Genome-wide DNA methylation profiling shows molecular heterogeneity of anaplastic pleomorphic xanthoastrocytoma.

In the revised World Health Organization classification 2016, anaplastic pleomorphic xanthoastrocytoma (PXA) has been newly defined as a variant of the PXA entity. Furthermore, some anaplastic PXA were reported to have extremely poor prognosis which showed a type of pediatric glioblastoma (GBM) molecular profile. Recent integrated molecular classification for primary central nervous system tumors proposed some differences between histological and molecular features. Herein, in a genome-wide molecular analysis, we show an extreme aggressive anaplastic PXA that resulted in a pediatric GBM molecular profile. A full implementation of the molecular approach is the key to predict prognosis and decide the treatment strategy for anaplastic PXA.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.

Succinate dehydrogenase B-deficient renal cell carcinoma: A case report with novel germline mutation.

Succinate dehydrogenase-deficient renal cell carcinoma (SDH-deficient RCC) is a newly introduced histological type of RCC, which is caused by loss of subunit genes of SDH. It is known to frequently demonstrate familial occurrence and be frequently associated with gastrointestinal stromal tumors and paraganglioma. To date, only 53 cases have been reported. Here, we present an additional case of SDH-deficient RCC occurring in a 40-year-old female. The tumor was histologically biphasic, consisting of tubular and solid architectures. The tumor cells possessed oval nuclei with small nucleoli, and an eosinophilic granular cytoplasm with occasional vacuoles. These cells completely lost the immunohistochemical expression of B subunit of SDH (SDHB). Consequently, the tumor was diagnosed as SDHB-deficient RCC. We identified a novel germ line mutation of the SDHB gene, and also confirmed a hemizygous deletion of the wild-type allele in the tumor cells. To define the pathological characteristics of SDH-deficient RCC, precise diagnosis and accumulation of more cases are required.

Colonic low-grade endometrial stromal sarcoma and orthotopic endometrial stromal tumor with limited infiltration sharing the JAZF1-SUZ12 gene fusion.

Endometrial stromal tumors (ESTs) are composed of cells resembling endometrial stroma, and are divided into benign and malignant types based on morphology. Endometrial stromal nodule (ESN) is a benign localized tumor, and endometrial stromal sarcoma (ESS) is an infiltrative and potentially metastatic neoplasm. A series of genetic aberrations contribute to pathological diagnosis of ESTs. At present, subsets of ESN and ESS-low grade (ESS-LG) are characterized as JAZF1-SUZ12/JJAZ1 gene fusion. The ESTs that show higher grade atypia but lack nuclear pleomorphism include YWHAE-FAM22 ESS. Here we report an unusual case of ESTs. Sudden colonic perforation occurred to the patient, and emergency surgery was performed. Pathological findings suggested metastatic ESS. Thorough medical examination of the genital organs detected a 1 cm-sized well-demarcated uterine tumor. Microscopically, the tumor lacked infiltrative features, conforming to the definition of ESN. Both lesions demonstrated identical cytology and shared JAZF1-SUZ12 gene fusion. Endometriosis was not found in any areas of the resected organs, strongly suggesting that the uterine orthotopic tumor metastasized. The current case uncovered the problems of differential diagnosis between ESN and ESS-LG. We demonstrate detailed pathological features of the two lesions, and discuss the possibility of orthotopic EST with limited infiltration to develop into ESS-LG.

Intraoperative Integrated Diagnostic System for Malignant Central Nervous System Tumors.

PURPOSE: The 2021 World Health Organization (WHO) classification of central nervous system (CNS) tumors uses an integrated approach involving histopathology and molecular profiling. Because majority of adult malignant brain tumors are gliomas and primary CNS lymphomas (PCNSL), rapid differentiation of these diseases is required for therapeutic decisions. In addition, diffuse gliomas require molecular information on single-nucleotide variants (SNV), such as IDH1/2. Here, we report an intraoperative integrated diagnostic (i-ID) system to classify CNS malignant tumors, which updates legacy frozen-section (FS) diagnosis through incorporation of a qPCR-based genotyping assay. EXPERIMENTAL DESIGN: FS evaluation, including GFAP and CD20 rapid IHC, was performed on adult malignant CNS tumors. PCNSL was diagnosed through positive CD20 and negative GFAP immunostaining. For suspected glioma, genotyping for IDH1/2, TERT SNV, and CDKN2A copy-number alteration was routinely performed, whereas H3F3A and BRAF SNV were assessed for selected cases. i-ID was determined on the basis of the 2021 WHO classification and compared with the permanent integrated diagnosis (p-ID) to assess its reliability. RESULTS: After retrospectively analyzing 153 cases, 101 cases were prospectively examined using the i-ID system. Assessment of IDH1/2, TERT, H3F3AK27M, BRAFV600E, and CDKN2A alterations with i-ID and permanent genomic analysis was concordant in 100%, 100%, 100%, 100%, and 96.4%, respectively. Combination with FS and intraoperative genotyping assay improved diagnostic accuracy in gliomas. Overall, i-ID matched with p-ID in 80/82 (97.6%) patients with glioma and 18/19 (94.7%) with PCNSL. CONCLUSIONS: The i-ID system provides reliable integrated diagnosis of adult malignant CNS tumors.

Case reports: chemoradiotherapy for locally advanced neuroendocrine carcinoma of the gallbladder.

Neuroendocrine carcinoma (NEC) is a rare subtype of malignant gallbladder tumor. Although surgical resection is the only potentially curative therapy for gallbladder NEC, most cases are surgically unresectable because of advanced stage disease and/or biologically aggressive behavior. The standard palliative treatment for malignant gallbladder tumors is chemotherapy; however, the efficacy of chemoradiotherapy in the treatment of gallbladder tumors is controversial. Here, we report a case of gallbladder NEC that showed a durable response to chemoradiotherapy. A 68-year-old Japanese man presented with a huge gallbladder tumor with liver and duodenal invasion. Pathological findings revealed poorly differentiated NEC of the gallbladder. After seven cycles of chemotherapy comprising cisplatin and irinotecan, computed tomography (CT) revealed remarkable tumor shrinkage, but an enlarged portal lymph node. The patient was treated with 50.4 Gy in 28 fractions with two cycles of cisplatin and etoposide. After chemoradiotherapy, the enlarged lymph node also decreased in size. Maximum standardized uptake value of fluorodeoxyglucose-positron emission tomography/CT(FDG-PET/CT) changed from 8.2 to physiological accumulation. We defined this condition as a complete response on both enhanced CT and FDG-PET/CT; therefore, we did not perform systemic treatment and only observed his condition. This patient remained healthy with no recurrence at 3 years after chemoradiotherapy.

Pulmonary Neuroendocrine Cells and Small Cell Lung Carcinoma: Immunohistochemical Study Focusing on Mechanisms of Neuroendocrine Differentiation.

Neuroendocrine (NE) differentiation has been histochemically detected in normal and cancer tissues and cells. Immunohistochemical analyses have provided a more detailed understanding of NE biology and pathology. Pulmonary NE cells are a rare lung epithelial type, and small cell carcinoma of the lung (SCLC) is a high-grade NE tumor. Pulmonary NE and SCLC cells share common mechanisms for NE differentiation. Neural or NE cell lineage-specific transcription factors, such as achaete-scute homologue 1 (Ascl1) and insulinoma-associated protein 1 (INSM1), are crucial for the development of pulmonary NE cells, and NE differentiation is influenced by the balance between Ascl1 and the suppressive neural transcription factor, hairy-enhancer of split 1, a representative target molecule of the Notch signaling pathway. In this review, we discuss the importance of Ascl1 and INSM1 in identifying pulmonary NE and SCLC cells and introduce Ascl1-related molecules detected by comparative RNA-sequence analyses. The molecular classification of SCLC based on the expression of lineage-specific transcription or co-transcription factors, including ASCL1, NEUROD1, POU2F3, and YAP1, was recently proposed. We attempted to characterize these 4 SCLC subtypes using integrated immunohistochemical studies, which will provide insights into the molecular characteristics of these subtypes and clarify the inter- and intratumor heterogeneities of SCLC.

Superficial siderosis and nonobstructive hydrocephalus due to subependymoma in the ventricle: An illustrative case report.

Background: Intraventricular tumors can generally result in obstructive hydrocephalus as they grow. Rarely, however, some intraventricular tumors develop superficial siderosis (SS) and trigger hydrocephalus, even though the tumor has hardly grown. Here, we present an illustrative case of SS and nonocclusive hydrocephalus caused by subependymoma of the lateral ventricles. Case Description: A 78-year-old man with an intraventricular tumor diagnosed 7 years ago had been suffering from gait disturbance for 2 years. He also developed cognitive impairment. Intraventricular tumors showed little growth on annual magnetic resonance imaging (MRI). MRI T2-star weighted images (T2*WI) captured small intratumoral hemorrhages from the beginning of the follow-up. Three years before, at the same time as the onset of ventricular enlargement, T2*WI revealed low intensity in the whole tumor and cerebral surface. Subsequent follow-up revealed that this hemosiderin deposition had spread to the brain stem and cerebellar surface, and the ventricles had expanded further. Cerebrospinal fluid (CSF) examination revealed xanthochromia. The tumor was completely removed en bloc. Histopathological findings were consistent with those of subependymoma. Although CSF findings improved, SS and hydrocephalus did not improve. Therefore, the patient underwent a lumboperitoneal shunt for CSF diversion after tumor resection. Conclusion: Some intraventricular tumors cause SS and nonobstructive hydrocephalus due to microbleeding, even in the absence of tumor growth. T2*WI and, if necessary, timely CSF examination can allow identification of presymptomatic SS. This follow-up strategy may provide a favorable course by facilitating early intervention in patients with intraventricular lesions, not just subependymomas.

IDH-Mutant Astrocytoma With Chromosome 19q13 Deletion Manifesting as an Oligodendroglioma-Like Morphology.

Partial deletions in chromosomes 1p and 19q are found in a subset of astrocytic tumors; however, it remains unclear how these alterations affect their histological features and prognosis. Herein, we present 3 cases of isocitrate dehydrogenase (IDH)-mutant astrocytoma with chromosome 19q13 deletion. In the first case, the primary tumor harbored an IDH1 mutation with chromosome 1p/19q partial deletions, which covered 19q13 and exhibited a durable initial response to radiotherapy and temozolomide (TMZ) treatment. However, the tumor lost the chromosome 1p/19q partial deletions at recurrence and became resistant to TMZ. Histologically, an oligodendroglioma-like feature was found in the primary tumor but not in the recurrent tumor. Capicua transcriptional repressor (CIC), located on 19q13, was less expressed in the primary tumor but was highly expressed in the recurrent tumor. Similar histological findings were observed in 2 other astrocytic tumors with IDH1 or IDH2 mutations. These tumors also had chromosome 19q13 deletion, including the CIC gene, weakly expressed CIC, and oligodendroglioma-like morphology. These tumors recurred at 6 and 32 months, respectively. These findings suggest that IDH-mutant astrocytoma with chromosome 19q13 partial deletion, including the CIC gene, may induce an oligodendroglioma-like phenotype, but the clinical prognosis may not be similar to that of genetically defined oligodendroglioma.

BRAF V600E mutation mediates FDG-methionine uptake mismatch in polymorphous low-grade neuroepithelial tumor of the young.

We present a case of a 14-year old boy with tumor-associated refractory epilepsy. Positron emission tomography imaging demonstrated a region with heterogeneous high 11C-methionine uptake and a region with homogenous low 18F-fluorodeoxyglucose uptake within the tumor. Histopathological and genomic analyses confirmed the tumor as BRAF V600E-mutated polymorphous low-grade neuroepithelial tumor of the young (PLNTY). Within the high-methionine-uptake region, we observed increased protein levels of L-type amino acid transporter 1 (LAT1), a major transporter of methionine; c-Myc; and constituents of the mitogen-activated protein kinase (MAPK) pathway. We also found that LAT1 expression was linked to the BRAF V600E mutation and subsequent activation of MAPK signaling and c-Myc. Pharmacological and genetic inhibition of the MAPK pathway suppressed c-Myc and LAT1 expression in BRAF V600E-mutated PLNTY and glioblastoma cells. The BRAF inhibitor dabrafenib moderately suppressed cell viability in PLNTY. Collectively, our results indicate that BRAF V600E mutation-activated MAPK signaling and downstream c-Myc induces specific metabolic alterations in PLNTY, and may represent an attractive target in the treatment of the disease.

A Hyperactive RelA/p65-Hexokinase 2 Signaling Axis Drives Primary Central Nervous System Lymphoma.

Primary central nervous system lymphoma (PCNSL) is an isolated type of lymphoma of the central nervous system and has a dismal prognosis despite intensive chemotherapy. Recent genomic analyses have identified highly recurrent mutations of MYD88 and CD79B in immunocompetent PCNSL, whereas LMP1 activation is commonly observed in Epstein-Barr virus (EBV)-positive PCNSL. However, a lack of clinically representative preclinical models has hampered our understanding of the pathogenic mechanisms by which genetic aberrations drive PCNSL disease phenotypes. Here, we establish a panel of 12 orthotopic, patient-derived xenograft (PDX) models from both immunocompetent and EBV-positive PCNSL and secondary CNSL biopsy specimens. PDXs faithfully retained their phenotypic, metabolic, and genetic features, with 100% concordance of MYD88 and CD79B mutations present in PCNSL in immunocompetent patients. These models revealed a convergent functional dependency upon a deregulated RelA/p65-hexokinase 2 signaling axis, codriven by either mutated MYD88/CD79B or LMP1 with Pin1 overactivation in immunocompetent PCNSL and EBV-positive PCNSL, respectively. Notably, distinct molecular alterations used by immunocompetent and EBV-positive PCNSL converged to deregulate RelA/p65 expression and to drive glycolysis, which is critical for intracerebral tumor progression and FDG-PET imaging characteristics. Genetic and pharmacologic inhibition of this key signaling axis potently suppressed PCNSL growth in vitro and in vivo. These patient-derived models offer a platform for predicting clinical chemotherapeutics efficacy and provide critical insights into PCNSL pathogenic mechanisms, accelerating therapeutic discovery for this aggressive disease. SIGNIFICANCE: A set of clinically relevant CNSL xenografts identifies a hyperactive RelA/p65-hexokinase 2 signaling axis as a driver of progression and potential therapeutic target for treatment and provides a foundational preclinical platform. GRAPHICAL ABSTRACT: http://cancerres.aacrjournals.org/content/canres/80/23/5330/F1.large.jpg.

PI3K/AKT/mTOR Pathway Alterations Promote Malignant Progression and Xenograft Formation in Oligodendroglial Tumors.

PURPOSE: Oligodendroglioma has a relatively favorable prognosis, however, often undergoes malignant progression. We hypothesized that preclinical models of oligodendroglioma could facilitate identification of therapeutic targets in progressive oligodendroglioma. We established multiple oligodendroglioma xenografts to determine if the PI3K/AKT/mTOR signaling pathway drives tumor progression. EXPERIMENTAL DESIGN: Two anatomically distinct tumor samples from a patient who developed progressive anaplastic oligodendroglioma (AOD) were collected for orthotopic transplantation in mice. We additionally implanted 13 tumors to investigate the relationship between PI3K/AKT/mTOR pathway alterations and oligodendroglioma xenograft formation. Pharmacologic vulnerabilities were tested in newly developed AOD models in vitro and in vivo. RESULTS: A specimen from the tumor site that subsequently manifested rapid clinical progression contained a PIK3CA mutation E542K, and yielded propagating xenografts that retained the OD/AOD-defining genomic alterations (IDH1 R132H and 1p/19q codeletion) and PIK3CA E542K, and displayed characteristic sensitivity to alkylating chemotherapeutic agents. In contrast, a xenograft did not engraft from the region that was clinically stable and had wild-type PIK3CA. In our panel of OD/AOD xenografts, the presence of activating mutations in the PI3K/AKT/mTOR pathway was consistently associated with xenograft establishment (6/6, 100%). OD/AOD that failed to generate xenografts did not have activating PI3K/AKT/mTOR alterations (0/9, P < 0.0001). Importantly, mutant PIK3CA oligodendroglioma xenografts were vulnerable to PI3K/AKT/mTOR pathway inhibitors in vitro and in vivo-evidence that mutant PIK3CA is a tumorigenic driver in oligodendroglioma. CONCLUSIONS: Activation of the PI3K/AKT/mTOR pathway is an oncogenic driver and is associated with xenograft formation in oligodendrogliomas. These findings have implications for therapeutic targeting of PI3K/AKT/mTOR pathway activation in progressive oligodendrogliomas.

Long-range GABAergic projection neurons in the cat neocortex.

Neocortical gamma-aminobutyric acid (GABA)ergic neurons have been previously described as largely involved in local intracortical circuitry. However, our recent findings in the murine model described select neocortical GABAergic neurons that project to both neighboring and more distant neocortical regions. Here, we investigated whether such GABAergic projection neurons are also found in the cat neocortex. Wheat germ agglutinin-conjugated horseradish peroxidase (WGA-HRP) was injected into the visual, auditory, or somatosensory cortex, in order to label efferent cortical neurons retrogradely and to label axons and terminals orthogradely. Staining for nicotinamide adenine dinucleotide phosphate diaphorase (NADPH-d), an enzyme involved in nitric oxide synthesis, was employed, and co-localization with WGA-HRP was determined by means of both polarizing and brightfield microscopy. We concluded that neurons double-labeled with WGA-HRP and NADPH-d in a distant region from the WGA-HRP-injection site are GABAergic neurons with long-range projection axons. All double-labeled neurons were found in cortical layers VIa and VIb and in the white matter. Neurons with intense NADPH-d reactivity (type I) were determined to be neuronal nitric oxide synthase (nNOS) positive in all cases. However, weakly NADPH-d-reactive neurons (type II) lacked nNOS immunoreactivity. Moreover, nNOS often co-localized with GABA, neuropeptide-Y, and somatostatin in the cat neocortex. In summary, the GABAergic neurons described here projected in a manner similar to that previously described for neocortical principal neurons, although some unique GABAergic long-range projections were also demonstrated.

Connexin expression in mouse lung tumor.

Gap junction intercellular communication (GJIC) is considered to play roles in regulation of homeostasis, development and differentiation of many tissues. In the present study, using reverse transcription-polymerase chain reaction (RT-PCR) and in situ RT-PCR, we examined expression of Connexins (Cx26, 32, 37, 40, 43 and 45) in the normal lung and lung tumors of mice to determine whether their expressions change during lung tumorigenesis. Cx26, 32 and 40 were expressed similarly in the normal lung tissue and tumors with smaller size (0.5-1.5mm) though expression of Cx32 and 40 decreased in tumors with larger size (>2.5mm). Cx26 was undetectable in larger size tumors. Cx37 and 45 were expressed in both normal lung and larger size tumors but no expression was seen in smaller size tumors. Cx43 was similarly detectable in normal lung, smaller size tumor and larger size tumor, but western blotting showed that Cx43 was phosphorylated during lung tumorigenesis. Thus, it is likely that alteration of expression of these Cx may be involved in expression of the neoplastic phenotype.

Small cell lung cancer, an epithelial to mesenchymal transition (EMT)-like cancer: significance of inactive Notch signaling and expression of achaete-scute complex homologue 1.

Small cell lung cancer (SCLC) is one of the most malignant neoplasms in common human cancers. The tumor is composed of small immature-looking cells with a round or fusiform shape, which possesses weak adhesion features among them, suggesting that SCLC shows the morphological characteristics of epithelial to mesenchymal transition (EMT). SCLC is characterized by high metastatic and recurrent rates, sensitivity to the initial chemotherapy, and easy acquirement of chemoresistance afterwards. These characters may be related to the EMT phenotype of SCLC. Notch signaling is an important signaling pathway, and could have roles in regulating neuroendocrine differentiation, proliferation, cell adhesion, EMT, and chemoresistance. Notch1 is usually absent in SCLC in vivo, but could appear after chemotherapy. Notch1 can enhance cell adhesion by induction of E-cadherin in SCLC, which indicates mesenchymal to epithelial transition. On the other hand, achaete-scute complex homologue 1 (ASCL1), negatively regulated by Notch signaling, is a lineage-specific gene of SCLC, and functions to promote neuroendocrine differentiation as well as EMT. ASCL1-transfected adenocarcinoma cell lines induced neuroendocrine phenotypes and lost epithelial cell features. SCLC is characterized by neuroendocrine differentiation and EMT-like features, which could be produced by inactive Notch signaling and ASCL1 expression. In addition, chemical and radiation treatments can activate Notch signaling, which suppress neuroendocrine differentiation and induces chemoradioresistance, accompanied by secession from EMT. Thus, the status of Notch signaling and ASCL1 expression may determine the cell behaviors of SCLC partly through modifying EMT phenotypes.

Encouraging option of multi-staged gross total resection for a C11orf-RelA fusion-positive supratentorial anaplastic ependymoma.

Ependymomas are primary neuroepithelial malignancies that mainly occur during childhood, and arise from ependymal cells along the ventricular systems of the CNS. Recently, it was elucidated that two-thirds of supratentorial (ST) ependymomas harbor oncogenic fusions of RELA, whose protein product is the principal effector of canonical NF-κB signaling. RELA fusion proteins activate signaling for tumor proliferation and malignant progression, resulting in poorer prognoses in these patients compared to those in patients with other ST ependymomas. In this study, we encountered a case of C11orf-RelA fusion-positive ST anaplastic ependymoma that was diagnosed in first tumor resection surgery of multi-staged gross total resection with molecular evidence. In ependymomas, regardless of tumor location or pathological grade, subtotal resection is associated with higher rates of mortality compared with GTR. Molecular analysis based on the application of recent molecular knowledge for ST ependymomas performs a role in appropriate and individualized treatment strategies.

Effects of a nerve-muscle pedicle on the denervated rat thyroarytenoid muscle.

OBJECTIVES: To evaluate the effects of the nerve-muscle pedicle (NMP) method on the rat thyroarytenoid (TA) muscle after transection of the recurrent laryngeal nerve (RLN). STUDY DESIGN: Quantitative histologic assessment of the TA muscle after NMP implantation. METHODS: Thirty-six Wistar rats were divided into two groups: animals subjected to transection of the left RLN alone (DNV group) and animals subjected to transection of the left RLN followed by immediate transplantation of a NMP flap containing the sternohyoid (SH) muscle and ansa cervicalis nerve branch (NMP group). Animals were killed 2, 4, and 10 weeks after the treatments. The TA muscle stained with hematoxylin-eosin was evaluated quantitatively. The pre- and postsynaptic structures of the neuromuscular junction (NMJ) in the TA muscle were analyzed histochemically. The myosin heavy chain (MyHC) isoforms were evaluated using immunohistochemistry and reverse-transcriptase polymerase chain reaction (RT-PCR). RESULTS: In the NMP group, the TA muscle fiber recovered to almost normal at 10 weeks, and the ratio of the number of synaptophysin-positive nerve terminals to that of alpha-bungarotoxin-positive acetylcholine receptors recovered to 79.8 +/- 11.8% (P < .05, compared with the control). Immunohistochemistry and the RT-PCR method after laser capture microdissection revealed the expression of MyHC isoforms type 2B and type 2A; the latter was detected in the SH muscle but not in the normal or denervated TA muscle. CONCLUSION: The NMP method was effective for recovering from the atrophic changes of the TA muscle after transection of the RLN. This was attributed to successful reinnervation by reconstruction of the NMJ, which might change MyHC isoform expression.

Mucinous cystadenoma of a horseshoe kidney: A case report and literature review.

A 45-year-old man complained of a palpable mass in his left abdomen. Computed tomography showed a horseshoe kidney with a Bosniak type II complicated cyst from a left segment. Three years after his initial examination, due to the growing cystic lesion and the compression imposed on the urinary collecting system and surrounding organs, we performed a left heminephrectomy. The diagnosis was mucinous cystadenoma of the kidney. No recurrence was observed 6 months after surgery. The histopathology was unique since the inner surface of the cyst was covered by a mucin-positive columnar epithelium connected to a urothelium, with continuous transition between the two. This suggests that the mucinous tumour may have originated from a sequestered segment of the renal pelvic epithelium in the renal parenchyma.

Long-term induction of beta-CGRP mRNA in rat lungs by allergic inflammation.

Calcitonin gene-related peptide (CGRP) is one of the major neuropeptides released from sensory nerve endings and neuroendocrine cells of the lung. Two CGRP isoforms, alpha-and beta-CGRP, have been identified in rats and humans, but no studies have attempted to reveal direct evidence of differences in action or location of these isoforms in allergic inflammation (AI). We investigated mRNA expressions of alpha-and beta-CGRP in lungs, nodose ganglia (NG), and dorsal root ganglia (DRG) of an animal model for AI of the airways, utilizing a model created by sensitizing Brown Norway (BN) rats with ovalbumin (OVA). By semiquantitative RT-PCR analysis, long-lasting enhanced expression of the beta-CGRP mRNA was shown in the lungs of the AI rats (14.5-fold enhancement at 6 hr, 8.1-fold at 24 hr, and 3.7-fold at 120 hr after OVA-challenge compared to the level in the lungs of phosphate-buffered saline (PBS)-challenged control rats). In contrast, the mRNA expression of the alpha-CGRP in AI lungs showed only a transient increase after OVA-challenge (2.7-fold at 6 hr) followed by a lower level of expression (0.5-fold at 48 hr and 0.6-fold at 120 hr). The mRNA expressions of both isoforms in NG, but not in DRG, were transiently up-regulated at 6 hr after antigen challenge. In situ RT-PCR in combination with immunohistochemical analysis revealed that beta-CGRP was expressed in neuroendocrine cells in clusters (termed neuroepithelial bodies [NEBs]) in AI lungs. These results indicate that the long-term induction of beta-CGRP in NEBs may play an important role in pulmonary AI such as bronchial asthma.

Mechanisms of neuroendocrine differentiation in pulmonary neuroendocrine cells and small cell carcinoma.

We review the significance of a network of proneural basic helix-loop-helix (bHLH) factors. Immunohistochemically, pulmonary neuroendocrine cells (PNECs) are positive for Mash1, one of the activator bHLHs, and non-PNECs such as Clara cells are positive for Hes1, one of the repressor bHLHs. Since mice deficient for the Mash1 gene do not possess PNEC and mice deficient for the Hes1 gene have many PNECs, it is suggested that a network of bHLHs work in cell fate determination of lung epithelium. Moreover, the Notch pathway could play a role in cell differentiation mechanisms in the lung because this signaling pathway has been reported to work in various tissues. PNECs have been reported to modulate various nonneoplastic human lung diseases. We demonstrate that PNECs in usual interstitial pneumonia and hASH1 (human homolog of Mash1) are upregulated in diseased lung tissues. Moreover, studies of small cell carcinoma and non- small cell carcinoma suggest that neuroendocrine differentiation could be regulated by hASH1. In non-small cell carcinoma, Hes1 and Notch signaling may have roles in maintaining cell differentiation. Thus, a network of bHLHs and Notch signaling are important in cell differentiation of normal and pathologic lung epithelial cells.