Genetic Analysis of the Emerging Citrus Yellow Vein Clearing Virus Reveals a Divergent Virus Population in American Isolates.

Citrus yellow vein clearing virus is a previously reported citrus virus from Asia with widespread distribution in China. In 2022, the California Department of Food and Agriculture conducted a multipest citrus survey targeting multiple citrus pathogens including citrus yellow vein clearing virus (CYVCV). In March 2022, a lemon tree with symptoms of vein clearing, chlorosis, and mottling in a private garden in the city of Tulare, California, tested positive for CYVCV, which triggered an intensive survey in the surrounding areas. A total of 3,019 plant samples, including citrus and noncitrus species, were collected and tested for CYVCV using conventional reverse transcription polymerase chain reaction, reverse transcription quantitative polymerase chain reaction, and Sanger sequencing. Five hundred eighty-six citrus trees tested positive for CYVCV, including eight citrus species not previously recorded infected under field conditions. Comparative genomic studies were conducted using 17 complete viral genomes. Sequence analysis revealed two major phylogenetic groups. Known Asian isolates and five California isolates from this study made up the first group, whereas all other CYVCV isolates from California formed a second group, distinct from all worldwide isolates. Overall, the CYVCV population shows rapid expansion and high differentiation indicating a population bottleneck typical of a recent introduction into a new geographic area.

First Report of Narcissus late season yellows virus, Narcissus latent virus, and Narcissus mosaic virus in daffodil (Narcissus pseudonarcissus) in the United States.

Daffodils (family Amaryllidaceae, genus Narcissus) are important ornamental plants produced primarily for cut flowers. In 2019, daffodils sales in the US were $6.26 M (USDA-NASS, 2019). In May 2021, four symptomatic daffodil plants (Narcissus pseudonarcissus) were sampled from a flowerbed (<10% disease incidence) on the Utah State University campus, Logan, Utah. The plants had foliar mosaic and yellow striping symptoms like those caused by the infections of Narcissus degeneration virus (NDV, a potyvirus) and Narcissus mosaic virus (NMV, a potexvirus) (Hanks and Chastagner 2017), and tested positive for potyviruses by ELISA Potyvirus group test (Agdia, Elkhart, IN). A sample of two leaves from the only surviving plant was sent to the USDA Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL) for testing. Total RNA extracted from 0.2 g pooled tissues (0.1g per leaf) using RNeasy Plant Mini kit (Qiagen) was tested for potyvirus in RT-PCR using Nib2F & Nib3R primers (Zheng et al. 2010). Later, the sample was tested for Narcissus latent virus (NLV) and NMV by RT-PCR (He et al. 2018) after the viruses were detected by high throughput sequencing (HTS) described below. A second primer pair was designed in-house targeting NMV TGB1 protein (NMV-2F: CCTTACACCACCGATCCTAAAG & NMV-2R: GGAGCTGCAGTGATGACATATAG. Amplicon size =555bp). The nucleotide (nt) sequence of the potyvirus RT-PCR product obtained (281 bp; GenBank accession no. ON653017) shared 99.29% identity with Narcissus late season yellows virus (NLSYV) BC 37 isolate (MH886515). The nt sequence of NLV-specific primer amplified product (542 bp; ON653018) showed 97.60% identity with NLV NL isolate (KX979913), a maculavirus. The amplicons obtained using two NMV-specific primer pairs were 348 bp (ON653019) and 524 bp (ON653020) long and shared 89.37% and 91.98% nt sequence identities with NMV SW13-Iris isolate (KF752593) at two genomic regions (5613-6860 nt and 5477-6000 nt), respectively. To obtain full genome sequences of the viruses in the sample, HTS was done. A cDNA library was prepared from 500 ng total RNA using the Direct cDNA sequencing kit (SQK-DCS109). The library was loaded onto an R9.4.1 MinION flow cell and sequenced for 48 hours. A total of 372,000 raw reads were obtained with a N50 of 2,754 bp and mean read length of 1,890 bp with 8,085 reads mapped to the viral database. Reads were assembled using canu v 2.1.1 (Koren et al. 2017). Three full-length viral contigs, ON677368 (6955 nt), ON677369 (9624 nt), and ON677370 (8180 nt), were assembled from 4616, 301, and 699 reads, respectively. BLASTn search showed that the three contigs (ON677368, ON677369, and ON677370) shared 94.42% nt identity with NMV SW13-Iris (KF752593), 98.56% with NLSYV BC 37 (MH886515.1), and 98.60% with NLV NL (KX979913.1) isolates, respectively. The potexvirus group, which NMV is a member, has species demarcation of < 72% nt identity (or 80% aa identity) between their coat protein or replicase genes (ICTV 2021). The predicted replicase protein sequence (1643 aa) of the detected NMV (ON677368) showed 95% identity with a published NMV genome (P15059), confirming its identity. NDV was not detected in the sample by RT-PCR and HTS. This is the first report of NLMV, NLSYV, and NMV in daffodil plants in the United States. Daffodils are an important ornamental crop in United States and Europe. A reduction in flower quality, bulb size, and number has been observed in plants infected with these viruses (Ward et al. 2009) that can affect their marketability.

Draft Genome Resource for the Ex-types of Phytophthora ramorum, P. kernoviae, and P. melonis, Species of Regulatory Concern, Using Ultra-Long Read MinION Nanopore Sequencing.

Phytophthora ramorum, P. kernoviae, and P. melonis are each species of current regulatory concern in the United States, the United Kingdom, and other areas of the world. Ex-type material are cultures and duplicates of the type that was used to describe each species and that are deposited in additional culture collections. Using these type specimens as references is essential to designing correct molecular identification and diagnostic systems. Here, we report a whole genome sequence for the Ex-type material of P. ramorum, P. kernoviae, and P. melonis generated using high-throughput sequencing via the MinION third generation platform from Oxford Nanopore Technology. We assembled the quality filtered reads into contigs for each species. We assembled the continuous contigs of P. ramorum, P. kernoviae, and P. melonis (1,322, 545, and 2,091 contigs, respectively). The ab initio prediction of genes from these species reveals that there are 16,838, 12,793, and 34,580 genes in P. ramorum, P. kernoviae, and P. melonis, respectively. Of the 34,580 P. melonis genes, 10,164 genes were conserved among all three of these Phytophthora species which may include pathogenicity genes. We compared the ex-type of P. ramorum EU1 lineage assembly with another selected isolate of EU1 available at the National Center for Biotechnology Information and found 251,859 single nucleotide polymorphisms (SNPs) genome-wide; the comparison with the EU2 lineage genome isolate revealed 441,859 SNPs genome-wide. This genome resource of the ex-types of P. ramorum, and P. kernoviae is a significant contribution as these species are among the most important pathogens of regulatory concern in different regions of the world.

Molecular Analysis of a Plum pox virus W Isolate in Plum Germplasm Hand Carried into the USA from the Ukraine Shows a Close Relationship to a Latvian Isolate.

Four of 19 Prunus germplasm accessions hand carried from the Ukraine into the United States without authorization were found to be infected with Plum pox virus (PPV). Of the three isolates characterized, isolates UKR 44189 and UKR 44191 were confirmed to be isolates of PPV strain W, and UKR 44188 was confirmed to be an isolate of PPV strain D. UKR 44189 and UKR 44191 are very closely related to the PPV strain W isolate LV-145bt (HQ670748) from Latvia. Nucleotide and amino acid sequence identities between these three isolates were greater than 99%. This indicates that the isolates are very closely related and likely originated from a common source. The high genetic diversity among PPV-W strain isolates allowed the identification of potential recombination events between PPV isolates. It appears also that GF 305 peach and Prunus tomentosa are not hosts for the PPV isolate UKR 44189.

High-throughput sequencing application in the detection and discovery of viruses associated with the regulated citrus leprosis disease complex.

Citrus leprosis (CiL) is one of the destructive emerging viral diseases of citrus in the Americas. Leprosis syndrome is associated with two taxonomically distinct groups of Brevipalpus-transmitted viruses (BTVs), that consist of positive-sense Cilevirus, Higrevirus, and negative-sense Dichorhavirus. The localized CiL symptoms observed in multiple citrus species and other alternate hosts indicates that these viruses might have originated from the mites and eventually adopted citrus as a secondary host. Genetic diversity in the genomes of viruses associated with the CiL disease complex have complicated current detection and diagnostic measures that prompted the application of High-Throughput Sequencing (HTS) protocols for improved detection and diagnosis. Two cileviruses are known to infect citrus, and among them only citrus leprosis virus C2 (CiLV-C2) hibiscus strain (CiLV-C2H) has been reported in hibiscus and passion fruit in the US. Based on our current CiL disease complex hypothesis, there is a high probability that CiL disease is associated with more viruses/strains that have not yet been identified but exist in nature. To protect the citrus industry, a Ribo-Zero HTS protocol was utilized for detection of cileviruses infecting three different hosts: Citrus spp., Swinglea glutinosa, and Hibiscus rosa-sinensis. Real-time RT-PCR assays were used to identify plants infected with CiLV-C2 or CiLV-C2H or both in mixed infection in all the above-mentioned plant genera. These results were further confirmed by bioinformatic analysis using HTS generated data. In this study, we utilized HTS assay in confirmatory diagnostics to screen BTVs infecting Dieffenbachia sp. (family: Araceae), Passiflora edulis (Passifloraceae), and Smilax auriculata (Smilacaceae). Through the implementation of HTS and downstream data analysis, we detected not only the known cileviruses in the studied hosts but also discovered a new strain of CiLV-C2 in hibiscus from Colombia. Phylogenetically, the new hibiscus strain is more closely related to CiLV-C2 than the known hibiscus strain, CiLV-C2H. We propose this strain to be named as CiLV-C2 hibiscus strain 2 (CiLV-C2H2). The findings from the study are critical for citrus growers, industry, regulators, and researchers. The possible movement of CiLV-C2H2 from hibiscus to citrus by the Brevipalpus spp. warrants further investigation.

Comparative Analysis of Tomato Brown Rugose Fruit Virus Isolates Shows Limited Genetic Diversity.

Tomato is an important vegetable in the United States and around the world. Recently, tomato brown rugose fruit virus (ToBRFV), an emerging tobamovirus, has impacted tomato crops worldwide and can result in fruit loss. ToBRFV causes severe symptoms, such as mosaic, puckering, and necrotic lesions on leaves; other symptoms include brown rugose and marbling on fruits. More importantly, ToBRFV can overcome resistance in tomato cultivars carrying the Tm-22 locus. In this study, we recovered ToBRFV sequences from tomato seeds, leaves, and fruits from the U.S., Mexico, and Peru. Samples were pre-screened using a real-time RT-PCR assay prior to high-throughput sequencing. Virus draft genomes from 22 samples were assembled and analyzed against more than 120 publicly available genomes. Overall, most sequenced isolates were similar to each other and did not form a distinct population. Phylogenetic analysis revealed three clades within the ToBRFV population. Most of the isolates (95%) clustered in clade 3. Genetic analysis revealed differentiation between the three clades indicating minor divergence occurring. Overall, pairwise identity showed limited genetic diversity among the isolates in this study with worldwide isolates, with a pairwise identity ranging from 99.36% and 99.97%. The overall population is undergoing high gene flow and population expansion with strong negative selection pressure at all ToBRFV genes. Based on the results of this study, it is likely that the limited ToBRFV diversity is associated with the rapid movement and eradication of ToBRFV-infected material between countries.

Molecular, ultrastructural, and biological characterization of Pennsylvania isolates of Plum pox virus.

Plum pox virus (PPV) was identified in Pennsylvania in 1999. The outbreak was limited to a four-county region in southern Pennsylvania. Initial serological and molecular characterization indicated that the isolates in Pennsylvania belong to the D strain of PPV. The Pennsylvania isolates were characterized by sequence analysis, electron microscopy, host range, and vector transmission to determine how these isolates related to their previously studied European counterparts. Genetically, Pennsylvania (PPV-Penn) isolates were more closely related to each other than to any other PPV-D strains, and isolates from the United States, Canada, and Chile were more closely related to each other than to European isolates. The PPV-Penn isolates exist as two clades, suggesting the possibility of multiple introductions. Electron microscopy analysis of PPV-Penn isolates, including cytopathological studies, indicated that the virions were similar to other Potyvirus spp. PPV-Penn isolates had a herbaceous host range similar to that of European D isolates. There were distinct differences in the transmission efficiencies of the two PPV-Penn isolates using Myzus persicae and Aphis spiraecola as vectors; however, both PPV-Penn isolates were transmitted by M. persicae more efficiently than a European D isolate but less efficiently than a European M isolate.

Complete Nucleotide Sequence of a Novel Hibiscus-Infecting Cilevirus from Florida and Its Relationship with Closely Associated Cileviruses.

The complete nucleotide sequence of a recently discovered Florida (FL) isolate of hibiscus-infecting cilevirus (HiCV) was determined by Sanger sequencing. The movement and coat protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HI (Hawaii) isolate.

Complete Genome Sequences of Three Xanthomonas citri Strains from Texas.

The complete genome sequences of three Xanthomonas citri strains isolated from lime trees in Texas were found to belong to the Aw group. All carried nearly identical large plasmids with similarity to those of a citrus canker strain from India and to xanthomonads from Africa and Colombia. All three strains harbored unusual pthA homologs.

Genetic Marker Analysis of a Global Collection of Isolates of Citrus tristeza virus: Characterization and Distribution of CTV Genotypes and Association with Symptoms.

ABSTRACT Genetic markers amplified from three noncontiguous regions by sequence specific primers designed from the partial or complete genome sequences of Citrus tristeza virus (CTV) isolates T3, T30, T36, and VT were used to assess genetic relatedness of 372 isolates in an international collection. Eighty-five isolates were judged similar to the T3 isolate, 81 to T30, 11 to T36, and 89 to VT. Fifty-one isolates were mixed infections by two or more identifiable viral genotypes, and 55 isolates could not be assigned unequivocally to a group defined by marker patterns. Maximum parsimony analysis of aligned marker sequences supported the grouping of isolates on the basis of marker patterns only. Specific disease symptoms induced in select citrus host plants were shared across molecular groups, although symptoms were least severe among isolates grouped by markers with the T30 isolate and were most severe among isolates grouped by markers with the T3 isolate. Isolates assigned the same genotype showed variable symptoms and symptom severity. A classification strategy for CTV isolates is proposed that combines genetic marker patterns and nucleotide sequence data.

Improved sampling methods for real-time polymerase chain reaction diagnosis of citrus canker from field samples.

ABSTRACT Citrus bacterial canker disease has been introduced at least three times into Florida in the last 15 years and, despite federal and state quarantine and eradication efforts, continues to spread in Florida. Accurate, fast, and reliable detection of the causal agent is of great importance. However, citrus bacterial canker is caused by at least two groups of phylogenetically distinct Xanthomonas citri strains, and there is host range variation within both groups. We developed a fast, sensitive and reliable real-time polymerase chain reaction (PCR) assay using a portable, field-hardened RAPID machine and primers designed to detect all canker-causing strains. Single-lesion sampling methods were developed that required minimal handling and allowed complete real-time PCR diagnosis in a total time of 4 h and with an apparent sensitivity of less than 10 CFU of target cells from diseased lesions. This sensitivity allowed molecular detection for the first time of X. citri in a herbarium sample from a 1912 canker outbreak. Sensitivity was improved significantly by the use of CaCO(3) and Silwet L-77, and by either minimizing the amount of citrus lesion tissue sampled or by soaking or swiping but not grinding the lesions. Primer design also was of significant importance in both specificity and sensitivity.