First report of Fusarium equiseti (Corda) Sacc. causing wilt of Cajanus scarabaeoides, a wild relative of pigeonpea in India.

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 µm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

A Psychologic Assessment of the Parents of Patients With Cleft Lip and Palate.

The aim of this study was to evaluate the psychologic burden in terms of depression, anxiety, and stress among the parents of children with congenital craniofacial deformity, nonsyndromic cleft lip and/or palate (CL/P) with early and late diagnosis and/or treatment. In this study, total 240 patients were enrolled, out of which 72 were parents (either mother/father) of CL/P children, below 10 years (group A: before adolescence), 70 were parents of CL/P children, above 10 years of age (group B: after adolescence), and 98 were parents of children with no CL/P or any other genetic disorder (group C). Depression, anxiety, and stress scale-21 was administered in all groups after obtaining the informed consent. Mean ranks of group B revealed a higher score for all the 3 psychologic domains. The CL/P was further divided into only cleft lip, only cleft palate, and both cleft lip and palate groups. A statistically significant difference was observed in group B for all the psychologic domains. Analysis of variance was applied between the groups and a P-value <0.05 was considered as statistically significant. Analysis revealed severe to extremely severe depressed state of mind and moderate to severe levels of stress in maximum parents (above 20%) of group B. However, approximately 50% parents of group B showed extremely severe anxiety. Therefore, psychologic assessment helps in providing a psychiatric or psychologic counseling and treatment to the parents of CL/P children.

Identification, characterization and expression profiles of Fusarium udum stress-responsive WRKY transcription factors in Cajanus cajan under the influence of NaCl stress and Pseudomonas fluorescens OKC.

The WRKY gene family has never been identified in pigeonpea (Cajanus cajan). Therefore, objective of the present study was to identify the WRKY gene family in pigeonpea and characterize the Fusarium udum stress-responsive WRKY genes under normal, NaCl-stressed and Pseudomonas fluorescens OKC (a plant growth-promoting bacterial strain) treated conditions. The aim was to characterize the Fusarium udum stress-responsive WRKY genes under some commonly occurring field conditions. We identified 97 genes in the WRKY family of pigeonpea, using computational prediction method. The gene family was then classified into three groups through phylogenetic analysis of the homologous genes from the representative plant species. Among the 97 identified WRKY genes 35 were further classified as pathogen stress responsive genes. Functional validation of the 35 WRKY genes was done through generating transcriptional profiles of the genes from root tissues of pigeonpea plants under the influence of P. fluorescens OKC after 24 h of stress application (biotic: Fusarium udum, abiotic: NaCl). The entire experiment was conducted in two pigeonpea cultivars Asha (resistant to F. udum) and Bahar (susceptible to F. udum) and the results were concluded on the basis of transcriptional regulation of the WRKY genes in both the pigeonpea cultivars. The results revealed that among the 35 tentatively identified biotic stress responsive CcWRKY genes, 26 were highly F. udum responsive, 17 were better NaCl responsive compared to F. udum and 11 were dual responsive to both F. udum and NaCl. Application of OKC was able to enhance transcript accumulation of the individual CcWRKY genes to both the stresses when applied individually but not in combined challenge of the two stresses. The results thus indicated that CcWRKY genes play a vital role in the defense signaling against F. udum and some of the F. udum responsive CcWRKYs (at least 11 in pigeonpea) are also responsive to abiotic stresses such as NaCl. Further, plant beneficial microbes such as P. fluorescens OKC also help pegionpea to defend itself against the two stresses (F. udum and NaCl) through enhanced expression of the stress responsive CcWRKY genes when the stresses are applied individually.

miR-876-3p regulates glucose homeostasis and insulin sensitivity by targeting adiponectin

miRNA has been known to regulate diverse cellular and molecular functions. In the earlier study, we have reported that adipocytes differentiated from human mesenchymal stem cells (hMSC) on 72-h chronic insulin (CI) treatment exhibit insulin resistance (IR). Present study has further explored above model to investigate the role of early expressed miRNAs within human adipocytes to modulate differential adipokine expression as observed during IR. Our results highlight that miR-876-3p regulate glucose homeostasis and its dysregulation leads to IR. We found that miR-876-3p level is a critical determinant of adiponectin expression by virtue of its target within adiponectin 3'UTR. Regulatory effect of miR-876-3p impacts crosstalk between adiponectin and insulin signaling. Rosiglitazone treatment in CI-induced IR adipocytes drastically reduced miR-876-3p expression and increased adiponectin level. In line with this, lentiviral-mediated inhibition of miR-876-3p expression ameliorated CI and high-fat diet (HFD)-induced IR in adipocytes differentiated from hMSC and C57BL/6 mice, respectively. Our findings thus suggest that modulating miR-876-3p expression could provide novel opportunities for therapeutic intervention of obesity-associated metabolic syndrome.

Chronic hyperinsulinemia induced miR-27b is linked to adipocyte insulin resistance by targeting insulin receptor.

Defect in insulin signaling leads to the development of insulin resistance followed by type 2 diabetes. Exploiting our previously developed physiological chronic hyperinsulinemia (CI)-mediated insulin resistance (IR) model, we wanted to understand how miRNAs contribute to the development of IR. Amongst the identified and validate miRNAs, the expression of miR-27b was found to be highly upregulated during CI-induced IR in 3T3-L1 adipocytes. We also validated the expression of miR-27b in CI-induced IR in human mesenchymal stem cell (hMSC)-derived adipocytes and in vivo high fat diet (HFD)-induced IR mice model. Bioinformatics target prediction softwares and luciferase reporter assay identified insulin receptor (INSR) as one of a prime target of miR-27b. Lentiviral mediated overexpression of miR-27b impairs insulin signaling by modulating INSR expression that in turn led to decreased glucose uptake in both 3T3-L1 and hMSC-derived adipocytes. Conversely, inhibition of miR-27b reversed CI-mediated suppression of target protein INSR and improved phosphorylation of Akt, a nodal protein of insulin signaling that is impaired by CI treatment. Lentiviral mediated overexpression of miR-27b in in vivo C57BL/6 mice impaired whole body glucose tolerance and adipose tissue insulin sensitivity. Furthermore, inhibition of miR-27b in HFD-induced insulin resistance mice model improved glucose tolerance and adipose tissue insulin sensitivity by increasing the expression of its target gene INSR in eWAT. Thus, our results indicate that miR-27b functions as a prime modulator of CI-induced IR via regulating the expression of INSR. KEY MESSAGES: miR-27b is upregulated in different in vitro and in vivo models of insulin resistance. miR-27b directly suppresses the expression of INSR by targeting 3'UTR of INSR. Modulation of miR-27b expression regulates insulin sensitivity by targeting INSR.

Trace elements content in the selected medicinal plants traditionally used for curing skin diseases by the natives of Mizoram, India.

OBJECTIVE: To determine the trace elements content in the selected medicinal plants, namely, Eryngium foetidum L., Mimosa pudica L., Polygonum plebeium, and Prunus cerasoides D. Don traditionally used by the natives of the Mizoram, one of the north eastern states in India as their folklore medicines for curing skin diseases like eczema, leg and fingers infection, swelling and wound. METHODS: A 3 MeV proton beam of proton induced X-ray emission technique, one of the most powerful techniques for its quick multi elemental trace analysis capability and high sensitivity was used to detect and characterized for trace elements. RESULTS: The studies revealed that six trace elements, namely, Fe, Zn, Cu, Mn, V, and Co detected in mg/L unit were present in varying concentrations in the selected medicinal plants with high and notable concentration of Fe, Zn, Mn and appreciable amount of the Cu, Co and V in all the plants. CONCLUSIONS: The results of the present study support the therapeutic usage of these medicinal plants in the traditional practices for curing skin diseases since they are found to contain appreciable amount of the Fe, Zn, Cu, Mn, V and Co.