Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

Green fabrication of ultrafine N-MoxC/CoP hybrids for boosting electrocatalytic water reduction.

Developing non-noble-metal electrocatalysts for hydrogen evolution reactions with high activity and stability is the key issue in green hydrogen generation based on electrolytic water splitting. It has been recognized that the stacking of large CoP particles limits the intrinsic activity of as-synthesized CoP catalyst for hydrogen evolution reaction. In the present study, N-MoxC/CoP-0.5 with excellent electrocatalytic activity for hydrogen evolution reaction was prepared using N-MoxC as decoration. A reasonable overpotential of 106 mV (at 10 mA cm-2) and a Tafel slope of 59 mV dec-1in 1.0 M KOH solution was achieved with N-MoxC/CoP-0.5 electrocatalyst, which exhibits superior activity even after working for 37 h. Uniformly distributed ultrafine nanoclusters of the N-MoxC/CoP-0.5 hybrids could provide sufficient interfaces for enhanced charge transfer. The effective capacity of the hydrogen evolution reaction could be preserved in the complex, and the enlarged electrocatalytic surface area could be expected to offer more active sites for the reaction.

ITGA5 is an independent prognostic biomarker and potential therapeutic target for laryngeal squamous cell carcinoma.

BACKGROUND: Integrin α5 (ITGA5) was involved in a variety of cancers. However, the role of ITGA5 in laryngeal squamous cell carcinoma (LSCC) remains unknown. METHODS: The expression of ITGA5 and the corresponding clinicopathological parameters of LSCC patients the TCGA database. Five datasets (GSE51985, GSE59102, GSE84957, GSE27020, and GSE65858) were downloaded from the GEO database as validation sets. Kaplan-Meier plotter, Cox regression analysis, and nomogram were performed to determine the prognostic value of ITGA5 in LSCC. GO, KEGG, and GSEA were used to explore the underlying biological functions of ITGA5 in LSCC. The algorithms ESTIMATE and CIBERSORT were adopted to evaluate the association between ITGA5 and the infiltration of the immune cells. The algorithm pRRophetic was used to estimate the response to chemotherapeutic drugs. RESULTS: The expression of ITGA5 was higher in the LSCC samples and linked to poor overall survival and recurrence-free survival. Further, the Cox regression analysis confirmed that high expression of ITGA5 was an independent unfavorable prognostic factor. The predictive performance of nomogram based on the expression of ITGA5 was accurate and practical. The functional enrichment analysis confirmed that ITGA5 was related to the construction of the components and structures of the extracellular matrix. Finally, patients with high ITGA5 expression were more likely to benefit from docetaxel and gemcitabine. CONCLUSION: The expression of ITGA5 was elevated in the LSCC and was a predictor for prognosis and chemotherapeutic response in LSCC patients.

Arylsulfatase I is a prognostic biomarker for head and neck squamous cell carcinoma and Pan-cancer.

BACKGROUND: Sulfatase gene family members mediate various biological functions in tumor stroma and tumor cell environments. However, the expressions and prognostic value of Arylsulfatase I (ARSI), a sulfatase gene family member, in head and neck squamous cell carcinoma (HNSC) have not been fully established. METHODS: Arylsulfatase I expressions in pan-cancer were profiled using publicly available databases. Then, univariate Cox regression, Kaplan-Meier, and the Pearson's correlation analyses were performed to determine correlations between ARSI expressions and cancer prognosis, immune cell status, and drug sensitivity. Gene set variation analysis (GSVA) and gene set enrichment analysis (GSEA) were used to assess the potential mechanisms underlying ARSI functions in HNSC. RESULTS: Arylsulfatase I was highly expressed in 15 cancer types, with significant expressions in HNSC. Elevated ARSI levels were associated with worse prognostic outcomes in HNSC patients. In addition, GSVA and GSEA showed that ARSI was highly involved in tumor cell escape and inflammatory responses. Expressions of ARSI negatively correlated with tumor mutation burden or microsatellite instability and positively correlated with immune-related genes. Elevated ARSI expressions conferred poor tolerance to daporinad and sinularin, but increased cell sensitivity to dasatinib and XAV939. CONCLUSION: Arylsulfatase I is a promising prognostic and therapeutic target for HNSC.

Pyroptosis patterns and immune infiltrates characterization in head and neck squamous cell carcinoma.

BACKGROUND: Pyroptosis plays an essential role in tumor immune responses and inflammation related to chemotherapy. Herein, we studied the characteristic patterns of pyroptosis in head and neck squamous cell carcinoma (HNSCC) to determine their prognostic and therapeutic effects. METHODS: Consensus clustering analysis was performed to classify patients into pyroptosis or gene clusters. A novel pyroptosis score was constructed by principal component analysis. Kaplan-Meier survival curves were used to show the prognostic value. We also assessed the functional enrichment, tumor mutation burden, immune cell infiltration, and the sensitivity to chemotherapy and immunotherapy between high and low pyroptosis score group. RESULTS: Two distinct pyroptosis clusters were defined based on the mRNA expression profiles of PRGs, which were related to immune activation in HNSCC. Notably, a pyroptosis score was constructed according to different expression gene signatures, and then, each HNSCC patient was classified into a low or high pyroptosis score group. Patients with low pyroptosis scores had better immunotherapeutic responses and higher sensitivities to chemotherapeutic agents (paclitaxel, docetaxel, and gemcitabine). Kaplan-Meier survival curves showed that the pyroptosis patterns were independent prognostic indicators regardless of the level of tumor mutation burden. CONCLUSIONS: Pyroptosis plays an essential role in immune infiltration in HNSCC. Quantifying the pyroptosis score of individual patients might suggest prognostic, immunotherapeutic, and chemotherapeutic strategies for HNSCC.

Chronic virus infection enforces demethylation of the locus that encodes PD-1 in antigen-specific CD8(+) T cells.

Functionally exhausted T cells have high expression of the PD-1 inhibitory receptor, and therapies that block PD-1 signaling show promise for resolving chronic viral infections and cancer. By using human and murine systems of acute and chronic viral infections, we analyzed epigenetic regulation of PD-1 expression during CD8(+) T cell differentiation. During acute infection, naive to effector CD8(+) T cell differentiation was accompanied by a transient loss of DNA methylation of the Pdcd1 locus that was directly coupled to the duration and strength of T cell receptor signaling. Further differentiation into functional memory cells coincided with Pdcd1 remethylation, providing an adapted program for regulation of PD-1 expression. In contrast, the Pdcd1 regulatory region was completely demethylated in exhausted CD8(+) T cells and remained unmethylated even when virus titers decreased. This lack of DNA remethylation leaves the Pdcd1 locus poised for rapid expression, potentially providing a signal for premature termination of antiviral functions.

Two-dimensional finite-difference time-domain formulation for sound propagation in a temperature-dependent elastomer-fluid medium.

This study focuses on the two-dimensional (2-D) finite-difference time-domain (FDTD) formulations to investigate the acoustic wave propagation in elastomers contained in a fluid region under different thermal conditions. The developed FDTD formulation is based on a direct solution of the time-domain wave equation and the Havriliak-Negami (H-N) dynamic mechanical response of the elastomers. The H-N representation, including double fractional derivative operators, can be accurately transferred from the frequency-domain to the time-domain by using Riemann-Liouville theory and the Grunwald-Letnikov operator for fractional derivative approximations. Since the Williams-Landel-Ferry shift function is related to the relaxation time for different thermal conditions, the proposed scheme represents a simple and accurate prediction of acoustic wave propagation for varying thermal conditions. The pulse-wave propagation in a viscous fluid field is simulated by investigating the Navier-Stokes equations. The acoustic properties of different elastomers in a variety of temperatures are obtained by means of the proposed FDTD formulation and validated by a good agreement with the experimental data over a wide frequency range. Additionally, the 2-D examples relevant to wave propagation in different elastomers contained in a fluid field are implemented. The proposed FDTD formulation can be used to predict 2-D acoustic wave propagation in different thermal conditions accurately.

Characterizing Occupational Health Risks and Chemical Exposures Among Asian Nail Salon Workers on the East Coast of the United States.

The products used in nail care services contain toxic chemicals. This study aimed to characterize occupational health risk factors and chemical exposures among Asian nail salon workers on the East Coast of the U.S. for informing the development of more effective, culturally appropriate interventions. We conducted a community-based participatory research (CBPR) study to characterize occupational health risks. A face-to-face, self-reported survey was performed, and personal exposure to volatile organic compounds (VOCs) was evaluated. Three VOCs, acetone, methyl methacrylate (MMA), and toluene, were measured using 3M 3500 organic vapor monitors. We collected data on 112 workers with 100 personal chemical exposure measurements from 25 nail salons. Self-reported health problems that emerged or worsened after participants started working in the nail salon industry included headaches (8%); lightheadedness (9.8%); and irritation to the nose, eyes, throat, and skin (21.2%). Approximately 70% of participants reported that they had been pregnant, 11.7% of whom had at least one miscarriage. The mean concentrations of acetone, MMA, and toluene were 18.51 parts per million (ppm), 39.45 ppm, and 0.09 ppm, respectively. Mean concentrations of acetone and MMA measured from salons in New York City were significantly lower than those measured in Philadelphia and southern New Jersey. CBPR proved to be as an efficient approach for recruiting hard-to-reach Asian immigrant nail salon workers. Adverse health symptoms and problems associated with providing nail salon services were identified in these workers. Further studies are needed to better understand the long-term health effects of chronic chemical exposures in nail salon environments.

Design and experimental investigation of V-folded beams with acoustic black hole indentations.

This paper proposes a strategy to broaden complete bandgap attenuating flexural and longitudinal modes, and to shift them to lower frequencies by spatially folding designs. Numerical simulations show that the V-folded acoustic black hole beam exhibits an ultra-wide complete bandgap below 1 kHz due to longitudinal-flexural waveform transformation, and experimental results verify this finding. The proposed folded beams are easy-to-fabricate, of compact dimensions, and exhibit excellent wave attenuation functionality that makes them promising for low-frequency vibration reduction and wave attenuation applications.

Efficacy of a community-based participatory and multilevel intervention to enhance hepatitis B virus screening and vaccination in underserved Korean Americans.

BACKGROUND: The primary objective of the current study was to evaluate the efficacy of a community-based participatory intervention program in improving hepatitis B virus (HBV) screening and vaccination among Korean Americans who were not previously screened. METHODS: A cluster randomized trial involving 32 Korean church-based community organizations (1834 participants) was conducted. Sixteen churches were randomly assigned to an HBV screening and vaccination multicomponent intervention condition (972 participants) and 16 were assigned to a general cancer education control condition (862 participants). The main components of the intervention program included interactive group education; patient navigation; and the engagement of health care providers, church leadership, and church members in the medical field. The application of community-based participatory research principles was monitored and evaluated. HBV screening and vaccination rates (self-reported and medical record verification) were assessed at 6-month and 12-month follow-ups, respectively. RESULTS: The results of the current study demonstrated significant efficacy in the HBV screening rate (92.5% in the intervention group vs 5.5% in the control group), 3-series HBV vaccination completion rate (84% in the intervention group vs 17.6% in the control group), and overall screening and vaccination compliance rate (87% in the intervention group vs 3.8% in the control group). Participants in the intervention group were significantly more likely to receive HBV screening (92.5%) compared with those in the control group (5.5%). In multivariate mixed-effect logistic regression analysis, the odds ratio for an intervention effect on HBV screening was 512.3 after adjusting for cluster effect and other demographic variables. With regard to vaccination rates, of the 332 participants who were screened with no immunity in the intervention group, 308 (92.8%) received at least 1 HBV vaccination, 300 (90.4%) received at least 2 shots, and 279 participants (84%) received all 3 shots. CONCLUSIONS: A combination of community-based participatory research and a multilevel approach may produce the most optimal results and be essential in producing a considerable effect for enhancing HBV screening and vaccination, particularly for Korean American populations with limited language proficiency and insurance coverage. Cancer 2018;124:973-82. © 2017 American Cancer Society.

Mechanical and acoustic performance prediction model for elastomers in different environmental conditions.

This study focuses on the constitutive model, including temperature and pressure effects, to investigate the dynamic, mechanical, and acoustic properties of elastomers in the frequency domain under different underwater conditions. The developed constitutive relation is based on the Havriliak-Negami (H-N) model by implementing experimental Young's modulus data and using the Williams-Landel-Ferry (WLF) shift function for relaxation time calculation. The H-N model accurately captures the dynamic mechanical modulus for a wide range of frequencies for constant temperature and pressure based on measured dynamic mechanical thermal analysis data. Since the WLF shift function is related with the relaxation time for different temperatures and pressures, the proposed model represents a simple and accurate prediction of the dynamic modulus for varying external conditions. The relationship between Young's modulus and the acoustic properties of the rubber structure can be established by investigating the hydro-wave propagation process. The predictions from the proposed model are verified by comparing with mechanical and acoustic experimental data at different temperatures and pressures. Additionally, the parametric study is conducted to investigate the effect of H-N parameters on mechanical and acoustic properties of elastomer materials. The proposed model can be used to predict the mechanical and acoustic properties in different environmental conditions accurately.

Normal incidence sound transmission loss evaluation with a general upstream tube wave decomposition formula.

This study presents a method for measuring the normal incidence sound transmission loss of acoustical materials used in classical piping systems from upstream surface complex reflection coefficient measurements only. Based on the standard transfer function method, the wave field of the upstream tube is further decomposed, and the relationship between the complex reflection coefficient and the twice-transmitted wave is deduced. Similar to the so-called upstream surface impedance (USI) method, two microphone locations and air cavities with several depths are required. As a validation of the proposed method, both symmetrical and non-symmetrical materials are investigated. The influence of the air cavity on the experiment result is also discussed. A comparison of the results between the proposed method and existing methods reveals a perfect agreement with the verified USI method.

Complex Young's modulus measurement by incident wave extracting in a thin resonant bar.

This study presents a method for measuring the complex Young's modulus of viscoelastic materials by extracting the incident wave within a thin bar. A Butterworth impulse is generated by an electromagnetic shaker and is employed to excite a bar-like sample. The experimental results prove that the method proposed in this study can determine the Young's modulus at frequencies ranging from 200 to 6500 Hz under atmospheric pressure and room temperature. The Young's moduli of two types of rubber material determined by the experimental method agree well with those obtained using a standard dynamic mechanical thermal analyzer. This method expands the experimental frequency range of the wave-speed method, simplifies the processing of traditional experimental measurements, and represents a potential application for a method for directly determining mechanical parameters.

In vitro effects of tamoxifen on adipose-derived stem cells.

In breast reconstructive procedures, adipose-derived stem cells (ASCs) that are present in clinical fat grafting isolates are considered to play the main role in improving wound healing. In patients following chemotherapy for breast cancer, poor soft tissue wound healing is a major problem. However, it is unclear if tamoxifen (TAM) as the most widely used hormonal therapeutic agent for breast cancer treatment, affects the ASCs and ultimately wound healing. This study evaluated whether TAM exposure to in vitro human ASCs modulate cellular functions. Human ASCs were isolated and treated with TAM at various concentrations. The effects of TAM on cell cycle, cell viability and proliferation rates of ASCs were examined by growth curves, MTT assay and BrdU incorporation, respectively. Annexin V and JC-1 Mitochondrial Membrane Potential assays were used to analyze ASC apoptosis rates. ASCs were cultured in derivative-specific differentiation media with or without TAM (5 uM) for 3 weeks. Adipogenic and osteogenic differentiation levels were measured by quantitative RT-PCR and histological staining. TAM has cytotoxic effects on human ASCs through apoptosis and inhibition of proliferation in dose- and time-dependent manners. TAM treatment significantly down-regulates the capacity of ASCs for adipogenic and osteogenic differentiation (p<0.05 vs. control), and inhibit the ability of the ASCs to subsequently formed cords in Matrigel. This study is the first findings to our knowledge that demonstrated that TAM inhibited ASC proliferation and multi-lineage ASC differentiation rates. These results may provide insight into the role of TAM with associated poor soft tissue wound healing and decreased fat graft survival in cancer patients receiving TAM.

Upscaling Brønsted acid intercalation and exfoliation of graphite into graphene by polyoxometalate clusters for sodium-ion battery application.

Non-oxidative intercalation of graphite avoids damage to graphene lattices and is a suitable method to produce high-quality graphene. However, the yield of exfoliated graphene is low in this process due to the poor delamination efficiency of guest species. In this study, a Brønsted acid intercalation protocol is developed involving polyoxometalate (POM) clusters (H6P2W18O62) as guests and intercalation of graphite is realized at the sub-nanometer scale. Theoretical simulation based on DFT elucidates the stepwise intercalation mechanism of Brønsted acid molecules and clusters. Unlike common molecules/ionic guests, intercalation of POM clusters induces large expansion and extensive donor-acceptor interactions among graphite interlayers. This significantly weakens the van der Waals forces and promotes exfoliation efficiency of graphene layers. The exfoliated graphene possesses outstanding features of large lateral size, thin thickness, and high purity, and shows excellent performance as the anode for high power sodium-ion batteries. This work proffers a new pathway toward non-oxidative intercalation of graphite for large-scale production of graphene.

Metal-polyphenol networks-modified tantalum plate for craniomaxillofacial reconstruction.

Using three-dimensional (3D) printing technology to make the porous tantalum plate and modify its surface. The physicochemical properties, cytocompatibility, antioxidant capacity, and histocompatibility of the modified materials were evaluated to prepare for the repair of craniomaxillofacial bone defects. The porous tantalum plates were 3D printed by selective laser melting technology. Tantalum plates were surface modified with a metal polyphenol network. The surface-modified plates were analyzed for cytocompatibility using thiazolyl blue tetrazolium bromide and live/dead cell staining. The antioxidant capacity of the surface-modified plates was assessed by measuring the levels of intracellular reactive oxygen species, reduced glutathione, superoxide dismutase, and malondialdehyde. The histocompatibility of the plates was evaluated by animal experiments. The results obtained that the tantalum plates with uniform small pores exhibited a high mechanical strength. The surface-modified plates had much better hydrophilicity. In vitro cell experiments showed that the surface-modified plates had higher cytocompatibility and antioxidant capacity than blank tantalum plates. Through subcutaneous implantation in rabbits, the surface-modified plates demonstrated good histocompatibility. Hence, surface-modified tantalum plates had the potential to be used as an implant material for the treatment of craniomaxillofacial bone defects.

Identification of a disulfidptosis-related lncRNA signature for the prognostic and immune landscape prediction in head and neck squamous cell carcinoma.

PURPOSE: Disulfidptosis, a newly identified form of cell death, is triggered by disulfide stress. Herein, a unique signature was developed based on disulfidptosis-related lncRNAs (DRlncRNAs) for the prognostic and immune landscape prediction of head and neck squamous cell carcinoma (HNSCC). METHODS: Transcriptome, somatic mutation, and clinical data were acquired at The Cancer Genome Atlas database. Individuals were partitioned into training and test cohorts at a 1:1 ratio to facilitate the development of a DRlncRNA signature using the least absolute shrinkage and selection operation method. Based on the median risk score, all HNSCC individuals were stratified into the high-risk group (HRG) and low-risk group (LRG). Kaplan-Meier survival and time-dependent receiver operating characteristic (ROC) analyses were used to estimate the prognostic value, and a nomogram was generated for survival prediction. To provide a more comprehensive assessment, the tumor microenvironment, functional enrichment, immune cell infiltration, and immunotherapeutic sensitivity were explored between LRG and HRG. RESULTS: A DRlncRNA signature was established with 10 DRlncRNAs. The corresponding values of areas under the ROC curves for 1-, 3-, and 5-year overall survival were 0.710, 0.692, and 0.640. A more favorable prognosis was noted in the patients with lower risk, along with higher immune scores, increased immune-related functions, and immune cell infiltration, as well as improved response to the immunotherapeutic intervention in comparison with individuals at higher risk. CONCLUSION: These findings demonstrate that the developed DRlncRNA signature holds promise as a reliable prognostic marker and predictor of immunotherapy response in HNSCC patients.

Co-culture of rice and aquatic animals enhances soil organic carbon: A meta-analysis.

Co-culture of rice (Oryza sativa) and aquatic animals (CRAAs) is an efficient eco-agricultural model and has been widely implemented in many Asia countries. However, its impact on soil organic carbon (SOC) content has not been synthesized and the relative effects of different CRAAs practices on SOC have not been assessed. Our meta-analysis aims to synthesize the effect of diverse CRAAs regimes on SOC content based on results from 200 field experiments. Our results showed that overall, CRAAs significantly increased SOC content by 11.6 % (P < 0.05). The highest relative effect on SOC content was found under the rice and amphibian coculture (P < 0.05). Also, CRAAs increased SOC content more significantly in temperate regions (19.1 %) than in subtropical (9.7 %) and tropical (12.1 %) regions (P < 0.05). In addition, CRAAs were more effective in enhancing SOC content in paddy soils with high nitrogen content (total nitrogen [TN] >1.2 g·N kg-1 soil) or alkaline soils. Further, SOC increased more in the CRAAs with japonica than indica rice, increasing 17.8 % and 6.1 % as compared to their respective rice-monoculture controls. Random forest analysis revealed that animal type was the most important factor influencing SOC under CRAAs. Together, these results indicate that CRAAs can significantly enhance SOC, particularly in low-N, alkaline paddy soils. Our findings suggest that CRAAs with appropriate rice and animal varieties can provide unique opportunities for soil C sequestration, while enhancing farmers' profitability.

A dual-ring network design for the fast orbit feedback system of the storage ring.

Building reliable fast orbit feedback (FOFB) systems to offer high stability of the beam orbit becomes more challenging for the diffraction-limited storage ring due to the smaller beam size. The beam position measurement and control (BPMC) processor has been developed to streamline the FOFB system architecture by integrating BPM (Beam Position Monitor) electronics and an orbit feedback controller. This paper designs a hierarchical dual-ring network topology based on BPMC processors using parameters derived from the storage ring of the Hefei Advanced Light Facility. To reduce latency and prevent data transmission collisions, we propose a multi-forwarding communication scheme and a communication controller design in a field-programmable gate array. Experimental results verify that this topology operates reliably with the multi-forwarding scheme, providing an approximate communication latency as low as 17.336 µs to support the 30 kHz orbit feedback update rate.

High-Performance Bimetallic Electrocatalysts for Hydrogen Evolution Reaction Using N-Doped Graphene-Supported N-Co6Mo6C.

Hydrogen has garnered considerable attention as a promising energy source for addressing contemporary environmental degradation and energy scarcity challenges. Electrocatalytic water splitting for hydrogen production has emerged as an environmentally friendly and versatile method, offering high purity. However, the development of cost-effective electrocatalytic catalysts using abundant and inexpensive materials is crucial. In this study, we successfully synthesized nitrogen-doped Co6Mo6C supported on nitrogen-doped graphene (N-Co6Mo6C/NC). The catalyst exhibited high performance and durability in alkaline electrolytes (1.0 M KOH) for hydrogen evolution, showcasing an overpotential of 185 mV at a current density of 100 mA cm-2 and a Tafel slope of 80 mV dec-1. These findings present a novel avenue for the fabrication of efficient bimetallic carbide catalysts.