Solvent-free synthesis and in-silico molecular docking study of (E)-3-(ß-C-glycosylmethylidene)-N-aryl/alkyl succinimides.

Globally, human papillomavirus (HPV) infection is the leading cause of mortality associated with cervical cancer, oral cancer (oropharyngeal), and head and neck squamous cell carcinoma (HNSCC). It is essential to explore anti-cancer drugs against life-threatening HPV infections. Aiming to search for potentially better anticancer agents, a small library of ß-C-glycosylated methylidene succinimides have been synthesized under bulk and mechanical grinding conditions using the Wittig olefination reaction. Thus, the reaction of different 2,3,4,6-tetra-O-benzyl-C-glycosyl aldehydes with N-aryl/alkyl maleimides in the presence of PPh3 at 25 °C under bulk and mechanical grinding conditions results in the formation of stereochemically defined (E)-3-(2,3,4,6-tetra-O-benzyl-C-glycosylmethylidene)-N-alkyl/phenyl succinimides, which upon debenzylation with 1 M BCl3 in DCM at -78 °C lead to the synthesis of (E)-3-(C-glycosylmethylidene)-N-alkyl/phenyl succinimides in good to excellent yields. The developed methodology is efficient and environmentally benign because there is no use of organic solvents, and the products are obtained in a stereochemically defined form and in high yields. The aqueous solubility of all synthesized ß-C-glycosylated methylidene succinimides makes them potential candidates for the evaluation of their different biological activities. In the present work, the synthesized glycosylated alkylidine succinimides were subjected to an in-silico molecular docking study against the E6 oncoprotein of high-risk type HPV16, which is responsible for the inactivation of the tumor suppressor p53 protein. Analysis of the molecular docking data revealed that the synthesized compounds are effective inhibitors of HPV infection, which is the cause of oral, head and neck, and cervical cancer. In comparison with the positive control 5-FU, an anti-cancer drug used in chemotherapy, more than fifteen compounds were found to be better E6 protein inhibitors.

Molecular mechanisms behind ROS regulation in cancer: A balancing act between augmented tumorigenesis and cell apoptosis.

ROS include hydroxyl radicals (HO.), superoxide (O2..), and hydrogen peroxide (H2O2). ROS are typically produced under physiological conditions and play crucial roles in living organisms. It is known that ROS, which are created spontaneously by cells through aerobic metabolism in mitochondria, can have either a beneficial or detrimental influence on biological systems. Moderate levels of ROS can cause oxidative damage to proteins, DNA and lipids, which can aid in the pathogenesis of many disorders, including cancer. However, excessive concentrations of ROS can initiate programmed cell death in cancer. Presently, a variety of chemotherapeutic drugs and herbal agents are being investigated to induce ROS-mediated cell death in cancer. Therefore, preserving ROS homeostasis is essential for ensuring normal cell development and survival. On account of a significant association of ROS levels at various concentrations with carcinogenesis in a number of malignancies, further studies are needed to determine the underlying molecular mechanisms and develop the possibilities for intervening in these processes.

Serratia endocarditis, uncommon organism, with significant complications.

Serratia marcescens is an aerobic, Gram-negative bacillus predominantly seen in patients with intravenous drug use, immunosuppression, previous antibiotic exposure, and indwelling catheterization. Gram-negative organism causing infective endocarditis (IE) is rare. Serratia marcescens IE is uncommon and is reported to be seen in 0.14% of all cases. In this report, we discuss in detail about a 38-year-old man with a history of intravenous drug abuse presenting with S. marcescens related prosthetic valve IE.

Evaluation of Therapeutic Potential of Selected Plant-Derived Homeopathic Medicines for their Action against Cervical Cancer.

BACKGROUND: Plant-derived homeopathic medicines (HMs) are cheap and commercially available but are mechanistically less explored entities than conventional medicines. PURPOSE: The aim of our study was to evaluate the impact of selected plant-derived HMs derived from Berberis aquifolium (BA), Berberis vulgaris (BV), Mentha piperita (MP), Curcuma longa (CL), Cinchona officinalis (CO), Thuja occidentalis (TO) and Hydrastis canadensis (HC) on cervical cancer (CaCx) cells in vitro. METHODS: We screened the mother tincture (MT) and 30C potencies of the above-mentioned HMs for anti-proliferative and cytotoxic activity on human papillomavirus (HPV)-negative (C33a) and HPV-positive CaCx cells (SiHa and HeLa) by MTT assay. Total phenolic content (TPC) and the free-radical scavenging activity of each HM was also determined using standard assays. Phytochemicals reportedly available in these HMs were examined for their potential inhibitory action on HPV16 E6 by in silico molecular docking. RESULTS: All tested MTs induced a differential dose-dependent cytotoxic response that varied with cell line. For C33a cells, the order of response was TO > CL > BA > BV > HC > MP > CO, whereas for SiHa and HeLa cells the order was HC > MP > TO > CO > BA > BV > CL and CL > BA > CO, respectively. 30C potencies of all HMs showed an inconsistent response. Further, anti-CaCx responses displayed by MTs did not follow the order of an HM's phenolic content or free radical scavenging activity. Analysis revealed anti-oxidant content of BA, BV and HC had the lowest contribution to their anti-CaCx activity. Using in silico modeling of molecular docking between the HPV16 E6 protein crystallographic structures (6SJA and 4XR8) and main phytochemical components of BV, BA, HC, CL and TO, their potential to inhibit the HPV16 E6 protein carcinogenic interactions was identified. CONCLUSION: The study has shown a comparative evaluation of the potential of several plant-derived MTs and HMs to affect CaCx cell line survival in vitro (through cytotoxicity and free radical scavenging) and their theoretical molecular targets in silico for the first time. Data demonstrated that MTs of BA and BV are likely to be the most potent HMs that strongly inhibited CaCx growth and have a strong anti-HPV phytochemical constitution.

Transcriptome analysis of cervical cancer exosomes and detection of HPVE6*I transcripts in exosomal RNA.

BACKGROUND: Exosomes play a key role in cell-to-cell communication and are integral component of the tumor microenvironment. Recent observations suggest transfer of RNA through tumor-derived exosomes that can potentially translate into regulatory proteins in the recipient cells. Role of cervical cancer-derived exosomes and their transcript cargo is poorly understood. MATERIALS AND METHODS: The total RNA of exosomes from HPV-positive (SiHa and HeLa) and HPV-negative (C33a) cervical cancer cell lines were extracted and the transcripts were estimated using Illumina HiSeq X. Further, validation of HPV transcripts were performed using RT-PCR. RESULTS: 3099 transcripts were found to be differentially-exported in HPV-positive vs. HPV-negative exosomes (p value <0.05). Analysis of top 10 GO terms and KEGG pathways showed enrichment of transcripts belonging to axon guidance and tumor innervation in HPV-positive exosomes. Among top 20 overexpressed transcripts, EVC2, LUZP1 and ANKS1B were the most notable due to their involvement in Hh signaling, cellular migration and invasion, respectively. Further, low levels of HPV-specific reads were detected. RT-PCR validation revealed presence of E6*I splice variant of HPV18 in exosomal RNA of HeLa cells. The E6*I transcripts were consistently retained in exosomes obtained from HeLa cells undergoing 5-FU and cisplatin-induced oxidative stress. CONCLUSION: Our data suggests the enrichment of poly-A RNA transcripts in the exosomal cargo of cervical cancer cells, which includes pro-tumorigenic cellular RNA and viral transcripts such as HPV E6, which may have clinical utility as potential exosomal biomarkers of cervical cancer.

Delineating role of NF-κB and interacting cytokines during prostate cancer-induced osteoclastogenesis.

Prostate cancer (PCa) frequently metastasizes to the bone leading to devastating complications such as severe pain and fracture. However, the mechanisms by which PCa cells cause bone loss remain less understood. We investigated the role and mechanisms by which PCa cells induce osteoclastogenesis using cultured monocytic osteoclast precursors. Treatment of RAW264.7 cells with PCa cell lines: DU145, LNCaP, PC-3, or their conditioned media led to the formation of distinct multinucleated, TRAP+ osteoclasts. This phenomenon was associated with the increased activation of transcription factor nuclear factor-kB (NF-κB). High transcript level of receptor activator of nuclear factor-kB ligand (RANKL), tumor necrosis factor-α (TNF-α), and interleukin-6 (IL-6) were detected in PCa cells. TNF-α and LT-α augmented, whereas IL-6 reduced the RANKL-induced osteoclast formation in RAW264.7 cultures. Our results also demonstrated that PCa cells-induced osteoclastogenesis involved the activation of the TRAF6-IKK-p65-NF-κB signaling cascade. Together, our study demonstrates that PCa cells produce RANKL and several other pro-inflammatory cytokines known to influence osteoclastogenesis, by targeting the NF-κB signaling pathway.

Exosomes from cervical cancer cells facilitate pro-angiogenic endothelial reconditioning through transfer of Hedgehog-GLI signaling components.

BACKGROUND: Angiogenic switch is a hallmark feature of transition from low-grade to high-grade cervical intraepithelial neoplasia (CIN) in cervical cancer progression. Therefore, early events leading to locally-advanced cervical metastatic lesions demand a greater understanding of the underlying mechanisms. Recent leads indicate the role of tumor-derived exosomes in altering the functions of endothelial cells in cervical cancer, which needs further investigation. METHODS: Exosomes isolated from cervical cancer cell lines were assessed for their angiogenic effect on the human umbilical vein endothelial cells (HUVEC) using tube formation and wound healing assay. The exosomal uptake by HUVEC cells was monitored using PKH-67 labelling followed by fluorescence microscopy. Alterations in Hh-GLI signaling components, PTCH1 and GLI1, in HUVEC were measured by immunoblotting. Changes in angiogenesis-related transcripts of vascular endothelial growth factor VEGF-A, VEGF-B, VEGFR2 and angiopoietin-1, angiopoietin-2, osteopontin were measured in exosome-treated HUVEC and in the exosomal RNA by RT-PCR. RESULTS: Enhanced tube formation, with an increased number of nodes and branching was observed in HUVEC's treated with exosomes derived from different cervical cancer cell lines. HPV-positive (SiHa and HeLa) cells' exosomes were more angiogenic. Exosome-treated HUVEC showed increased migration rate. PKH-67 labelled exosomes were found internalized in HUVEC. A high level of PTCH1 protein was detected in the exosome-treated endothelial cells. Subsequent RT-PCR analysis showed increased transcripts of Hh-GLI downstream target genes VEGF-A, VEGFR2, angiopoietin-2, and decreased expression of VEGF-B, and angiopoietin-1, suggestive of active Hh-GLI signaling. These effects were more pronounced in HUVEC's treated with exosomes of HPV-positive cells. However, these effects were independent of tumor-derived VEGF-A as exosomal cargo lacked VEGF-A transcripts or proteins. CONCLUSION: Overall, the data showed cervical cancer exosomes promote pro-angiogenic response in endothelial cells via upregulation of Hh-GLI signaling and modulate downstream angiogenesis-related target genes. The study provides a novel exosome-mediated mechanism potentially favoring cervical angiogenesis and thus identifies the exosomes as potential pharmacological targets against locally-advanced metastatic cervical lesions.

First report of Sclerotium rolfsii causing collar rot on Berseem (Trifolium alexandrinum) in India.

Berseem (Trifolium alexandrinum) is a winter season legume fodder crop widely cultivated in the central and northern parts of India. It is considered the 'King of fodder' for its high quality green fodder, which is a rich source of protein and low in fibre. Symptoms similar to collar rot were observed in experimental sites at the ICAR-Indian Grassland and Fodder Research institute (IGFRI), Jhansi (N25º 52' 749.20″, E78º 55' 452.70″), Uttar Pradesh, India in March 2019. The incidence of disease was ranged from 18 to 22% during 2019. Symptoms included dark colored water-soaked lesions at the base of stems, stem thinning (resembles wire stem) and eventually wilting of the whole plant. A white mycelial mat was observed on the stem and collar region and light brown to tan colored sclerotial bodies formed as disease progressed. To determine the etiology of the infection, 30 diseased plants with typical symptoms were collected from the 3 different fields and used for the isolation of causal agent. Infected stem portion were cut in to small pieces (5mm), surface sterilized with 2% sodium hypochlorite (NaOCl) for 2 minutes, washed three times with sterile distilled water and air dried. The sterilized infected tissues were cultured on potato dextrose agar amended with streptomycin sulphate @ 50µg/ml and incubated at 28±1º C for 3 days. After four days, hyaline septate mycelia ranging 2-3µm in diameter grow radially over the whole plate (90 mm). Sclerotia formation started 6 days after incubation. Sclerotia were initially white and later turned brownish to tan as they matured. The number of sclerotia per plate ranged from 55 to 120 (n=5) at 12 days after inoculation. The diameter of matured sclerotial bodies ranged from 0.1mm to 1.35mm (n=25). Genomic DNA was extracted from mycelium using the CTAB method (Murray and Thompson, 1980). Three regions of rDNA viz., internal transcribed spacer (ITS), large subunit (LSU), and small subunit (SSU) were used to identify the etiology of the disease. The isolate was amplified with ITS1 (5'CGGATCTCTTGGTTCTGGGA3')/ ITS4 (5'GACGCTCGAACATGCC3') described by White et al. (1990) and sequenced. The ITS sequence (NCBI GenBank Accession No: MT026581) showed 98.21 % similar to Athelia rolfsii (MH514001.1). The isolate also amplified with primers LSU (LROR: ACCCGCTGAACTTAAGC/ LR5: TCCTGAGGGAAACTTCG) and SSU (NS1: GTAGTCATATGCTTGTCTC/ NS4: CTTCCGTCAATTCCTTTAAG). The LSU (MT225781) and SSU (MT225782) sequences showed 99.90 % and 100 % similarity to Athelia rolfsii (AY635773.1) and Athelia rolfsii (AY635773.1) respectively. Based on the morphological and molecular characteristics, the pathogen responsible for collar rot in berseem was identified as Athelia rolfsii (Anamorph: Sclerotium rolfsii) (Mordue, 1974). To confirm pathogenicity, inoculum was prepared by inoculating mycelial plugs of pathogen into autoclaved corn sand meal (5:95) and incubated at 28±1º C for 12 days. The inoculum (30g) was placed at stem portion of 15 day old seedlings (n=30) of berseem (Cv. Wardan) raised in pots filled with sterilized soil. Seedlings (n=25) inoculated with sterilized corn sand meal (30g) served as the control. The pots were placed inside of a plant growth chamber (26±2º C, 65% RH) for 15 days. Water soaked spots with white mycelium were observed on the collar region after 3 days. After 7 days, stems were completely covered by mycelia and death of seedlings was observed 14 days after inoculation. The pathogen was recovered from the artificially inoculated berseem seedlings (n=15). No symptoms were observed in control plants. Based on morphological and molecular characterization, the present isolate was confirmed as Sclerotium rolfsii. To the best of our knowledge, this is the first report of S. rolfsii causing collar rot of berseem in India.

Human papillomavirus oncoproteins differentially modulate epithelial-mesenchymal transition in 5-FU-resistant cervical cancer cells.

Etiological role of viral proteins E6 and E7 of high-risk HPV in cervical carcinogenesis is well established. However, their contribution in chemoresistance and epithelial-mesenchymal transition (EMT) that leads to advanced metastatic lesions and chemoresistance is poorly defined. In the present study, contribution of viral oncoproteins in acquisition of EMT character during onset of chemoresistance was assessed. A chemoresistant cell line (SiHaCR) was developed from an established HPV16-positive cervical cancer cell line, SiHa, by escalating selection pressure of 5-fluorouracil (5-FU). Expression of Survivin, ABCG2, Snail, Slug, Twist, and Vimentin was examined in SiHa and SiHaCR cells by reverse transcriptase-PCR (RT-PCR) and immunoblotting assays. Mesenchymal phenotype in SiHaCR cells was confirmed by assessment of migration and invasion potentials. SiHaCR cells displayed elevated level of functional and molecular markers associated with chemoresistance (Survivin, ABCG2) and EMT (Snail, Slug, Twist, Vimentin) and reduced E-cadherin. SiHaCR also showed increased levels of HPV16 E6 and E7 transcripts. Specific silencing of HPV16 E6, but not E7 using corresponding siRNA, demonstrated a differential involvement of HPV oncogenes in manifestation of EMT. HPV16 E6 silencing resulted in reduction of Slug and Twist expression. However, the expression of Snail and Vimentin was only marginally affected. In contrast, there was an increase in the expression of E-cadherin. A reduced migration and invasion capabilities were observed only in E6-silenced SiHaCR cells, which further confirmed functional contribution of HPV16 E6 in manifestation of EMT. Taken together, our study demonstrated an active involvement of HPV16 E6 in regulation of EMT, which promotes chemoresistance in cervical cancer.

Temozolomide and flavonoids against glioma: from absorption and metabolism to exosomal delivery.

Patients with glioblastoma multiforme and anaplastic astrocytoma are treated with temozolomide. Although it has been demonstrated that temozolomide increases GBM patient survival, it has also been connected to negative immune-related adverse effects. Numerous research investigations have shown that flavonoids have strong antioxidant and chemo-preventive effects. Consequently, it might lessen chemotherapeutic medicines' side effects while also increasing therapeutic effectiveness. The need for creating innovative, secure, and efficient drug carriers for cancer therapy has increased over time. Recent research indicates that exosomes have enormous potential to serve as carriers and cutting-edge drug delivery systems to the target cell. In recent years, researchers have been paying considerable attention to exosomes because of their favorable biodistribution, biocompatibility, and low immunogenicity. In the present review, the mechanistic information of the anti-glioblastoma effects of temozolomide and flavonoids coupled with their exosomal delivery to the targeted cell has been discussed. In addition, we discuss the safety aspects of temozolomide and flavonoids against glioma. The in-depth information of temozolomide and flavonoids action via exosomal delivery can unravel novel strategies to target Glioma.

The Role of Phytonutrient Kaempferol in the Prevention of Gastrointestinal Cancers: Recent Trends and Future Perspectives.

In recent years, kaempferol, a natural flavonoid present in various fruits and vegetables, has received significant attention in gastrointestinal cancer research due to its varied therapeutic effects. Kaempferol has been proven to alter several molecular mechanisms and pathways, such as the PI3/Akt, mTOR, and Erk/MAPK pathway involved in cancer progression, showing its inhibitory effects on cell proliferation, survival, angiogenesis, metastasis, and migration. Kaempferol is processed in the liver and small intestine, but limited bioavailability has been a major concern in the clinical implications of kaempferol. Nano formulations have been proven to enhance kaempferol's efficacy in cancer prevention. The synergy of nanotechnology and kaempferol has shown promising results in in vitro studies, highlighting the importance for more in vivo research and clinical trials to determine safety and efficacy. This review aims to focus on the role of kaempferol in various types of gastrointestinal cancer and how the combination of kaempferol with nanotechnology helps in improving therapeutic efficacy in cancer treatment.

Assessing genotypes of buffel grass (Cenchrus ciliaris) as an alternative to maize silage for sheep nutrition.

Nutritive value of five Cenchrus ciliaris (buffel grass) genotypes (IG96-50, IG96-96, IG96-358, IG96-401 and IG96-403) weredetermined. Their sugar contents (>70 mg/g of dry matter) and ensiling potential were evaluated using in vitro batch culture and in vivo studies. Research indicated significant differences (P < 0.05) in the dry matter, organic matter, ether extract, neutral detergent fiber, acid detergent fiber, cellulose and lignin contents of the C. ciliaris genotypes tested. Genotypes also differed (P < 0.05) in total carbohydrates, structural carbohydrates, non-structural carbohydrates and protein fractions. Genotype IG96-96 had the lowest total digestible nutrients, digestible energy and metabolizable energy contents (377.2 g/kg, 6.95 and 5.71 MJ/kg of dry matter, respectively), and net energy values for lactation, maintenance and growth. After 45 days of ensiling, C. ciliaris silages differed (P < 0.05) in dry matter, pH, and lactic acid contents, and their values ranged between 255-339, 4.06-5.17 g/kg of dry matter and 10.8-28.0 g/kg of dry matter, respectively. Maize silage had higher (P < 0.05) Organic Matter (919.5g/kg of dry matter), ether extract (20.4g/kg of dry matter) and hemi-cellulose (272.3 g/kg of dry matter) than IG96-401 and IG96-96 silages. The total carbohydrates and non-structural carbohydrates of maize silage were higher (P < 0.05), while structural carbohydrates were comparable (P < 0.05) with C. ciliaris silages. Sheep on maize silage had (P < 0.05) higher metabolizable energy, lower crude protein, and digestible crude protein intake (g/kg of dry matter) than those on C. ciliaris silage diets. Nitrogen intake and urinary-N excretion were higher (P < 0.05) on genotype IG96-96 silage diet. Overall, this study suggested that certain C. ciliaris genotypes, notably IG96-401 and IG96-96, exhibited nutritive values comparable to maize silage in sheep studies, offering a promising avenue for future exploration as potential alternatives in diversified and sustainable livestock nutrition programs.

Advancements and recent explorations of anti-cancer activity of chrysin: from molecular targets to therapeutic perspective.

In recent times, there have been notable advancements in comprehending the potential anti-cancer effects of chrysin (CH), a naturally occurring flavonoid compound found abundantly in various plant sources like honey, propolis, and certain fruits and vegetables. This active compound has garnered significant attention due to its promising therapeutic qualities and minimal toxicity. CH's ability to combat cancer arises from its multifaceted mechanisms of action, including the initiation of apoptosis and the inhibition of proliferation, angiogenesis, metastasis, and cell cycle progression. CH also displays potent antioxidant and anti-inflammatory properties, effectively counteracting the harmful molecules that contribute to DNA damage and the development of cancer. Furthermore, CH has exhibited the potential to sensitize cancer cells to traditional chemotherapy and radiotherapy, amplifying the effectiveness of these treatments while reducing their negative impact on healthy cells. Hence, in this current review, the composition, chemistry, mechanisms of action, safety concerns of CH, along with the feasibility of its nanoformulations. To conclude, the recent investigations into CH's anti-cancer effects present a compelling glimpse into the potential of this natural compound as a complementary therapeutic element in the array of anti-cancer approaches, providing a safer and more comprehensive method of combating this devastating ailment.

A study to compare the effect of adding 12 days DEC regimen to 6 years annual mass drug administration to eliminate microfilaraemia infection in the community in rural Kanpur, Uttar Pradesh, India.

Lymphatic filariasis is a major public health problem of tropical countries. Although its elimination is planned as global effort using mass drug administration in affected communities but its impact has been influenced by MDA coverage across countries. The drug coverage is affected by fever as side effect and its continuation for over 6 years which affect the population participation. Therefore alternative approaches are needed which can show impact faster than standard MDA. Present research using additional 12 days dose of DEC to mf carriers, show that if drug coverage could be regular, sustainable impact could be created in 4 years.

Exosomal miRNAs as novel avenues for breast cancer treatment.

Breast cancer is the most commonly diagnosed cancer and a leading cause of death in women worldwide. It is a heterogeneous disease, as shown by the gene expression profiles of breast cancer samples. It begins in milk-producing ducts, with a high degree of diversity between and within tumors, as well as among cancer-bearing individuals. The enhanced prevalence of breast cancer is influenced by various hormonal, lifestyle, and environmental factors, and very early onset of the disease correlates strongly with the risk of local and distant recurrence. Many subtypes are difficult to treat with conventional therapeutic modalities, and therefore, optimal management and early diagnosis are the first steps to minimizing the mortality linked with breast cancer. The use of newer methods of nanotechnology extends beyond the concept of synthesizing drug delivery mechanisms into the creation of new therapeutics, such as delivering chemotherapeutics with nanomaterial properties. Exosomes, a class of nanovesicles, are emerging as novel tools for deciphering the patient-specific proteins and biomarkers across different disease models, including breast cancer. In this review, we address the role of exosomal miRNA in breast cancer diagnosis and treatment.

Nutrient and Rumen Fermentation Studies of Indian Pasture Legumes for Sustainable Animal Feed Utilisation in Semiarid Areas.

This study evaluated 5 annual and 11 perennial Indian pasture legumes species for their nutritive value, dry matter and mineral contents and in vitro fermentation parameters. Legume species differed significantly (p < 0.05) in various nutritional aspects such as organic matter, crude protein (CP), ether extract, fibres and protein fractions. Perennial Clitoria ternateaa had higher (p < 0.05) buffer soluble protein (477), while neutral detergent soluble protein was highest in annually grown Lablab purpureus (420 g/kg CP). Atylosia scarabaeoides (AS) had higher levels of nonstructural carbohydrates (NSCs) (392 g/kg dry matter (DM)) than structural carbohydrates (SC) (367 g/kg DM). Its rapidly degradable fraction (51.7 g/kg (total carbohydrate) tCHO) was lower (p < 0.05) than other fractions of carbohydrates. Total digestible nutrients, digestible energy and metabolisable energy varied, with Desmodium virgatus (DV) having higher values and Stylosanthas seabrana (SSe) having the lowest. Predicted dry matter intake, digestible dry matter and relative feed value also showed significant differences (p < 0.05). Annual grasses such as Dolichos biflorus, Macroptilium atropurpureum, Rhynchosia minima (RM) were found to be better balanced with micro minerals. In vitro dry matter degradability, partition factor, short-chain fatty acids and microbial protein production of legumes varied significantly (p < 0.05). Gas and CH4 production (mL/g and mL/g (digestible DM) DDM) also varied, with Clitoria ternatea-blue having the highest gas production and C. ternatea -white (CT-w) and AS having lower CH4 production. Methane in total gas was low for DV, RM and CT-w (8.99%, 9.72% and 9.51%). Loss of DE and ME as CH4 varied (p < 0.05) among the legumes. Each legume offers unique benefits, potentially allowing for tailored combinations of annual and perennial legumes to optimize rumen feed efficiency.

Effect of thermal treatments on the matrix components, inherent glycemic potential, and bioaccessibility of phenolics and micronutrients in pearl millet rotis.

Pearl millet (PM) is a nutri-cereal rich in various macro and micronutrients required for a balanced diet. Its grains have a unique phenolic and micronutrient composition; however, the lower bioaccessibility of nutrients and rancidity of flour during storage are the major constraints in its consumption and wide popularity. Here, to explore the effect of different thermal processing methods, i.e., hydrothermal (HT), microwave (MW), and infrared (IR) treatments, on the digestion of starch, phenolics, and microelements (Fe and Zn), an in vitro digestion model consisting of oral, gastric and intestinal digestion was applied to PM rotis. The hydrothermally treated PM roti was promising as it showed lower inherent glycemic potential (60.4%) than the untreated sample (72.4%) and less enzymatic activities associated with rancidity in PM flour. FTIR revealed an increased ratio of 1047/1022 cm-1 in the hydrothermally treated sample, reflecting the enhancement of the structurally ordered degree and compactness of starch compared to other thermal treatments. A tighter and more compact microstructure with an agglomeration of starch in the hydrothermally treated PM flour was observed by SEM. These structural changes could provide a better understanding of the lower starch digestion rate in the hydrothermally treated flour. However, HT treatment significantly (P < 0.05) reduced the bioaccessibility of phenolics (10.6%) compared to native PM rotis and slightly reduced the Fe (2%) and Zn (3.2%) bioaccessibility present in PM rotis.

Quantitative assessment of antioxidant potential of selected homeopathic preparations in clinical practice.

OBJECTIVES: Antioxidant property like radical scavenging is a primary target to elucidate the efficacy mechanism of a drug against diseases linked to oxidative stress such as cancer, metabolic disorders, rheumatoid arthritis, etc. In alternative therapies, homeopathy is one of the preferred choices by patients and clinicians due to its potential to cure chronic and complex illnesses. However, the efficacy of homeopathic preparations at high diluted potencies attracts rational criticism due to insufficient scientific knowledge supporting the mechanism of action. Therefore, an attempt was made to estimate the total phenolic content (TPC) and radical scavenging activity of clinically prescribed homeopathic drugs. METHODS: With gallic acid as a reference control, mother tinctures (MTs) and different potencies of Eucalyptus globulus (EG), Syzygium jambolanum (SJ), Ruta graveolens (RG), and Thuja occidentalis (TO) were used to perform Folin-Ciocalteu test, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS), and 2,2-diphenyl-1-picrylhydrazyl (DPPH) assays. RESULTS: The results showed TPC of MTs equivalent to µg/mL of gallic acid viz; EG (4,872.5 ± 133.2), SJ (8,840.5 ± 14.8), RG (985.6 ± 39.1), and TO (341.5 ± 19.5) with significant ABTS and DPPH radical scavenging potential. Whereas 30C and 200C potencies of each homeopathic drug showed undetectable phenolic content and insignificant radical scavenging potential compared to vehicle control, i.e., alcohol 90% (2.0 ± 1.5). CONCLUSIONS: The reported efficacy of 30C and 200C potencies of homeopathic medicines against oxidative stress-related illnesses might be due to mechanisms other than radical scavenging. Furthermore, the assays studied can be helpful in drug standardization and quality control of MTs that are used as starting material in homeopathic preparations.

Twenty-four years lucerne (Medicago sativa L.) breeder seed production in India: a retrospective study.

Lucerne (Medicago sativa L.) is the second most significant winter leguminous fodder crop after berseem in India. Breeder seed (BS) is the first stage of the seed production chain, as it is the base material for producing foundation and certified seeds. In India, lucerne BS demand has been reduced by 85.58% during the last 24 years (1998-1999 to 2021-2022), declining from 2150 kg to 310 kg. Out of 14 varieties released and notified so far, only nine varieties entered the seed chain since 1998-1999. It shows narrow varietal diversification and, hence, needs robust breeding programs towards enriching genetic variability and varietal development. The present study also highlights the disparity in BS demand and production over the years and puts forth the possible reasons behind the reduction in BS demand and production in the country. Out of the nine varieties, the BS demand of Anand-2 (53.11%) was highest, followed by Type-9 (19.44%) and RL-88 (13.60%). Varietal replacement rate (VRR) was found to be moderate, i.e., 23.67% for the varieties having <5 years old age in the last 3 years (2019-2020 to 2021-2022). It has also been estimated that BS produced (233 kg) during 2021-2022 can cover the approximate area of 6,300 ha at farmers' fields in 2024-2025 if the seed chain functions 100%, effectively. The present study provides a holistic overview of lucerne BS demand and production, challenges in BS production, and the way forward to develop more varieties and surplus BS production in the country.

Cardiovascular complications following medical termination of pregnancy: An updated review.

BACKGROUND: Around 1 million cases of medical termination of pregnancy (MTP) take place yearly in the United States of America with around 2 percent of this population developing complications. The cardiovascular (CVD) complications occurring post MTP or after stillbirth is not very well described. AIM: To help the reader better understand, prepare, and manage these complications by reviewing various cardiac comorbidities seen after MTP. METHODS: We performed a literature search in PubMed, Medline, RCA, and google scholar, using the search terms "abortions" or "medical/legal termination of pregnancy" and "cardiac complications" or "cardiovascular complications". RESULTS: The most common complications described in the literature following MTP were infective endocarditis (IE) (n = 16), takotsubo cardiomyopathy (TTC) (n = 7), arrhythmias (n = 5), and sudden coronary artery dissection (SCAD) (n = 4). The most common valve involved in IE was the tricuspid valve in 69% (n = 10). The most observed causative organism was group B Streptococcus in 81% (n = 12). The most common type of TTC was apical type in 57% (n = 4). Out of five patients developing arrhythmia, bradycardia was the most common and was seen in 60% (3/5) of the patients. All four cases of SCAD-P type presented as acute coronary syndrome 10-14 d post termination of pregnancy with predominant involvement of the right coronary artery. Mortality was only reported following IE in 6.25%. Clinical recovery was reported consistently after optimal medical management following all these complications. CONCLUSION: In conclusion, the occurrence of CVD complications following pregnancy termination is infrequently documented in the existing literature. In this review, the most common CVD complication following MTP was noted to be IE and TTC.