Safety of embryo cryopreservation: insights from mid-term placental transcriptional changes.

BACKGROUND: In recent years, with benefits from the continuous improvement of clinical technology and the advantage of fertility preservation, the application of embryo cryopreservation has been growing rapidly worldwide. However, amidst this growth, concerns about its safety persist. Numerous studies have highlighted the elevated risk of perinatal complications linked to frozen embryo transfer (FET), such as large for gestational age (LGA) and hypertensive disorders during pregnancy. Thus, it is imperative to explore the potential risk of embryo cryopreservation and its related mechanisms. METHODS: Given the strict ethical constraints on clinical samples, we employed mouse models in this study. Three experimental groups were established: the naturally conceived (NC) group, the fresh embryo transfer (Fresh-ET) group, and the FET group. Blastocyst formation rates and implantation rates were calculated post-embryo cryopreservation. The impact of FET on fetal growth was evaluated upon fetal and placental weight. Placental RNA-seq was conducted, encompassing comprehensive analyses of various comparisons (Fresh-ET vs. NC, FET vs. NC, and FET vs. Fresh-ET). RESULTS: Reduced rates of blastocyst formation and implantation were observed post-embryo cryopreservation. Fresh-ET resulted in a significant decrease in fetal weight compared to NC group, whereas FET reversed this decline. RNA-seq analysis indicated that the majority of the expression changes in FET were inherited from Fresh-ET, and alterations solely attributed to embryo cryopreservation were moderate. Unexpectedly, certain genes that showed alterations in Fresh-ET tended to be restored in FET. Further analysis suggested that this regression may underlie the improvement of fetal growth restriction in FET. The expression of imprinted genes was disrupted in both FET and Fresh-ET groups. CONCLUSION: Based on our experimental data on mouse models, the impact of embryo cryopreservation is less pronounced than other in vitro manipulations in Fresh-ET. However, the impairment of the embryonic developmental potential and the gene alterations in placenta still suggested it to be a risky operation.

Melatonin mitigates drought stress by increasing sucrose synthesis and suppressing abscisic acid biosynthesis in tomato seedlings.

The increasing prevalence of drought events poses a major challenge for upcoming crop production. Melatonin is a tiny indolic tonic substance with fascinating regulatory functions in plants. While plants can respond in several ways to alleviate drought stress, the processes underpinning stress sensing and signaling are poorly understood. Hereafter, the objectives of this investigation were to explore the putative functions of melatonin in the regulation of sugar metabolism and abscisic acid biosynthesis in drought-stressed tomato seedlings. Melatonin (100 µM) and/or water were foliar sprayed, followed by the plants being imposed to drought stress for 14 days. Drought stress significantly decreased biomass accumulation, inhibited photosynthetic activity, and stimulated senescence-associated gene 12 (SAG12) expression. Melatonin treatment effectively reversed drought-induced growth retardation as evidenced by increased leaf pigment and water balance and restricted abscisic acid (ABA) accumulation. Sugar accumulation, particularly sucrose content, was higher in drought-imposed seedlings, possibly owing to higher transcription levels of sucrose non-fermenting 1-related protein kinase 2 (SnKR2.2) and ABA-responsive element binding factors 2 (AREB2). Melatonin addition further uplifted the sucrose content, which coincided with increased activity of sucrose synthase (SS, 130%), sucrose phosphate synthase (SPS, 137%), starch degradation encoding enzyme ß-amylase (BAM, 40%) and α-amylase (AMY, 59%) activity and upregulated their encoding BAM1(10.3 folds) and AMY3 (8.1 folds) genes expression at day 14 relative to the control. Under water deficit conditions, melatonin supplementation decreased the ABA content (24%) and its biosynthesis gene expressions. Additionally, sugar transporter subfamily genes SUT1 and SUT4 expression were upregulated by the addition of melatonin. Collectively, our findings illustrate that melatonin enhances drought tolerance in tomato seedlings by stimulating sugar metabolism and negatively regulating ABA synthesis.

Characterization and Effect of a Nematophagous Fungus Talaromyces cystophila sp. nov. for the Biological Control of Corn Cyst Nematode.

The dynamic of plant-parasitic nematode populations in soil is closely related to soil microorganisms. Fungi from Heterodera zeae cysts were isolated to explore the phenomenon of decline in the H. zeae population in the soil. Phylogenetic study of partial ITS, BenA, CaM, and RPB2 gene sequences, in addition to morphological investigations, was utilized to identify a nematode-destroying fungus. The nematicidal activity of a novel strain GX1 against H. zeae was assessed in vitro and in the greenhouse. Our findings revealed that strain GX1 is a new species of Talaromyces, named Talaromyces cystophila. It has a strong parasitic and lethal effect on H. zeae cysts, with 91.11% parasitism on cysts at 3 days after treatment. The contents of second-stage juveniles (J2s) and eggs inside the cysts were degraded and formed dense vacuoles, and the damaged eggs could not hatch normally. The spore suspension exhibited high nematophagous activity against nematodes, and fermentation filtrate exhibited marked inhibition of egg hatching and nematicidal activities on J2s. The hatching inhibition rates of eggs exposed to 1 × 108 CFU/ml spore suspensions or 20% 1-week fermentation filtrate (1-WF) for 15 days were 98.56 and 100%, respectively. The mortality of J2s exposed to 1 × 108 CFU/ml spore suspension reached 100% at 24 h; exposure to 50% 2-WF was 98.65 and 100% at 24 and 48 h, respectively. Greenhouse experiments revealed that the spore suspension and fermentation broth considerably decreased H. zeae reproduction by 56.17 to 78.76%. T. cystophila is a potential biocontrol strain with nematophagous and nematicidal activity that deserves attention and application.

Clinical significance of R-wave amplitude in lead V1 and inferobasal myocardial infarction in patients with inferior wall myocardial infarction.

OBJECTIVE: To assess electrocardiogram (ECG) for risk stratification in inferior ST-elevation myocardial infarction (STEMI) patients within 24 h. METHODS: Three hundred thirty-four patients were divided into four ECG-based groups: Group A: R V1 <0.3 mV with ST-segment elevation (ST↑) V7-V9, Group B: R V1 <0.3 mV without ST↑ V7-V9, Group C: R V1 ≥0.3 mV with ST↑ V7-V9, and Group D: R V1 ≥0.3 mV without ST↑ V7-V9. RESULTS: Group A demonstrated the longest QRS duration, followed by Groups B, C, and D. ECG signs for right ventricle (RV) infarction were more common in Groups A and B (p < .01). ST elevation in V6, indicative of left ventricle (LV) lateral injury, was more higher in Group C than in Group A, while the ∑ST↑ V3R + V4R + V5R, representing RV infarction, showed the opposite trend (p < .05). The estimated LV infarct size from ECG was similar between Groups A and C, yet Group A had higher creatine kinase MB isoform (CK-MB; p < .05). Cardiac troponin I (cTNI) was higher in Groups A and C than in B and D (p < .05 and p = .16, respectively). NT-proBNP decreased across groups (p = .20), with the highest left ventricular ejection fraction (LVEF) observed in Group D (p < .05). Group A notably demonstrated more cardiac dysfunction within 4 h post-onset. CONCLUSIONS: For inferior STEMI patients, concurrent R V1 <0.3 mV with ST↑ V7-V9 suggests prolonged ventricular activation and notable myocardial damage. RV infarction's dominance over LV lateral injury might explain these observations.

The value of tissue quantitative diffusion analysis of ultrasound elastography in the diagnosis of early-stage chronic kidney disease.

PURPOSE: To explore the value of tissue quantitative diffusion analysis of ultrasound elastography in the diagnosis of early-stage chronic kidney disease (CKD). METHODS: The observation group comprised 54 patients with early-stage CKD treated at Fuzhou No 7 Hospital, and the control group consisted of 40 healthy individuals who underwent physical examinations at the same hospital. The renal parenchyma of the participants were examined using ultrasonography, color Doppler ultrasonography, and tissue quantitative diffusion analysis of ultrasound elastography. Renal dimensions (diameter, thickness, and renal parenchyma thickness), interlobar artery blood flow parameters, and 11 elastic characteristic values were analyzed and compared between the two groups. The area under the receiver-operating characteristic (ROC) curve, cut-off values, sensitivity, and specificity were calculated using the ROC curve analysis. RESULTS: There were no significant differences in the blood flow parameters of the interlobar artery and the dimensions of renal meridians between the two groups. In the observation group, the mean (MEAN) decreased, while the blue area ratio and skewness, increased, compared to the control group (p < 0.05). In addition, the ROC curve revealed that the blue area ratio, MEAN, and skewness had significant diagnostic value (the area under the curve > 0.7). Notably, the best cut-off value of the MEAN was found to be 106, indicating that a MEAN value less than 106 represented early-stage CKD. Also, this cutoff value had a sensitivity of 80% and a specificity of 81%. CONCLUSION: Tissue quantitative diffusion analysis of ultrasound elastography can quantitatively evaluate renal parenchymal damage in early-stage CKD using quantitative diffusion parameters, with the MEAN parameter, having a cutoff of 106, being particularly effective. This parameter and cutoff value offer a valuable tool for the early detection and diagnosis of CKD, potentially improving patient outcomes through earlier intervention. CLINICAL TRIAL NUMBER: Not applicable.

Ground-to-satellite quantum teleportation.

An arbitrary unknown quantum state cannot be measured precisely or replicated perfectly. However, quantum teleportation enables unknown quantum states to be transferred reliably from one object to another over long distances, without physical travelling of the object itself. Long-distance teleportation is a fundamental element of protocols such as large-scale quantum networks and distributed quantum computation. But the distances over which transmission was achieved in previous teleportation experiments, which used optical fibres and terrestrial free-space channels, were limited to about 100 kilometres, owing to the photon loss of these channels. To realize a global-scale 'quantum internet' the range of quantum teleportation needs to be greatly extended. A promising way of doing so involves using satellite platforms and space-based links, which can connect two remote points on Earth with greatly reduced channel loss because most of the propagation path of the photons is in empty space. Here we report quantum teleportation of independent single-photon qubits from a ground observatory to a low-Earth-orbit satellite, through an uplink channel, over distances of up to 1,400 kilometres. To optimize the efficiency of the link and to counter the atmospheric turbulence in the uplink, we use a compact ultra-bright source of entangled photons, a narrow beam divergence and high-bandwidth and high-accuracy acquiring, pointing and tracking. We demonstrate successful quantum teleportation of six input states in mutually unbiased bases with an average fidelity of 0.80 ± 0.01, well above the optimal state-estimation fidelity on a single copy of a qubit (the classical limit). Our demonstration of a ground-to-satellite uplink for reliable and ultra-long-distance quantum teleportation is an essential step towards a global-scale quantum internet.

First Report of the guava root-knot nematode (Meloidogyne enterolobii) on Selenicereus costaricensis in Guangxi, China.

Pitaya (Selenicereus costaricensis), a tropical and subtropical fruit of Cactaceae family, become very popular in the fruit consumer market in recent years. In June 2022, plant stunting, reduced yields and galled root symptoms were observed on S. costaricensis plants sampled from a commercial production base in Wuming County (23°10'36.67″ N; 108°40'43.24″ E), Guangxi autonomous region, China. The area of S. costaricensis field we investigated was about 19.9 ha. The incidence of root-knot nematode disease was almost 60%. Roots of twenty S. costaricensis plants were dug up, and many root knots and egg masses were observed. The roots with galls were collected, nematodes at different stages were collected and morphologically identified. Females were annulated, pearly white and globular to pear-shaped. The perineal pattern was oval shaped with the dorsal arch being moderately high to high. Average length of adult females (n = 20): body = 614.4 ± 57.3 µm, stylet lengths = 15.1 ± 0.9 µm, dorsal esophageal gland orifice (DGO) = 4.7 ± 0.6 µm. The tail of the second stage juvenile (J2) was very thin with a bluntly pointed tip. The hyaline tail terminus was clearly defined. Average length of J2 (n = 20): body = 469.5 ± 36.7 µm, stylet lengths = 14.7 ± 0.5 µm, DGO = 3.5 ± 0.4 µm, tail lengths averaged = 43.6 ± 9.7 µm. The males were vermiform, annulated, slightly tapering anteriorly, bluntly rounded posteriorly. Typical characteristics of Meloidogyne enterolobii observed were consistent with those previously described by Yang & Eisenback (1983) and Bulletin (2016). J2s hatched from an individual egg mass were collected for DNA extraction and used for molecular biological identification. The specific primers of M. enterolobii, Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), was used to validate the pathogen (Long et al. 2006). Approximately 236 bp of the target product was amplified, whereas no product was obtained from M. incognita. Further, the rDNA gene sequences (ITS; ITS1_5.8S_ITS2) and large subunit rDNA gene were amplified by the primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Subbotin et al. 2006). The target sequences of 765 bp (GenBank accession no. OQ512155) and 759 bp (OQ512743) were recorded in the NCBI with GeneBank. The sequences showed 100% identity with M. enterolobii in ITSs (KJ146863, JQ082448) and D2/D3 (MF467276, OL681885). To verify reproduction on S. costaricensis (Jindu 1), twelve ten-week-old seedlings (12 pots) cultured on a sterile substrate soil were inoculated with 5,000 J2s from the original population in a greenhouse at 26 ˚C. Noninoculated control were set up at the same time. After 8 weeks, the noninoculated plants (n = 12) did not present galls in the roots. All inoculated plants had galled roots and showed dwarf plant. The average reproductive factor obtained was 11.6 and the mean root gall rating of the samples was 5.3 (rating scale of 0 to 10), confirming the pathogenicity of M. enterolobii to S. costaricensis. The red dragon fruits (Hylocereus polyrhizus) in Hainan Island (China) were reported infected by M. enterolobii in previous report (Long et al. 2022). To our knowledge, this is the first report of M. enterolobii parasitizing S. costaricensis in Guangxi, China. This finding has important implications for the control of M. enterolobii at the place of discovery, which is the major fruit production area.

Gestational diabetes mellitus suppresses fetal testis development in mice†.

The prevalence of gestational diabetes mellitus (GDM) is increasing rapidly. In addition to the metabolic disease risks, GDM might increase the risks of cryptorchidism in children. However, its mechanism involved in abnormalities of the male reproductive system is still unclear. The purpose of this study was to study the effects of GDM on the development of mouse fetal Leydig cells (FLCs) and Sertoli cells (SCs). Pregnant mice were treated on gestational days 6.5 and 12.5 with streptozotocin (100 mg/kg) or vehicle (sodium citrate buffer). Leydig cell and SC development and functions were evaluated by investigating serum testosterone levels, cell number and distribution, genes, and protein expression. GDM decreased serum testosterone levels, the anogenital distance, and the level of desert hedgehog in SCs of testes of male offspring. FLC number was also decreased in testes of GDM offspring by delaying the commitment of stem Leydig cells into the Leydig cell lineage. RNA-seq showed that FOXL2, RSPO1/ß-catenin signaling was activated and Gsk3ß signaling was inhibited in GDM offspring testis. In conclusion, GDM disrupted reproductive tract and testis development in mouse male offspring via altering genes related to development.

Variations in the toxicity and condition index of five bivalve species throughout a red tide event caused by Alexandrium catenella: A field study.

Harmful red tides in China have caused paralytic shellfish toxins (PSTs) pollution and led to severe socioeconomic effects in shellfish aquaculture. Although shellfish can survive harmful algal blooms, the effects on their Condition Index (CI) have been underestimated. This study sought to evaluate the effects of the profiles and levels of paralytic shellfish toxins on variations in the CI in bivalves under natural blooming conditions. We observed clear soft tissue lesions to varying degrees except in Mytilus galloprovincialis after toxin exposure. Among the five species of shellfish exposed in situ, only M. galloprovincialis accumulated PSTs content above the maximum permitted level (800 µg STX di-HCl eq./kg). The highest toxin content in all sample tissues was observed in Patinopecten yessoensis. Significant interspecies differences in PSTs accumulation among the five bivalve species were observed in the hepatopancreas. A total of nine PSTs components and four new C-11 hydroxyl metabolites (so-called M-toxins) toxins were detected, and detoxification diversity was observed among bivalves. We observed a higher proportion of M-toxin in early stages, and the proportions changed only slightly over time in M. galloprovincialis and Magallana gigas, thus accounting for the significantly higher metabolism rate. Notably, the CI in M. gigas and Argopecten irradians was positively correlated with lowest toxin accumulation of PSTs content, but significantly inhibited. In conclusion, our results revealed a significant inhibitory effect on the CI in shellfish, in a species specific manner, with distinct levels of inhibition correlated with different toxin metabolites. Our study revealed the toxin content of different bivalves exposed to a natural red tide environment and the consequent effects on growth, thus building a foundation for research on the mechanisms underlying the effects of PSTs on growth. These data establish the ecological and economic significance of the effects of harmful algal blooms on bivalves.

Legionella septentrionalis sp. nov., isolated from aquatic environments in the northern PR China.

Four strains (km711T, km714, km542 and km524), representing a novel Legionella species, were isolated from aquatic environments in northern PR China. Cells were Gram-stain-negative, rod-shaped, microaerobic, motile and growth depended on l-cysteine. They grew at 25‒42 °C (optimum, 35‒37 °C) and could tolerate up to 1.5 % (w/v) NaCl (optimum, 0.5 %). The major fatty acids (>5 %) of the type strain km711T were C17 : 0 anteiso, C15 : 0 anteiso, iso-C16 : 0 and C16 : 1 ω7c and/or iso-C15 : 0 2OH. The pairwise comparison values were <96.1 % for 16S rRNA gene sequences, 23.3‒28.7 % interspecies variation for mip gene sequences, <93.6 % average nucleotide identity and <72.8 % average amino acid identity between these four strains and related type strains within the genus Legionella. The phylogenetic tree based on the four concatenated genes (16S rRNA, mip, rpoB and rnpB) and protein-concatamer tree based on concatenation of 21 protein markers both revealed that these four strains formed a separate phylogenetic branch cluster within the genus Legionella. The results of phenotypic and genotypic features suggest that these four strains represent a novel species of the genus Legionella, for which the name Legionella septentrionalis sp. nov. is proposed (type strain km711T=KCTC 15655T=NBRC 113219T).

Amelioration of AsV toxicity by concurrent application of ZnO-NPs and Se-NPs is associated with differential regulation of photosynthetic indexes, antioxidant pool and osmolytes content in soybean seedling.

Arsenic is a significant food safety and environmental concern due to its mutagenic and carcinogenic effect on living organism. Soybean (Glycine max [L.] Merrill) is a global staple crop grown intensively in arsenic-contaminated regions of the world (e.g., Southern Province of China). Therefore, the objective of this study was to investigate whether Se-NPs and/or ZnO-NPs could be used as an eco-friendly and efficient amendment to reduce arsenic uptake and toxicity in soybean. Ten-days-old seedling, grown in vermiculite, were transferred to hydroponic media and further grown till V2 growth stage appeared. AsV (25 µM Na2HAsO4) stressed plants were treated with ZnONP (25 µM ZnO) and SeNP (25 µM Se) separately and in combination, which were grown for another 10 d. The result demonstrated that arsenic-treated soybean plants displayed a reduction in photosynthetic efficiency, increased proline and glycine betaine accumulation in tissues, and altered antioxidant activity compared to an untreated control. The application of zinc oxide and selenium nanoparticles, both independently and in tandem, reduced arsenic stress in root and shoot tissues and rescued plant health. This was reflected through increased levels of reduced glutathione content, ascorbic acid, and various photosynthesis- and antioxidant-relevant enzymes. In addition, nanoparticle-treated soybean plants displayed higher expression of defense- and detoxification-related genes compared to controls. Cellular toxicants (i.e., oxidized glutathione, reactive oxygen species, and malondialdehyde) were reduced upon nanoparticle treatment. These data collectively suggest that selenium and zinc oxide nanoparticles may be a solution to ameliorate arsenic toxicity in agricultural soils and crop plants.

Putative environmental levels of levofloxacin facilitate the dissemination of antibiotic-resistant Escherichia coli via plasmid-mediated transformability.

Antibiotic residues in the environment pose a great risk to global public health. They increase antibiotic resistance by enhancing plasmid conjugation among bacteria or mutations within bacterial genomes. However, little is known about whether the putative environmental levels of antibiotics are sufficient to influence plasmid-mediated transformability. In this study, we explored the effect of eight kinds of representative antibiotics and several other compounds on the plasmid transformability of competent Escherichia coli. Only levofloxacin (LEV) at the putative environmental levels was found to facilitate the frequency of PBR322-or RP4-plasmid-mediated transformation by up to 5.3-fold. Additionally, PBR322 transformation frequency could be further enhanced by copper ion or ammonia nitrogen but inhibited by humic acid. However, when competent E. coli was exposed to the minimal inhibitory concentrations (MIC) of the antibiotics, an enhanced plasmid-assimilation ability was observed and plasmid transformation frequency was increased by up to 98.6-fold for all the tested antibiotics. Furthermore, E. coli exhibited a preference for the uptake of plasmids harbouring the resistance genes to the antibiotics it had been exposed to. Among these antibiotics, cephalexin, tetracycline, and kanamycin induced the highest uptake of RP4. The putative environmental levels of LEV enhanced plasmid transformability regardless of the presence of corresponding antibiotic resistance gene (ARG) on the genetic elements, suggesting environmental LEV residues may facilitate dissemination of antibiotic resistance by any plasmid-mediated transformability, thereby posing a great risk to health.

Structure Elucidation of Two New Norlignans from Anemone vitifolia and Their Anti-Inflammatory Activities.

Two new norlignans together with two known phenylpropanoids were isolated from the whole herb of Anemone vitifolia. All compounds were reported from this plant for the first time. The structures of these compounds were identified by comprehensive HR-ESI-MS, 1D and 2D NMR spectroscopic data analysis and comparison with literature data. Additionally, bioactivity study results showed that two new compounds have potential anti-inflammatory activity. The plausible biosynthetic pathway for these compounds were also speculated in this article.

CRISPR/Cas9-mediated efficient and precise targeted integration of donor DNA harboring double cleavage sites in Xenopus tropicalis.

The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system has emerged as a powerful tool for knock-in of DNA fragments via donor plasmid and homology-independent DNA repair mechanism; however, conventional integration includes unnecessary plasmid backbone and may result in the unfaithful expression of the modified endogenous genes. Here, we report an efficient and precise CRISPR/Cas9-mediated integration strategy using a donor plasmid that harbors 2 of the same cleavage sites that flank the cassette at both sides. After the delivery of donor plasmid, together with Cas9 mRNA and guide RNA, into cells or fertilized eggs, concurrent cleavages at both sides of the exogenous cassette and the desired chromosomal site result in precise targeted integration without plasmid backbone. We successfully used this approach to precisely integrate the EGFP reporter gene into the myh6 locus or the GAPDH locus in Xenopus tropicalis or human cells, respectively. Furthermore, we demonstrate that replacing conventional terminators with the endogenous 3UTR of target genes in the cassette greatly improves the expression of reporter gene after integration. Our efficient and precise method will be useful for a variety of targeted genome modifications, not only in X. tropicalis, but also in mammalian cells, and can be readily adapted to many other organisms.-Mao, C.-Z., Zheng, L., Zhou, Y.-M., Wu, H.-Y., Xia, J.-B., Liang, C.-Q., Guo, X.-F., Peng, W.-T., Zhao, H., Cai, W.-B., Kim, S.-K., Park, K.-S., Cai, D.-Q., Qi, X.-F. CRISPR/Cas9-mediated efficient and precise targeted integration of donor DNA harboring double cleavage sites in Xenopus tropicalis.

Legionella qingyii sp. nov., isolated from water samples in China.

Three Legionella-like strains, designed km488T, km489 and km521, were isolated from freshwater samples in China. Cells were Gram-stain-negative, rod-shaped and non-spore-forming. Growth was observed on BCYEα agar, but not on BCYEα agar without l-cysteine, chocolate agar with PolyViteX or Columbia blood agar. The major fatty acids (>5 %) of strains km488T, km489 and km521 were C16 : 0, anteiso-C15 : 0, iso-C16 : 0 and anteiso-C17 : 0. The mip gene sequences (574 nt) showed the isolates were almost identical with more than 99.7 % sequence similarities, and closely matched to L. gormanii ATCC 33297T with 95.4-95.6 % sequence similarities. Phylogenetic analyses based on concatenated gene (16S rRNA, mip, rpoB and rnpB) sequences indicated that the isolates formed a distinct cluster along with L. gormanii within the genus Legionella. Matrix-assisted laser desorption ionization time-of-flight analyses also demonstrated a clear separation between the isolates and other closely and distantly related Legionella species. DNA-DNA hybridization studies demonstrated that the isolates were closely related (92.0 -95.0 % DNA-DNA relatedness) but differentiated from their phylogenetic neighbours (<70 % DNA-DNA relatedness). The whole genome of km488T was sequenced, and showed a G+C content of 37.8 mol%. Based on the findings from this polyphasic taxonomic study, the isolates are considered to represent a single novel species, for which the name Legionella qingyii sp. nov. is proposed. The type strain is km488T (KCTC 15636T=CCTCC AB 2018025T=NRBC 113223T).

PALLD Regulates Phagocytosis by Enabling Timely Actin Polymerization and Depolymerization.

PALLD is an actin cross-linker supporting cellular mechanical tension. However, its involvement in the regulation of phagocytosis, a cellular activity essential for innate immunity and physiological tissue turnover, is unclear. We report that PALLD is highly induced along with all-trans-retinoic acid-induced maturation of myeloid leukemia cells, to promote Ig- or complement-opsonized phagocytosis. PALLD mechanistically facilitates phagocytic receptor clustering by regulating actin polymerization and c-Src dynamic activation during particle binding and early phagosome formation. PALLD is also required at the nascent phagosome to recruit phosphatase oculocerebrorenal syndrome of Lowe, which regulates phosphatidylinositol-4,5-bisphosphate hydrolysis and actin depolymerization to complete phagosome closure. Collectively, our results show a new function for PALLD as a crucial regulator of the early phase of phagocytosis by elaborating dynamic actin polymerization and depolymerization.

[Generality and specificity of cognitive control: research logics and debates].

As a high-level cognitive function of actively regulating human behaviors, cognitive control plays essential roles in conflict processing, working memory, decision making and so on. However, it is still under debate whether a universal cognitive control mechanism underlies the processing of various conflicts. Many existing theories tend to hold that cognitive control is domain-general; however, this view has been challenged by recent empirical studies. The logics of studying generality/specificity mainly include transferability, parallel comparison, correlation and resources competition, etc. Current empirical findings support that cognitive control is domain-general, domain-specific or both, respectively. To tackle this controversy, future studies about cognitive control can be performed from the perspectives of life-span development, the dynamic brain network, combination of multiple logics, causal relationship from brain injury, computational modeling, cognitive flexibility and functional connectivity.

Nematicidal Activity of Fosthiazate Against Soybean Cyst Nematode Heterodera glycines.

Nematicidal activity at different concentrations of fosthiazate against soybean cyst nematode (Heterodera glycines) was evaluated in this paper. The mortality rates of second-stage juvenile (J2) reached 13.43, 48.39, 66.82, 79.77, and 86.35% at 12 hr after exposure to 2.18, 3.44, 5.45, 8.61, and 13.62 mg/l of fosthiazate, respectively, whereas cumulative hatching rates totaled 58.24, 53.88, 42.54, 24.11, and 13.69% at 18 days after exposure to concentrations. J2s dead by exposure to fosthiazate exhibited shrunk and twisted body shape, whose length of nematode body, stylet, and esophageal glands to head were significantly shorter than that of the control (p < 0.05). A pot test was also performed to count the numbers of cysts on soybean roots, showing reduction of 43.64-97.94% due to application of fosthiazate at 5.45, 13.62, 34.04, and 85.10 mg/l concentrations. This study demonstrated that fosthiazate exhibits increasing of J2 mortality, and reducing egg hatching and reproduction rates, which providing evidence to support the use fosthiazate in further studies against H. glycines.Nematicidal activity at different concentrations of fosthiazate against soybean cyst nematode (Heterodera glycines) was evaluated in this paper. The mortality rates of second-stage juvenile (J2) reached 13.43, 48.39, 66.82, 79.77, and 86.35% at 12 hr after exposure to 2.18, 3.44, 5.45, 8.61, and 13.62 mg/l of fosthiazate, respectively, whereas cumulative hatching rates totaled 58.24, 53.88, 42.54, 24.11, and 13.69% at 18 days after exposure to concentrations. J2s dead by exposure to fosthiazate exhibited shrunk and twisted body shape, whose length of nematode body, stylet, and esophageal glands to head were significantly shorter than that of the control (p < 0.05). A pot test was also performed to count the numbers of cysts on soybean roots, showing reduction of 43.64­97.94% due to application of fosthiazate at 5.45, 13.62, 34.04, and 85.10 mg/l concentrations. This study demonstrated that fosthiazate exhibits increasing of J2 mortality, and reducing egg hatching and reproduction rates, which providing evidence to support the use fosthiazate in further studies against H. glycines.

CpG oligodeoxynucleotide preconditioning improves cardiac function after myocardial infarction via modulation of energy metabolism and angiogenesis.

Unmethylated CpG oligodeoxynucleotide (CpG-ODN), a Toll-like receptor 9 (TLR9) ligand, has been shown to protect against myocardial ischemia/reperfusion injury. However, the potential effects of CpG-ODN on myocardial infarction (MI) induced by persistent ischemia remains unclear. Here, we investigated whether and how CpG-ODN preconditioning protects against MI in mice. C57BL/6 mice were treated with CpG-ODN by i.p. injection 2 hr prior to MI induction, and cardiac function, and histology were analyzed 2 weeks after MI. Both 1826-CpG and KSK-CpG preconditioning significantly improved the left ventricular (LV) ejection fraction (LVEF) and LV fractional shortening (LVFS) when compared with non-CpG controls. Histological analysis further confirmed the cardioprotection of CpG-ODN preconditioning. In vitro studies further demonstrated that CpG-ODN preconditioning increases cardiomyocyte survival under hypoxic/ischemic conditions by enhancing stress tolerance through TLR9-mediated inhibition of the SERCA2/ATP and activation of AMPK pathways. Moreover, CpG-ODN preconditioning significantly increased angiogenesis in the infarcted myocardium compared with non-CpG. However, persistent TLR9 activation mediated by lentiviral infection failed to improve cardiac function after MI. Although CpG-ODN preconditioning increased angiogenesis in vitro, both the persistent stimulation of CpG-ODN and stable overexpression of TLR9 suppressed the tube formation of cardiac microvascular endothelial cells. CpG-ODN preconditioning significantly protects cardiac function against MI by suppressing the energy metabolism of cardiomyocytes and promoting angiogenesis. Our data also indicate that CpG-ODN preconditioning may be useful in MI therapy.

Three new xanthones from Swertia bimaculata and their anti-5α-reductase activity.

Three new xanthones (1-3), together with five known ones (4-8), were isolated from whole herb of Swertia bimaculata. Their structures were established on the basis of detailed spectroscopic analysis (1D- and 2D-NMR, HRESIMS, UV, and IR) and comparison with data reported in the literature. New isolates were evaluated for their anti-5α-reductase activity. The results revealed that all new compounds showed weak activity with reductase inhibitions of 40.5 ± 2.8, 38.6 ± 2.5, and 48.9 ± 3.0%, respectively.