymal transition (EMT) and upregulated the expression of matrix metalloproteinase 2 (MMP2). Finally, overexpression of FRL1 upregulated phosphorylation level of ERK1/2 with no effect on total level of ERK1/2 in the RCC cells. MAPK/ERK inhibitor reversed the promotional effects of FRL1. CONCLUSION: FRL1 was overexpressed in ccRCC tissues and predicted poor prognosis. FRL1 contributes to invasion and aggressive phenotype of ccRCC by facilitating EMT through MAPK/MMP2 axis.


Asunto(s)
Carcinoma de Células Renales , Neoplasias Renales , Animales , Humanos , Ratones , Carcinoma de Células Renales/metabolismo , Línea Celular Tumoral , Movimiento Celular/genética , Proliferación Celular/genética , Forminas/genética , Forminas/metabolismo , Regulación Neoplásica de la Expresión Génica , Neoplasias Renales/genética , Neoplasias Renales/patología , Metaloproteinasa 2 de la Matriz/genética , Metaloproteinasa 2 de la Matriz/metabolismo , Ratones Desnudos
8.
Acta Pharmacol Sin ; 44(2): 268-287, 2023 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-35896695

RESUMEN

Fibrosis is caused by extensive deposition of extracellular matrix (ECM) components, which play a crucial role in injury repair. Fibrosis attributes to ~45% of all deaths worldwide. The molecular pathology of different fibrotic diseases varies, and a number of bioactive factors are involved in the pathogenic process. Mesenchymal stem cells (MSCs) are a type of multipotent stem cells that have promising therapeutic effects in the treatment of different diseases. Current updates of fibrotic pathogenesis reveal that residential MSCs may differentiate into myofibroblasts which lead to the fibrosis development. However, preclinical and clinical trials with autologous or allogeneic MSCs infusion demonstrate that MSCs can relieve the fibrotic diseases by modulating inflammation, regenerating damaged tissues, remodeling the ECMs, and modulating the death of stressed cells after implantation. A variety of animal models were developed to study the mechanisms behind different fibrotic tissues and test the preclinical efficacy of MSC therapy in these diseases. Furthermore, MSCs have been used for treating liver cirrhosis and pulmonary fibrosis patients in several clinical trials, leading to satisfactory clinical efficacy without severe adverse events. This review discusses the two opposite roles of residential MSCs and external MSCs in fibrotic diseases, and summarizes the current perspective of therapeutic mechanism of MSCs in fibrosis, through both laboratory study and clinical trials.


Asunto(s)
Trasplante de Células Madre Mesenquimatosas , Células Madre Mesenquimatosas , Fibrosis Pulmonar , Animales , Fibrosis , Cirrosis Hepática/terapia , Cirrosis Hepática/patología , Fibrosis Pulmonar/terapia , Fibrosis Pulmonar/patología , Inflamación/patología
9.
Curr Microbiol ; 80(9): 292, 2023 Jul 19.
Artículo en Inglés | MEDLINE | ID: mdl-37466752

RESUMEN

Arginase has shown promising potential in treating cancers by arginine deprivation therapy; however, low enzymatic activity and stability of arginase are impeding its development. This study was aimed to improve the enzymological properties of a marine bacterial arginase by carboxymethyl chitosan (CMCS) conjugation. An arginase producing marine bacterium Priestia megaterium strain P6 was isolated and identified. The novel arginase PMA from the strain was heterologously expressed, purified, and then conjugated to CMCS by ionic gelation with calcium chloride as the crosslinking agent. Enzymological properties of both PMA and CMCS-PMA conjugate were determined. The optimum temperature for PMA and CMCS-PMA at pH 7 were 60 °C and 55 °C, respectively. The optimum pH for PMA and CMCS-PMA at 37 °C were pH 10 and 9, respectively. CMCS-PMA showed higher thermostability than PMA over 55-70 °C and higher pH stability over pH 4-11 with the highest pH stability at pH 7. At 37 °C and pH of 7, i.e., around the human blood temperature and pH, CMCS-PMA was higher than the free PMA in enzymatic activity and stability by 24% and 21%, respectively. CMCS conjugation not only changed the optimum temperature, optimum pH, and enzymatic activity of PMA, but also improved its pH stability and temperature stability, and thus made it more favorable for medical application.


Asunto(s)
Arginasa , Quitosano , Humanos , Quitosano/química , Fenómenos Químicos , Temperatura , Concentración de Iones de Hidrógeno
10.
Plant Dis ; 2023 Mar 01.
Artículo en Inglés | MEDLINE | ID: mdl-36856647

RESUMEN

Maize (Zea mays L.) as the most important crops is globally cultivated for food, feedstuff and industrial raw materials. During August to September 2021, we carried out a survey on the soil-borne diseases of tobacco in Guizhou Province. Poorly developed maize plants were observed in the same field of root-knot nematode (RKN) infected tobacco (Nicotiana tabacum L.) in Dafang County, Bijie City (106º00'08"E, 22º24'81"N) (Figure 1A). Roots of maize plant were taken back to laboratory for nematode identification and infecting confirmation in greenhouse. Females, males, second-stage juveniles (J2s) and eggs were collected from the sampling roots and nematodes were identified based on morphological and molecular characteristics. The identification of the nematode was performed by observations of morphological characters of adults (n= 30) and molecular analysis. Perineal pattern of female showed distinct characteristics of a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. 1B). J2s hatched from eggs demonstrated the morphometric characters of body length = 433.25 µm, body width = 16.31 µm, stylet length = 10.43 µm. DGO = 3.62 µm, tail length = 52.78 µm, and hyaline tail terminus = 11.14 µm (Fig. 1C). For molecular analysis, females from infected roots of maize in fields and in Koch's postulate experiment were definitively identified via PCR using the M. arenaria species-specific markers (Far/Rar:TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT). PCR products of females amplification were run in the agar gel, and a PCR product of 420 bp band was identified for M. arenaria for all tested female samples (Fig. 1E). The obtained specific fragment was sequenced and submitted to GenBank with accession number of OP503512. A 100% identity of the Fare/Rare sequence with M. arenaria (Accession: GQ395518.1, J. Phytopathol. 160(2): 59-66, 2012, MZ555757.1,MZ555753.1, U42342.1)were found through NCBI blast. Therefore, based on morphological and molecular analysis, the nematodes from maize were determined to be M. arenaria according to the related description of (Perry et al., 2009). Koch's postulate was conducted in greenhouse by inoculation of J2 from the original population to pots containing two-week old maize seedlings (n= 15, 1000 J2/seedling) and 5 seedlings were nonincubated as controls. Plants were maintained in greenhouse at 26 to 28°C. On day 50 after inoculation, all the inoculated plants showed typical RKN symptoms such as stunting and galled roots which were similar to those observed in the field (Fig. 2A). Females, J2 and eggs were found in the roots after staining(Fig. 2B, C, D) by the method of Bybd et al. (1983), while uninoculated control plants presented normal development, confirming that Maize was a host of M. arenaria. M. arenaria is one of the most damaging plant-parasitic nematodes, which can infect many crops worldwide, resulting in great losses on the crop quality and yield. The Southern Root-Knot Nematode (M. incognita) had been known to cause root-knot nematode disease on maize in Shandong Province of China(Shi et al.,2020). As a major rotation crop, maize was recommended for the management of RKNs and most soil-born pathogens in tobacco planting systems in China. However, the findings of M. arenaria on maize demonstrates that further investigation and management strategies should be conduct. To our knowledge, this is the first report of M. arenaria parasitizing maize in Guizhou province of China.

11.
Molecules ; 28(4)2023 Feb 14.
Artículo en Inglés | MEDLINE | ID: mdl-36838776

RESUMEN

In order to explore the mechanism responsible for the interactions in the surfactant-polymer composite flooding and broaden the application range of the binary system in heterogeneous oil reservoirs, in this paper, the influences of different surfactants on the viscosity of two polymers with similar molecular weights, partially hydrolyzed polyacrylamide (HPAM) and hydrophobically modified polyacrylamide (HMPAM), were studied at different reservoir environments. In addition, the relationship between the surfactant-polymer synergistic effects and oil displacement efficiency was also investigated. The experimental results show that for HPAM, surfactants mainly act as an electrolyte to reduce its viscosity. For HMPAM, SDBS and TX-100 will form aggregates with the hydrophobic blocks of polymer molecules, reducing the bulk viscosity. However, zwitterionic surfactant aralkyl substituted alkyl sulfobetaine BSB molecules can build "bridges" between different polymer molecules through hydrogen bonding and electrostatic interaction. After forming aggregates with HMPAM molecules, the viscosity will increase. The presence of two polymers all weakened the surfactant oil-water interfacial membrane strength to a certain extent, but had little effect on the interfacial tension. The synergistic effect of the "bridge" between HMPAM and BSB under macroscopic conditions also occurs in the microscopic pores of the core, which has a beneficial effect on improving oil recovery.


Asunto(s)
Polímeros , Tensoactivos , Tensoactivos/química , Polímeros/química , Resinas Acrílicas/química
12.
Molecules ; 28(3)2023 Jan 28.
Artículo en Inglés | MEDLINE | ID: mdl-36770949

RESUMEN

Betaine is a new surfactant with good application prospects in high-temperature and high-salinity reservoirs. The interfacial properties of two kinds of betaine mixtures with a good synergistic effect were evaluated in this paper. On this basis, the effects of temperature-resistant, salt-resistant polymers with different contents of 2-acrylamide-2-methylpropanesulfonic acid (AMPS) on dynamic interfacial tensions (IFTs) against n-alkanes and crude oil were studied. The experimental results show that the IFTs between betaine ASB and n-alkanes can be reduced to ultra-low values by compounding with anionic surfactant petroleum sulfonate (PS) and extended anionic surfactant alkoxyethylene carboxylate (AEC), respectively. ASB@AEC is very oil-soluble with nmin value ≥14, and ASB@PS is relatively water-soluble with nmin value of 10. The water solubility of both ASB@PS and ASB@AEC is enhanced by the addition of water-soluble polymers. The HLB of the ASB@AEC solution becomes better against crude oil after the addition of polymers, and the IFT decreases to an ultra-low value as a result. On the contrary, the antagonistic effect in reducing the IFT can be observed for ASB@PS in the same case. In a word, polymers affect the IFTs of surfactant solutions by regulating the HLB.

13.
Molecules ; 28(9)2023 Apr 24.
Artículo en Inglés | MEDLINE | ID: mdl-37175098

RESUMEN

With the increased incidence of wine fraud, a fast and reliable method for wine certification has become a necessary prerequisite for the vigorous development of the global wine industry. In this study, a classification strategy based on three-dimensional fluorescence spectroscopy combined with chemometrics was proposed for oak-barrel and stainless steel tanks with oak chips aged wines. Principal component analysis (PCA), partial least squares analysis (PLS-DA), and Fisher discriminant analysis (FDA) were used to distinguish and evaluate the data matrix of the three-dimensional fluorescence spectra of wines. The results showed that FDA was superior to PCA and PLS-DA in classifying oak-barrel and stainless steel tanks with oak chips aged wines. As a general conclusion, three-dimensional fluorescence spectroscopy can provide valuable fingerprint information for the identification of oak-barrel and stainless steel tanks with oak chips aged wines, while the study will provide some theoretical references and standards for the quality control and quality assessment of oak-barrel aged wines.


Asunto(s)
Quercus , Vino , Vino/análisis , Acero Inoxidable , Quercus/química , Espectrometría de Fluorescencia , Quimiometría , Madera/química
14.
Aesthet Surg J ; 43(5): 527-534, 2023 04 10.
Artículo en Inglés | MEDLINE | ID: mdl-36594173

RESUMEN

BACKGROUND: Fullness of the perioral mound is considered a dissatisfying aspect of premature aging and has become a common complaint of patients seeking facial rejuvenation. OBJECTIVES: The authors propose a novel concept of improving perioral mound fullness by liposuction and verify its safety and efficacy through cadaver and clinical studies. METHODS: A cadaver study was conducted to discover the soft tissue structure of the perioral mound region and identify a vital use for liposuction. For clinical evaluation, 37 patients with perioral mound fullness who underwent liposuction were retrospectively reviewed. RESULTS: The cadaver study results showed moderate fatty tissue in the subcutaneous layer of the perioral mound region. The liposuction manipulation was limited to the subcutaneous fat layer. Among the 37 patients (including 74 perioral mound regions), the median fat removal volume per perioral mound region was 2.0 (1.2, 2.3) mL. After liposuction, the subcutaneous fat thickness significantly decreased (median 5.0 [3.9, 6.6] mm vs 0.7 [0.4, 1.0] mm per perioral mound region, P < .001). All patients were satisfied with their posttreatment outcomes. Two patients (5.4%) had slight skin hyperpigmentation in the liposuction area after treatment and recovered naturally in 3 months without any intervention. No other complications were noted. CONCLUSIONS: Liposuction is effective in improving perioral mound fullness with a low risk of complications.


Asunto(s)
Lipectomía , Humanos , Lipectomía/efectos adversos , Lipectomía/métodos , Estudios Retrospectivos , Cara , Tejido Adiposo , Cadáver
15.
Artículo en Inglés | MEDLINE | ID: mdl-35834405

RESUMEN

An actinobacterial strain, designated R-N-C8T, was isolated from the rhizosphere soil of Arabidopsis thaliana collected in Yunnan Province, south-west China. Based on the results of 16S rRNA gene sequence analysis, strain R-N-C8T had highest similarity to Nocardioides terrae CGMCC 1.7056T (96.5%), Nocardioides opuntiae KCTC 19804T (96.3%) and Nocardioides currus IB-3T (96.1%), and lower than 96.0 % similarity to other members of the genus Nocardioides. Phylogenetic trees based on 16S rRNA gene sequences indicated that strain R-N-C8T formed an isolated branch with N. terrae CGMCC 1.7056T and N. opuntiae KCTC 19804T. The polar lipids contained phosphatidylglycerol, diphosphatidylglycerol, one unidentified phosphoglycolipid and four unidentified phospholipids in the cellular membrane. The major fatty acids were identified as iso-C16 : 0, anteiso-C17 : 0, iso-C17 : 0, summed feature 9 (iso-C17 : 1 ω9c and/or C16 : 0 10-methyl) and iso-C15 : 0. The predominant respiratory quinone was MK-8(H4) and ll-diaminopimelic acid was the diagnostic diamino acid in the cell-wall peptidoglycan. The genomic DNA G+C content was 70.9 mol%. The orthologous average nucleotide identiy values between N. terrae CGMCC 1.7056T, N. currus IB-3T and strain R-N-C8T were 77.1 and 75.1 %, respectively. DNA-DNA hybridization values between N. terrae CGMCC 1.7056T, N. currus IB-3T and strain R-N-C8T were 20.7 and 19.9 % respectively. Data from phenotypic and genotypic analyses supported that strain R-N-C8T represents a new species of Nocardioides, for which the name Nocardioides nematodiphilus sp. nov. is proposed. The type strain is R-N-C8T (=CGMCC 1.18723T= KCTC 49528T).


Asunto(s)
Actinomycetales , Arabidopsis , Técnicas de Tipificación Bacteriana , Composición de Base , China , ADN Bacteriano/genética , Ácidos Grasos/química , Nocardioides , Fosfolípidos/química , Filogenia , ARN Ribosómico 16S/genética , Rizosfera , Análisis de Secuencia de ADN , Microbiología del Suelo
16.
Mol Cell Probes ; 66: 101867, 2022 12.
Artículo en Inglés | MEDLINE | ID: mdl-36183925

RESUMEN

BACKGROUND: Cancer stem cells (CSCs) have an key role in the beginning, progression and treatment of bladder cancer. In the current study, our target was to identify CSCS-related genes in bladder cancer. METHODS: Bladder cancer (BLCA) transcriptome data were acquired from The Cancer Genome Atlas (TCGA) database. WGCNA was used to screen genes connected with the mRNA expression-based stemness index (mRNAsi).Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were used to analyze the biological function of mRNAsi-related genes. Univariate Cox regression and LASSO Cox regression algorithms were applied to build a risk score model. Additionally, a ceRNA regulatory netwok based on key mRNAsi-related genes was established via TargetScan, miRDB, miRTarBas and miRcode database,and lncRNA SNHG12 was selected for further in vitro and invivo functional assays. RESULTS: Between BLCA and normal samples were identified 1560 differentially expressed genes (DEGs).845 DEGs were most significantly associated with mRNAsi according to WGCNA analysis, which were mainly enriched in GO terms and KEGG pathways related to cell proliferation. Univariate Cox regression and LASSO Cox regression algorithms screened 25 mRNAsi-related genes to construct the risk score model with the significant ability to estimate prognosis of BLCA patients. A ceRNA network, including 8 lncRNA, 11 miRNA and 9 mRNAsi-related mRNA, was constructed.We found that lncRNAs ADAMTS9-AS1 and SNHG12 were observably related to the survival of BLCA patients. To verify this finding, we selected SNHG12 for further study. RT-PCR experiments revealed that SNHG12 was high expression in both bladder cancer tissues and cells.SNHG12 promoted proliferation, invasion, migration, apoptosis and stemness of bladder cancer cells in vitro and tumour proliferation in vivo. CONCLUSION: Our study identified 25 biomarkers associated with stemness indices in BLCA and established a ceRNA network based on key mRNAsi-related genes.SNHG12 promoted BLCA proliferation, invasion, migration, apoptosis and stemness in vitro. It was also showed that SNHG12 promoted tumour growth.


Asunto(s)
ARN Largo no Codificante , Neoplasias de la Vejiga Urinaria , Humanos , Regulación Neoplásica de la Expresión Génica , Ontología de Genes , Redes Reguladoras de Genes , ARN Largo no Codificante/genética , ARN Mensajero/genética , Neoplasias de la Vejiga Urinaria/genética
17.
Mol Cell Probes ; 65: 101845, 2022 10.
Artículo en Inglés | MEDLINE | ID: mdl-35820642

RESUMEN

BACKGROUND: Clear cell renal cell carcinoma (ccRCC) is a worldwide malignancy with high morbidity and mortality. Translation initiation factor 4A1 (eIF4A1), which is an ATP-dependent RNA helicase as a part of eIF4F complex, has been linked to malignant transformation and progression, and a variety of cancers display dysregulation of this enzyme. However, its role in ccRCC remains unclear. In our study, we examined its potential effects in ccRCC. METHODS: Based on Proteomic data, TCGA and ONCOMINE database, RCC cell lines and tissues, the expression of eIF4A1 between ccRCC and normal tissues were investigated. A correlation was evaluated between the prognostic model for OS and ccRCC progression. Analysis of functional enrichment and PPI network were performed. After examining differentially expressed genes between the eIF4A1 high and low-expression groups, we performed GSEA analysis. Furthermore, we investigated immune cell infiltration of eIF4A1. Then we determined eIF4A1 functions in the establishment and maintenance of cell viability, migration and invasion of cell lines. Flow cytometry was utilized to detect cell cycle. RESULTS: The eIF4A1 was up-regulated in ccRCC tissues and cell lines. An increased level of eIF4A1 was linked to lower survival rates and impaired immunity. Depletion of eIF4A1 could arrest tumor cells in G1 phase, so as to seriously limit cell proliferation and weaken the capacity of cell migration. CONCLUSION: ccRCC patients with high eIF4A1 expression are at increased risk of poor prognosis, furthermore eIF4A1 plays a prominent role in facilitating tumor cell proliferation and migration which may further be a potential prognostic biomarker and therapeutic target.


Asunto(s)
Carcinoma de Células Renales , Neoplasias Renales , Biomarcadores de Tumor/genética , Biomarcadores de Tumor/metabolismo , Carcinoma de Células Renales/metabolismo , Movimiento Celular/genética , Proliferación Celular/genética , Humanos , Neoplasias Renales/genética , Neoplasias Renales/patología , Proteómica
18.
Int J Neurosci ; 132(3): 269-282, 2022 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-33208009

RESUMEN

BACKGROUND: Cognitive decline is one of the greatest concerns for patients with Parkinson's disease (PD) and their care partners. Repetitive transcranial magnetic stimulation (rTMS) is a nonpharmacological treatment option used to improve cognitive function in PD, but its efficacy is unclear. We performed a meta-analysis to determine whether rTMS improves cognition in PD patients. METHODS: Eligibility criteria (PICOS) were as follows: (1) 'P': The patients participating were diagnosed with idiopathic PD; (2) 'I': Intervention using rTMS; (3) 'C': Sham stimulation as control; (4) 'O': The outcome of the study included cognitive evaluations; (5) 'S': The study adopted randomized controlled design. The standardized mean difference (SMD) of change of score was applied to measure efficacy, and we used Version 2 of the Cochrane tool to assess risk of bias. RESULTS: Twelve studies met the inclusion criteria. Compared with sham-controlled group, the pooled result showed a non-significant short-term effect of rTMS on global cognition (SMD: -0.15, 95% CI: -0.59 to 0.29, I2 = 36.7%), executive function (SMD: 0.03, 95% CI: -0.21 to 0.26, I2 = 0.0%), and attention and working memory (SMD: 0.05, 95% CI: -0.25 to 0.35, I2 = 0.0%). Long-term outcomes were either shown to be statistically nonsignificant. CONCLUSIONS: Based on a limited number of studies, rTMS fails to improve cognition in PD. We call for additional high-quality randomized controlled trials with adequate sample sizes to determine the efficacy of rTMS.


Asunto(s)
Disfunción Cognitiva , Enfermedad de Parkinson , Cognición , Humanos , Enfermedad de Parkinson/complicaciones , Enfermedad de Parkinson/terapia , Ensayos Clínicos Controlados Aleatorios como Asunto , Estimulación Magnética Transcraneal , Resultado del Tratamiento
19.
Aesthetic Plast Surg ; 46(4): 1689-1697, 2022 08.
Artículo en Inglés | MEDLINE | ID: mdl-35059815

RESUMEN

BACKGROUND: An ovoid, slender face with a smooth contour is preferred in oriental esthetics. We developed a novel concept to achieve a slimmer and harmonious midface contour by liposuction of the projection area of the zygomatic arch. METHODS: A cadaver study including anatomical dissection and histologic examination were conducted to better understand the soft tissue structure of the projection area of the zygomatic arch and the vital technique for liposuction. For the clinical evaluation, 49 patients with midface hypertrophy who underwent liposuction of the zygomatic arch area from January 2016 to June 2021 were retrospectively reviewed. RESULTS: Cadaver study showed that abundant fatty tissue existed in the subcutaneous layer of the zygomatic arch area. The liposuction manipulation was precisely limited to the subcutaneous fat layer, and nerve branches were observed in the deeper loose areolar tissue plane. Of the 49 patients enrolled in this study (including 98 zygomatic arch areas), the median fat removal volume per zygomatic arch area was 3.0 (2.0, 5.0) mL. The subcutaneous fat thickness was significantly decreased postoperatively [median 9 (6, 10) mm vs. 1 (1, 2) mm per zygomatic arch area, P < 0.001]. All patients were satisfied with their postoperative outcomes. Only three patients underwent slight depression of the liposuction area during making facial expression after surgery and subsequently recovered. CONCLUSIONS: Liposuction of the zygomatic arch area is effective in improving midface hypertrophy and achieving a harmonious facial contour with a low risk of complications. LEVEL OF EVIDENCE IV: This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .


Asunto(s)
Lipectomía , Cadáver , Estética , Humanos , Hipertrofia/cirugía , Lipectomía/métodos , Estudios Retrospectivos , Resultado del Tratamiento , Cigoma/cirugía
20.
Water Sci Technol ; 86(12): 3163-3180, 2022 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-36579876

RESUMEN

The sulfidation of nanoscale zerovalent iron (nZVI) has received increasing attention for reducing the oxidizability of nZVI and improving its reactivity toward heavy metal ions. Here, a sulfide (S)-modified attapulgite (ATP)-supported nanoscale nZVI composite (S-nZVI@ATP) was rapidly synthesized under acidic conditions and used to alleviate Cd2+ toxicity from an aqueous solution. The degree of oxidation of S-nZVI@ATP was less than that of nZVI@ATP, indicating that the sulfide modification significantly reduced the oxidation of nZVI. The optimal loading ratio was at an S-to-Fe molar ratio of 0.75, and the adsorption performance of S-nZVI@ATP for Cd2+ was significantly improved compared with that of nZVI@ATP. The removal of Cd2+ by S-nZVI@ATP was 100% when the adsorbent addition was 1 g/L, the solution was 30 mL, and the adsorption was performed at 25 °C for 24 h with an initial Cd2+ concentration of 100 mg/L. Kinetics studies showed that the adsorption process of Cd followed the pseudo-second-order model, indicating that chemisorption was the dominant adsorption mechanism. The adsorption of Cd2+ by S-nZVI @ATP is dominated by the complexation between the iron oxide or iron hydroxide shell of S-nZVI and Cd2+ and the formation of Cd(OH)2 and CdS precipitates.


Asunto(s)
Hierro , Contaminantes Químicos del Agua , Cadmio , Contaminantes Químicos del Agua/análisis , Sulfuros , Adsorción , Adenosina Trifosfato
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA