Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 27
Filtrar
Más filtros

Banco de datos
Tipo del documento
Intervalo de año de publicación
1.
BMC Plant Biol ; 24(1): 195, 2024 Mar 16.
Artículo en Inglés | MEDLINE | ID: mdl-38493110

RESUMEN

BACKGROUND: The sustainable supply of medicinal plants is important, and cultivating and domesticating them has been suggested as an optimal strategy. However, this can lead to a loss of genetic diversity. Tripterygium wilfordii Hook. f. is a medicinal plant commonly used in traditional Chinese medicine, but its wild populations are dwindling due to excessive harvesting. To protect the species and meet the increasing demand, it is urgent to cultivate it on a large scale. However, distinguishing between T. wilfordii and T. hypoglaucum, two similar species with different medicinal properties, is challenging. Therefore, it is crucial to understand the genetic diversity and population structure of these species for their sustainable utilization. RESULTS: In this study, we investigated the genetic diversity and population structure of the two traditional medicinal semiwoody vines plant species, Tripterygium wilfordii and T. hypoglaucum, including wild and cultivated populations using chloroplast DNA (cpDNA) sequences and microsatellite loci. Our results indicated that the two species maintain a high level of genetic divergence, indicating possible genetic bases for the different contents of bioactive compounds of the two species. T. wilfordii showed lower genetic diversity and less subdivided population structures of both markers than T. hypoglaucum. The potential factors in shaping these interesting differences might be differentiated pollen-to-seed migration rates, interbreeding, and history of population divergence. Analyses of cpDNA and microsatellite loci supported that the two species are genetically distinct entities. In addition, a significant reduction of genetic diversity was observed for cultivated populations of the two species, which mainly resulted from the small initial population size and propagated vegetative practice during their cultivation. CONCLUSION: Our findings indicate significant genetic divergence between T. wilfordii and T. hypoglaucum. The genetic diversity and population structure analyses provide important insights into the sustainable cultivation and utilization of these medicinal plants. Accurate identification and conservation efforts are necessary for both species to ensure the safety and effectiveness of crude drug use. Our study also highlighted the importance of combined analyses of different DNA markers in addressing population genetics of medicinal plants because of the contrasts of inheritance and rates of gene flow. Large-scale cultivation programs should consider preserving genetic diversity to enhance the long-term sustainability of T. wilfordii and T. hypoglaucum. Our study proposed that some populations showed higher genetic diversity and distinctness, which can be considered with priority for conservation and as the sources for future breeding and genetic improvement.


Asunto(s)
Celastraceae , Plantas Medicinales , Tripterygium/genética , Tripterygium/química , Celastraceae/genética , Fitomejoramiento , Genética de Población , Plantas Medicinales/genética , ADN de Cloroplastos/genética , Variación Genética
2.
J Enzyme Inhib Med Chem ; 33(1): 920-935, 2018 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-29768059

RESUMEN

Pentabromopseudilin (PBrP) is a marine antibiotic isolated from the marine bacteria Pseudomonas bromoutilis and Alteromonas luteoviolaceus. PBrP exhibits antimicrobial, anti-tumour, and phytotoxic activities. In mammalian cells, PBrP is known to act as a reversible and allosteric inhibitor of myosin Va (MyoVa). In this study, we report that PBrP is a potent inhibitor of transforming growth factor-ß (TGF-ß) activity. PBrP inhibits TGF-ß-stimulated Smad2/3 phosphorylation, plasminogen activator inhibitor-1 (PAI-1) protein production and blocks TGF-ß-induced epithelial-mesenchymal transition in epithelial cells. PBrP inhibits TGF-ß signalling by reducing the cell-surface expression of type II TGF-ß receptor (TßRII) and promotes receptor degradation. Gene silencing approaches suggest that MyoVa plays a crucial role in PBrP-induced TßRII turnover and the subsequent reduction of TGF-ß signalling. Because, TGF-ß signalling is crucial in the regulation of diverse pathophysiological processes such as tissue fibrosis and cancer development, PBrP should be further explored for its therapeutic role in treating fibrotic diseases and cancer.


Asunto(s)
Lisosomas/efectos de los fármacos , Lisosomas/metabolismo , Miosina Tipo V/antagonistas & inhibidores , Proteínas Serina-Treonina Quinasas/antagonistas & inhibidores , Pirroles/farmacología , Receptores de Factores de Crecimiento Transformadores beta/antagonistas & inhibidores , Factor de Crecimiento Transformador beta/antagonistas & inhibidores , Alteromonas/química , Animales , Línea Celular , Relación Dosis-Respuesta a Droga , Células HEK293 , Células Hep G2 , Humanos , Visón , Estructura Molecular , Miosina Tipo V/metabolismo , Proteínas Serina-Treonina Quinasas/biosíntesis , Pseudomonas/química , Pirroles/química , Pirroles/aislamiento & purificación , Receptor Tipo II de Factor de Crecimiento Transformador beta , Receptores de Factores de Crecimiento Transformadores beta/biosíntesis , Relación Estructura-Actividad , Factor de Crecimiento Transformador beta/metabolismo
3.
Genes Chromosomes Cancer ; 56(5): 427-435, 2017 05.
Artículo en Inglés | MEDLINE | ID: mdl-28124395

RESUMEN

Pancreatic ductal adenocarcinoma (PDAC), either sporadic or familial, has a dismal prognosis and finding candidate genes involved in development of the cancer is crucial for the patient care. First, we identified two patients with germline alterations in or adjacent to CDH10 by chromosome studies and sequencing analyses in 41 familial pancreatic cancer (FPC) cases. One patient had a balanced translocation between chromosome 5 and 20. The breakpoint on chromosome band 5p14.2 was ∼810 Kb upstream of CDH10, while that on chromosome arm 20p was in the pericentromeric region which might result in inactivation of one copy of the gene leading to reduced expression of CDH10. This interpretation was supported by loss of heterozygosity (LOH) seen in this region as determined by short tandem repeat analyses. Another patient had a single nucleotide variant in exon 12 (p.Arg688Gln) of CDH10. This amino acid was conserved among vertebrates and the mutation was predicted to have a pathogenic effect on the protein by several prediction algorithms. Next, we analyzed LOH status in the CDH10 region in sporadic PDAC and at least 24% of tumors had evidence of LOH. Immunohistochemical stains with CDH10 antibody showed a different staining pattern between normal pancreatic ducts and PDAC. Taken together, our data supports the notion that CDH10 is involved in sporadic pancreatic carcinogenesis, and might have a role in rare cases of FPC. Further functional studies are needed to elucidate the tumor suppressive role of CDH10 in pancreatic carcinogenesis.


Asunto(s)
Biomarcadores de Tumor/metabolismo , Cadherinas/metabolismo , Carcinoma Ductal Pancreático/patología , Variaciones en el Número de Copia de ADN/genética , Neoplasias Pancreáticas/patología , Biomarcadores de Tumor/genética , Cadherinas/genética , Carcinoma Ductal Pancreático/genética , Carcinoma Ductal Pancreático/metabolismo , Estudios de Casos y Controles , Estudios de Seguimiento , Humanos , Técnicas para Inmunoenzimas , Estadificación de Neoplasias , Neoplasias Pancreáticas/genética , Neoplasias Pancreáticas/metabolismo , Pronóstico
4.
Mol Biol Evol ; 33(6): 1381-95, 2016 06.
Artículo en Inglés | MEDLINE | ID: mdl-26882987

RESUMEN

A selective sweep is the result of strong positive selection driving newly occurring or standing genetic variants to fixation, and can dramatically alter the pattern and distribution of allelic diversity in a population. Population-level sequencing data have enabled discoveries of selective sweeps associated with genes involved in recent adaptations in many species. In contrast, much debate but little evidence addresses whether "selfish" genes are capable of fixation-thereby leaving signatures identical to classical selective sweeps-despite being neutral or deleterious to organismal fitness. We previously described R2d2, a large copy-number variant that causes nonrandom segregation of mouse Chromosome 2 in females due to meiotic drive. Here we show population-genetic data consistent with a selfish sweep driven by alleles of R2d2 with high copy number (R2d2(HC)) in natural populations. We replicate this finding in multiple closed breeding populations from six outbred backgrounds segregating for R2d2 alleles. We find that R2d2(HC) rapidly increases in frequency, and in most cases becomes fixed in significantly fewer generations than can be explained by genetic drift. R2d2(HC) is also associated with significantly reduced litter sizes in heterozygous mothers, making it a true selfish allele. Our data provide direct evidence of populations actively undergoing selfish sweeps, and demonstrate that meiotic drive can rapidly alter the genomic landscape in favor of mutations with neutral or even negative effects on overall Darwinian fitness. Further study will reveal the incidence of selfish sweeps, and will elucidate the relative contributions of selfish genes, adaptation and genetic drift to evolution.


Asunto(s)
Proteínas Nucleares/genética , Proteínas de Unión al ARN/genética , Secuencias Repetitivas de Ácidos Nucleicos , Adaptación Fisiológica/genética , Alelos , Animales , Evolución Biológica , Variaciones en el Número de Copia de ADN/genética , Evolución Molecular , Femenino , Variación Genética , Genética de Población , Masculino , Ratones , Modelos Genéticos , Mutación , Selección Genética
5.
Heliyon ; 10(9): e30575, 2024 May 15.
Artículo en Inglés | MEDLINE | ID: mdl-38765140

RESUMEN

Synaptotagmin 4 (syt4) belongs to the synaptotagmin protein family, which has 17 and 28 family members in human and zebrafish, respectively. In zebrafish and rodents, syt4 is known to express abundantly in the entire central nervous system in the early developmental stages. In adult rodents, the gene expression shifts to be predominant in the cerebellum, mostly in Purkinje cells, a type of GABAergic neurons. However, there is no report of the expression pattern of syt4 in the adult zebrafish brain. Therefore, we hypothesize that the expression of syt4 is conserved in adult zebrafish and is specific to the GABAergic neurons, likely Purkinje cells, in the cerebellum. To examine the hypothesis, we first show that only one copy of syt4 gene remains in the zebrafish genome, and it is orthologous to the gene in other vertebrates. We further observe mammalian SYT4 antibody immunoreactive-like (mSYT4-ir) signals in several structures in the hindbrain including the medial divisions of the valvula cerebelli and the corpus cerebelli. In addition, our observations indicate the presence of mSYT4-ir signals in GABAergic neurons, most notably in the Purkinje cell layer of the molecular layer in the aforementioned structures. Conversely, mSYT4-ir signals are not observed in glutamatergic or cholinergic neurons. Therefore, we deduce that the syt4 gene in zebrafish exhibits a homologous expression pattern to those of previously studied vertebrate species, which is revealed by the positive immunoreactive-like signals of mammalian SYT4 antibodies.

6.
Heliyon ; 10(9): e30628, 2024 May 15.
Artículo en Inglés | MEDLINE | ID: mdl-38726167

RESUMEN

Cinnamomum kanehirae Hayata, belonging to Lauraceae family, is an indigenous and endangered species of considerable economic importance in Taiwan. It plays a crucial role as the host for the economically valuable saprotrophic fungus, Taiwanofungus camphorates. However, accurate species identification poses a challenge due to the similarity in morphological features and frequent natural hybridization with closely related species. Acquiring high-quality and pure leaf oils becomes imperative for precise species identification and producing superior goods. In this study, our objective was to establish methodologies for analyzing the chemical composition of leaf essential oils and subsequently apply this knowledge to differentiate among three Cinnamomum species. Gas chromatography-mass spectrometry (GC/MS) was employed to scrutinize the chemical makeup of leaf essential oils from three closely related species: C. kanehirae, C. micranthum, and C. camphora. We utilized Steam Distillation (SD) and steam distillation-solvent extraction (SDSE) methods, with the SDSE-Hexane approach chosen for optimization, enhancing extraction efficiency and ensuring essential oil purity. Through the SDSE-Hexane method, we identified seventy-four compounds distributed across three major classes: monoterpenes hydrocarbons (0.0-7.0 %), oxygenated monoterpenes (3.8-90.9 %), sesquiterpenes hydrocarbons (0.0-28.3 %), and oxygenated sesquiterpenes (1.6-88.1 %). Our findings indicated the presence of more than one chemotype in both C. kanehirae and C. camphora, whereas no specific chemotype could be discerned in C. micranthum. Furthermore, clustering based on chemotypes allowed for the differentiation of samples from the three species. Notably, we demonstrated that the chemical compositions of grafted C. kanehirae remained largely unaffected by the rootstock. Conversely, natural hybrids between C. kanehirae and C. camphora exhibited profiles more closely aligned with C. kanehirae. The optimized extraction method and the chemotype-based classification system established in this study present valuable tools for essential oil preparation, species identification, and further exploration into the genetic variation of Cinnamomum.

7.
Int J Biol Macromol ; 245: 125510, 2023 Aug 01.
Artículo en Inglés | MEDLINE | ID: mdl-37353120

RESUMEN

The objectives were to identify the functional domains of a potential oncoprotein, cell migration inducing hyaluronidase 2 (CEMIP2), evaluate its expression levels and roles in colorectal cancer (CRC), and develop an aptamer-based nanoparticle for targeted therapy. Data mining on TCGA identified that CEMIP2 might play oncogenic roles in CRC. In a local cohort, CEMIP2 mRNA levels significantly stepwise increase in CRC patients with higher stages, and high CEMIP2 confers worse disease-free survival. In addition, CEMIP2 mRNA levels significantly correlated to hyaluronan levels in sera from CRC patients. Deletion mapping identified that CEMIP2 containing G8 and PANDER-like domains preserved hyaluronidase activity and oncogenic roles, including cell proliferation, anchorage-independent cell growth, cell migration and invasion, and human umbilical vein endothelial cell (HUVEC) tube formation in CRC-derived cells. A customized monoclonal mouse anti-human CEMIP2 antibody probing the PANDER-like domain (anti-289307) counteracted CEMIP2-mediated carcinogenesis in vitro. Cell-SELEX pinpointed an aptamer, aptCEMIP2(101), specifically interacted with the full-length CEMIP2, potentially involving its 3D structure. Treatments with aptCEMIP2(101) significantly reduced CEMIP2-mediated tumorigenesis in vitro. Mesoporous silica nanoparticles (MSN) carrying atpCEMIP2(101) and Dox were fabricated. Dox@MSN, MSN-aptCEMIP2(101), and Dox@MSN-aptCEMIP2(101) significantly suppressed tumorigenesis in vitro compared to the Mock, while Dox@MSN-aptCEMIP2(101) showed substantially higher effects compared to Dox@MSN and MSN-aptCEMIP2(101) in CRC-derived cells. Our study identified a novel oncogene and developed an effective aptamer-based targeted therapeutic strategy.


Asunto(s)
Neoplasias Colorrectales , Nanopartículas , Humanos , Ratones , Animales , Sistemas de Liberación de Medicamentos , Portadores de Fármacos/química , Hialuronoglucosaminidasa , Doxorrubicina/química , Oligonucleótidos , Nanopartículas/química , Carcinogénesis , Neoplasias Colorrectales/tratamiento farmacológico , Dióxido de Silicio/química , Porosidad , Citocinas
8.
J Fungi (Basel) ; 9(9)2023 Sep 20.
Artículo en Inglés | MEDLINE | ID: mdl-37755058

RESUMEN

The genus Lasiodiplodia, a member of the family Botryosphaeriaceae, is an important fungal disease genus in agriculture. However, the Lasiodiplodia species survey and genetic diversity in Taiwan remain unclear. This study aimed to investigate the Lasiodiplodia species associated with various fruit species to explore the cryptic Lasiodiplodia species diversity, validate species delimitation, and unveil cryptic genetic diversity. Overall, six Lasiodiplodia species were identified, with several new records of infection identified. Additionally, phylogenetic analyses indicated that the relations of all isolates of L. theobromae might be paraphyletic. They were grouped with L. brasiliense based on Automatic Barcode Gap Discovery (ABGD), Automatic Partitioning (ASAP) and structure-based clustering analyses. These analyses did not provide conclusive evidence for L. brasiliensis as a stable species. It may be necessary to gather more information to clarify the species delineation. The multiple new records of Lasiodiplodia species with high genetic diversity and differentiation revealed that the diversity of Lasiodiplodia in Taiwan was underestimated in the past. We found that L. theobromae has the highest number of haplotypes but the lowest number of haplotype and nucleotide diversities, indicating a recent population expansion. This was supported by the significant negative Tajima's D and Fu and Li's D* tests. The high genetic diversity, low gene flow, and host-associated differentiation of Lasiodiplodia species indicate that they might harbour powerful evolutionary potential in Taiwan. This study provided critical insights into genetic variation, host-associated differentiation, and demography of Lasiodiplodia species, which would be helpful for disease management of related pathogens.

9.
Cell Oncol (Dordr) ; 46(4): 933-951, 2023 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-36920729

RESUMEN

PURPOSE: Urothelial carcinoma (UC) is a common disease in developed counties. This study aimed to identify autocrine roles and signaling pathways of gremlin 1, DAN family BMP antagonist (GREM1), which inhibits tumor growth and epithelial-mesenchymal transition (EMT) in UC. METHODS: Systematic in vitro and in vivo studies using genetic engineering, different urinary bladder urothelial carcinoma (UBUC)-derived cell lines, and mouse models were performed, respectively. Further, primary upper tract urothelial carcinoma (UTUC) and UBUC specimens were evaluated by immunohistochemistry. RESULTS: GREM1 protein levels conferred better disease-specific and metastasis-free survival rates and played an independent prognostic factor in UTUC and UBUC. Hypermethylation is the primary cause of low GREM1 levels. In different UBUC-derived cell lines, the autocrine/secreted and glycosylated GREM1 interacted with transforming growth factor beta 1 (TGFB1) and inhibited TGFß/BMP/SMAD signaling and myosin light chain 9 (MYL9) transactivation, subsequently cell proliferation and epithelial-mesenchymal transition (EMT). Secreted and glycosylated GREM1 also suppressed tumor growth, metastasis, and MYL9 levels in the mouse model. Instead, cytosolic GREM1 promoted cell proliferation and EMT by activating the tumor necrosis factor (TNF)/AKT/nuclear factor kappa B (NFκB) axis. CONCLUSIONS: Clinical associations, animal models, and in vitro indications provided solid evidence to show that the epithelial autocrine GREM1 is a novel tumor suppressor in UCs. The glycosylated-GREM1 hampered cell proliferation, migration, invasion, and in vitro angiogenesis through interaction with TGFB1 to inactivate TGFß/BMP/SMAD-mediated EMT in an autocrine manner.


Asunto(s)
Carcinoma de Células Transicionales , Neoplasias de la Vejiga Urinaria , Ratones , Animales , Factor de Crecimiento Transformador beta/metabolismo , Transición Epitelial-Mesenquimal/genética , Neoplasias de la Vejiga Urinaria/patología , Carcinoma de Células Transicionales/genética , Activación Transcripcional
10.
Plants (Basel) ; 11(18)2022 Sep 19.
Artículo en Inglés | MEDLINE | ID: mdl-36145834

RESUMEN

Yellow water lily (Nuphar shimadai Hayata) is a critically endangered species in Taiwan. Here, we examined genetic structures of four extant populations, WP, GPa, GPb and GPn, using 39 simple sequence repeat (SSR) markers. Positive genetic correlation was observed within 50 m, beyond which no correlation was detected due to isolation by distance according to Mantel correlogram. This suggests a significant genetic structuring of the species. Besides, multilocus genotype (MLG) analysis revealed that GPa was a panmictic population and the species' putative center of origin. Genetic exchange was observed between GPa and GPb populations, which likely resulted from their geographic proximity. Nevertheless, there was a strong asymmetric migration detected from GPa to WP, but a recent genetic barrier prevented dispersal further northward (WP). Geneland estimated the best number of clusters as K = 2, where WP distinctly separated from the rest of the populations. In STRUCTURE output of K = 3, a third cluster was abundant only in WP. We suggest to consider GPn and WP as separate conservation units, being far from GPa. There is indeed a need to investigate these populations; as predicted, Ne = 1.6 to 3.0 is considered low and that may put the species at risk of extinction.

11.
Front Plant Sci ; 13: 1038998, 2022.
Artículo en Inglés | MEDLINE | ID: mdl-36388479

RESUMEN

Nipa (Nypa fruticans Wurmb.) is an important mangrove palm species, but it is understudied due to lack of information on genetic patterns within its distribution range. In this study, we identified 18 informative microsatellite markers to assess genetic variations among local populations in the Indo-West Pacific (IWP). Results showed population stratification based on high genetic differentiation (FST = 0.22131) with the Mantel test indicating significance to isolation-by-distance. We found a pronounced differentiation between the west populations in Sri Lanka and east populations in Southeast Asia. The east populations around the South China Sea were more genetically similar than those along the Malacca Strait and Java Sea. These genetic clines were shaped by ocean circulations and seasonal monsoon reversals as plausible factors. The Malacca Strait was confirmed as both a genetic and a geographic barrier rather than a corridor according to the Monmonier plot. Simulations of directional migration indicated a statistically strong contemporary genetic connectivity from west to east where Sri Lankan immigrants were detected as far as central Philippines via long-distance dispersal. This is the first report on the recent migration patterns of nipa using microsatellites. Assignment of first-generation (F0) immigrants suggested Mainland Southeast Asia as a melting pot due to the admixture associated with excess of homozygosity. The western populations were recent expansions that emerged in rapid succession based on a phylogram as supported by footprints of genetic drift based on bottleneck tests.

12.
Biomedicines ; 9(10)2021 Oct 10.
Artículo en Inglés | MEDLINE | ID: mdl-34680550

RESUMEN

Failure to detect early-stage epithelial ovarian cancer (EOC) is a major contributing factor to its low survival rate. Increasing evidence suggests that different subtypes of EOC may behave as distinct diseases due to their different cells of origins, histology and treatment responses. Therefore, the identification of EOC subtype-specific biomarkers that can early detect the disease should be clinically beneficial. Exosomes are extracellular vesicles secreted by different types of cells and carry biological molecules, which play important roles in cell-cell communication and regulation of various biological processes. Multiple studies have proposed that exosomal miRNAs present in the circulation are good biomarkers for non-invasive early detection of cancer. In this review, the potential use of exosomal miRNAs as early detection biomarkers for EOCs and their accuracy are discussed. We also review the differential expression of circulating exosomal miRNAs and cell-free miRNAs between different biofluid sources, i.e., plasma and serum, and touch on the issue of endogenous reference miRNA selection. Additionally, the current clinical trials using miRNAs for detecting EOCs are summarized. In conclusion, circulating exosomal miRNAs as the non-invasive biomarkers have a high potential for early detection of EOC and its subtypes, and are likely to be clinically important in the future.

13.
Biosci Rep ; 41(12)2021 12 22.
Artículo en Inglés | MEDLINE | ID: mdl-34708245

RESUMEN

Malignant ascites is an abnormal accumulation of fluid within the peritoneal cavity, caused by metastasis of several types of cancers, including colorectal cancer (CRC). Cancer cells in ascites reflect poor prognosis and serve as a good specimen to study tumour heterogeneity, as they represent a collection of multiple metastatic sites in the peritoneum. In the present study, we have employed single-cell RNA-sequencing (scRNA-seq) to explore and characterise ascites-derived cells from a CRC patient. The samples were prepared using mechanical and enzymatic dissociations, and obtained before and after a chemotherapy treatment. Unbiased clustering of 19,653 cells from four samples reveals 14 subclusters with unique transcriptomic patterns in four major cell types: epithelial cells, myeloid cells, fibroblasts, and lymphocytes. Interestingly, the percentages of cells recovered from different cell types appeared to be influenced by the preparation protocols, with more than 90% reduction in the number of myeloid cells recovered by enzymatic preparation. Analysis of epithelial cell subpopulations unveiled only three out of eleven subpopulations with clear contraction after the treatment, suggesting that the majority of the heterogeneous ascites-derived cells were resistant to the treatment, potentially reflecting the poor treatment outcome observed in the patient. Overall, our study showcases highly heterogeneous cancer subpopulations at single-cell resolution, which respond differently to a particular chemotherapy treatment. All in all, this work highlights the potential benefit of single-cell analyses in planning appropriate treatments and real-time monitoring of therapeutic response in cancer patients through routinely discarded ascites samples.


Asunto(s)
Protocolos de Quimioterapia Combinada Antineoplásica/uso terapéutico , Líquido Ascítico/metabolismo , Biomarcadores de Tumor/genética , Neoplasias Colorrectales/tratamiento farmacológico , Perfilación de la Expresión Génica , Heterogeneidad Genética , ARN Neoplásico/genética , RNA-Seq , Análisis de la Célula Individual , Transcriptoma , Líquido Ascítico/patología , Biomarcadores de Tumor/metabolismo , Toma de Decisiones Clínicas , Neoplasias Colorrectales/genética , Neoplasias Colorrectales/metabolismo , Neoplasias Colorrectales/patología , Resistencia a Antineoplásicos , Femenino , Humanos , Persona de Mediana Edad , Valor Predictivo de las Pruebas , ARN Neoplásico/metabolismo , Resultado del Tratamiento
14.
Cell Oncol (Dordr) ; 44(5): 1133-1150, 2021 Oct.
Artículo en Inglés | MEDLINE | ID: mdl-34339014

RESUMEN

PURPOSE: Urinary bladder urothelial carcinoma (UBUC) is a common malignant disease, and its high recurrence rates impose a heavy clinical burden. The objective of this study was to identify signaling pathways downstream of epithelial membrane protein 2 (EMP2), which induces cytostasis and apoptosis in UBUC. METHODS: A series of in vitro and in vivo assays using different UBUC-derived cell lines and mouse xenograft models were performed, respectively. In addition, primary UBUC specimens were evaluated by immunohistochemistry. RESULTS: Exogenous expression of EMP2 in J82 UBUC cells significantly decreased DNA replication and altered the expression levels of several TGFß signaling-related proteins. EMP2 knockdown in BFTC905 UBUC cells resulted in opposite effects. EMP2-dysregulated cell cycle progression was found to be mediated by the TGFß/TGFBR1/SP1 family member SMAD. EMP2 or purinergic receptor P2X7 (P2RX7) gene expression upregulation induced apoptosis via both intrinsic and extrinsic pathways. In 242 UBUC patient samples, P2RX7 protein levels were found to be significantly and positively correlated with EMP2 protein levels. Low P2RX7 levels conferred poor disease-specific and metastasis-free survival rates, and significantly decreased apoptotic cell rates. EMP2 was found to physically interact with P2RX7. In the presence of a P2RX7 agonist, BzATP, overexpression of both EMP2 and P2RX7 significantly increased apoptotic cell rates compared to overexpression of EMP2 or P2RX7 alone. CONCLUSIONS: EMP2 induces cytostasis via the TGFß/SMAD/SP1 axis and recruits P2RX7 to enhance apoptosis in UBUC. Our data provide new insights that may be employed for the design of UBUC targeting therapies.


Asunto(s)
Apoptosis/genética , Carcinoma de Células Transicionales/genética , Proliferación Celular/genética , Glicoproteínas de Membrana/genética , Proteínas/genética , Receptores Purinérgicos P2X7/genética , Neoplasias de la Vejiga Urinaria/genética , Animales , Carcinoma de Células Transicionales/metabolismo , Carcinoma de Células Transicionales/patología , Línea Celular Tumoral , Regulación Neoplásica de la Expresión Génica , Humanos , Immunoblotting , Glicoproteínas de Membrana/metabolismo , Ratones Endogámicos NOD , Ratones SCID , Proteínas/metabolismo , Receptores Purinérgicos P2X7/metabolismo , Reacción en Cadena de la Polimerasa de Transcriptasa Inversa , Transducción de Señal/genética , Proteínas Smad/genética , Proteínas Smad/metabolismo , Factor de Transcripción Sp1/genética , Factor de Transcripción Sp1/metabolismo , Factor de Crecimiento Transformador beta/genética , Factor de Crecimiento Transformador beta/metabolismo , Trasplante Heterólogo , Neoplasias de la Vejiga Urinaria/metabolismo , Neoplasias de la Vejiga Urinaria/patología
15.
Biomolecules ; 10(8)2020 08 17.
Artículo en Inglés | MEDLINE | ID: mdl-32824461

RESUMEN

Although gastric cancer is one of the most common causes of cancer death in the world, mechanisms underlying this type of tumor have not been fully understood. In this study, we found that IQGAP3, a member of the IQGAP gene family, was significantly up-regulated in human gastric cancer starting from the early stages of tumor progression. Overexpression of IQGAP3 in 293T and NIH3T3 cells, which have no endogenous IQGAP3 expression, resulted in morphological change with multiple dendritic-like protrusions and enhanced migration. Overexpression of IQGAP3 also led to reduced cell-cell adhesion in 293T cells, likely as a result of its interactions with e-cadherin or ß-catenin proteins. Additionally, IQGAP3 accumulated along the leading edge of migrating cells and at the cleavage furrow of dividing cells. In contrast, suppression of IQGAP3 by short-interfering RNA (siRNA) markedly reduced invasion and anchorage-independent growth of MKN1 and TMK-1 gastric cancer cells. We further confirmed that IQGAP3 interacted with Rho family GTPases, and had an important role in cytokinesis. Taken together, we demonstrated that IQGAP3 plays critical roles in migration and invasion of human gastric cancer cells, and regulates cytoskeletal remodeling, cell migration and adhesion. These findings may open a new avenue for the diagnosis and treatment of gastric cancer.


Asunto(s)
Proteínas Activadoras de GTPasa/genética , Proteínas Activadoras de GTPasa/metabolismo , Neoplasias Gástricas/patología , Regulación hacia Arriba , Animales , Línea Celular Tumoral , Movimiento Celular , Regulación Neoplásica de la Expresión Génica , Células HEK293 , Humanos , Ratones , Células 3T3 NIH , Clasificación del Tumor , Invasividad Neoplásica , Neoplasias Gástricas/genética , Neoplasias Gástricas/metabolismo
16.
Theranostics ; 10(25): 11775-11793, 2020.
Artículo en Inglés | MEDLINE | ID: mdl-33052246

RESUMEN

Urothelial carcinoma (UC), including upper tract urothelial carcinoma (UTUC) and urinary bladder urothelial carcinoma (UBUC), is a common malignant disease in developed countries. Oncogenic metabolic lesions have been associated with UC development. Methods: Using data mining, a series of studies were performed to study the involvement of SLC14A1 in UC specimens, animal models and UC-derived cell lines. Results: In two cohorts of UTUC (n = 340) and UBUC (n = 295), the SLC14A1 protein level was an independent prognostic factor. Epigenetic silencing contributed to SLC14A1 downregulation in UCs. Total and membranous SLC14A1 played tumor suppressive roles through the inhibition of cell proliferation and metastasis in distinct UC-derived cells and animal models. Functional SLC14A1 prevented the accumulation of arginine and urea, enhanced mitochondrial fusion and aerobic respiration, inhibited glycolysis by altering the expression levels of several related proteins and sensitized arginine-deprivation treatment in ASS1-deficient UC-derived cells. In vitro and in vivo, SLC14A1 inhibited the mTOR signaling pathway and subsequently tumorigenesis, supported by reduced arginine concentrations in vitro. Nuclear SLC14A1 transrepressed HK2 and DEGS1 genes via recruitment of HDAC1 and/or SIN3A to maintain metabolic homeostasis and thereafter impeded tumorigenesis. Conclusion: Clinical associations, animal models and in vitro indications provide solid evidence that the SLC14A1 gene is a novel tumor suppressor in UCs. Total and membranous SLC14A1 prevents urea and arginine accumulation via the mTOR signaling pathway. Nuclear SLC14A1 recruits HDAC1 to transrepress oncometabolite genes.


Asunto(s)
Carcinoma de Células Transicionales/genética , Histona Desacetilasa 1/metabolismo , Proteínas de Transporte de Membrana/metabolismo , Neoplasias de la Vejiga Urinaria/genética , Anciano , Animales , Arginina/metabolismo , Carcinogénesis/metabolismo , Carcinoma de Células Transicionales/mortalidad , Carcinoma de Células Transicionales/patología , Carcinoma de Células Transicionales/cirugía , Línea Celular Tumoral , Núcleo Celular/metabolismo , Cistectomía , Progresión de la Enfermedad , Supervivencia sin Enfermedad , Regulación hacia Abajo , Represión Epigenética , Ácido Graso Desaturasas/genética , Ácido Graso Desaturasas/metabolismo , Femenino , Perfilación de la Expresión Génica , Regulación Neoplásica de la Expresión Génica , Técnicas de Silenciamiento del Gen , Hexoquinasa/genética , Hexoquinasa/metabolismo , Humanos , Masculino , Proteínas de Transporte de Membrana/análisis , Proteínas de Transporte de Membrana/genética , Ratones , Persona de Mediana Edad , Pronóstico , Estudios Retrospectivos , Transducción de Señal/genética , Serina-Treonina Quinasas TOR/metabolismo , Activación Transcripcional , Urea/metabolismo , Vejiga Urinaria/patología , Vejiga Urinaria/cirugía , Neoplasias de la Vejiga Urinaria/mortalidad , Neoplasias de la Vejiga Urinaria/patología , Neoplasias de la Vejiga Urinaria/cirugía , Ensayos Antitumor por Modelo de Xenoinjerto , Transportadores de Urea
17.
Front Genet ; 11: 589784, 2020.
Artículo en Inglés | MEDLINE | ID: mdl-33362852

RESUMEN

Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

18.
Genetics ; 178(3): 1683-91, 2008 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-18245324

RESUMEN

Insulin genes in mouse and rat compose a two-gene system in which Ins1 was retroposed from the partially processed mRNA of Ins2. When Ins1 originated and how it was retained in genomes still remain interesting problems. In this study, we used genomic approaches to detect insulin gene copy number variation in rodent species and investigated evolutionary forces acting on both Ins1 and Ins2. We characterized the phylogenetic distribution of the new insulin gene (Ins1) by Southern analyses and confirmed by sequencing insulin genes in the rodent genomes. The results demonstrate that Ins1 originated right before the mouse-rat split ( approximately 20 MYA), and both Ins1 and Ins2 are under strong functional constraints in these murine species. Interestingly, by examining a range of nucleotide polymorphisms, we detected positive selection acting on both Ins2 and Ins1 gene regions in the Mus musculus domesticus populations. Furthermore, three amino acid sites were also identified as having evolved under positive selection in two insulin peptides: two are in the signal peptide and one is in the C-peptide. Our data suggest an adaptive divergence in the mouse insulin two-gene system, which may result from the response to environmental change caused by the rise of agricultural civilization, as proposed by the thrifty-genotype hypothesis.


Asunto(s)
Evolución Molecular , Insulina/genética , Ratones/genética , Aminoácidos , Animales , Secuencia de Bases , Southern Blotting , Genes Duplicados , Humanos , Datos de Secuencia Molecular , Filogenia , Selección Genética
20.
Front Genet ; 9: 309, 2018.
Artículo en Inglés | MEDLINE | ID: mdl-30158952

RESUMEN

Intrahepatic cholangiocarcinoma (ICC) is the cancer of the intrahepatic bile ducts, and together with hepatocellular carcinoma (HCC), constitute the majority of primary liver cancers. ICC is a rare disorder as its overall incidence is < 1/100,000 in the United States and Europe. However, it shows much higher incidence in particular geographical regions, such as northeastern Thailand, where liver fluke infection is the most common risk factor of ICC. Since the early stages of ICC are often asymptomatic, the patients are usually diagnosed at advanced stages with no effective treatments available, leading to the high mortality rate. In addition, unclear genetic mechanisms, heterogeneous nature, and various etiologies complicate the development of new efficient treatments. Recently, a number of studies have employed high-throughput approaches, including next-generation sequencing and mass spectrometry, in order to understand ICC in different biological aspects. In general, the majority of recurrent genetic alterations identified in ICC are enriched in known tumor suppressor genes and oncogenes, such as mutations in TP53, KRAS, BAP1, ARID1A, IDH1, IDH2, and novel FGFR2 fusion genes. Yet, there are no major driver genes with immediate clinical solutions characterized. Interestingly, recent studies utilized multi-omics data to classify ICC into two main subgroups, one with immune response genes as the main driving factor, while another is enriched with driver mutations in the genes associated with epigenetic regulations, such as IDH1 and IDH2. The two subgroups also show different hypermethylation patterns in the promoter regions. Additionally, the immune response induced by host-pathogen interactions, i.e., liver fluke infection, may further stimulate tumor growth through alterations of the tumor microenvironment. For in-depth functional studies, although many ICC cell lines have been globally established, these homogeneous cell lines may not fully explain the highly heterogeneous genetic contents of this disorder. Therefore, the advent of patient-derived xenograft and 3D patient-derived organoids as new disease models together with the understanding of evolution and genetic alterations of tumor cells at the single-cell resolution will likely become the main focus to fill the current translational research gaps of ICC in the future.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA