Ustilaginoidea virens secretes a family of phosphatases that stabilize the negative immune regulator OsMPK6 and suppress plant immunity.

Rice false smut caused by Ustilaginoidea virens is emerging as a devastating disease of rice (Oryza sativa) worldwide; however, the molecular mechanisms underlying U. virens virulence and pathogenicity remain largely unknown. Here we demonstrate that the small cysteine-rich secreted protein SCRE6 in U. virens is translocated into host cells during infection as a virulence factor. Knockout of SCRE6 leads to attenuated U. virens virulence to rice. SCRE6 and its homologs in U. virens function as a novel family of mitogen-activated protein kinase phosphatases harboring no canonical phosphatase motif. SCRE6 interacts with and dephosphorylates the negative immune regulator OsMPK6 in rice, thus enhancing its stability and suppressing plant immunity. Ectopic expression of SCRE6 in transgenic rice promotes pathogen infection by suppressing the host immune responses. Our results reveal a previously unidentified fungal infection strategy in which the pathogen deploys a family of tyrosine phosphatases to stabilize a negative immune regulator in the host plant to facilitate its infection.

Phospho-code of a conserved transcriptional factor underpins fungal virulence.

BACKGROUND: Cell wall integrity (CWI) is crucial for fungal growth, pathogenesis, and adaptation to extracellular environments. Calcofluor white (CFW) is a cell wall perturbant that inhibits fungal growth, yet little is known about how phytopathogenic fungi respond to the CFW-induced stress. RESULTS: In this study, we unveiled a significant discovery that CFW triggered the translocation of the transcription factor CgCrzA from the cytoplasm to the nucleus in Colletotrichum gloeosporioides. This translocation was regulated by an interacting protein, CgMkk1, a mitogen-activated protein kinase involved in the CWI pathway. Further analysis revealed that CgMkk1 facilitated nuclear translocation by phosphorylating CgCrzA at the Ser280 residue. Using chromatin immunoprecipitation sequencing, we identified two downstream targets of CgCrzA, namely CgCHS5 and CgCHS6, which are critical for growth, cell wall integrity, and pathogenicity as chitin synthase genes. CONCLUSIONS: These findings provide a novel insight into the regulatory mechanism of CgMkk1-CgCrzA-CgChs5/6, which enables response of the cell wall inhibitor CFW and facilitates infectious growth for C. gloeosporioides.

Amelogenesis imperfecta in a Chinese family resulting from a FAM83H variation and the effect of FAM83H on the secretion of enamel matrix proteins.

OBJECTIVES: To investigate the variant of an amelogenesis imperfecta (AI) family and to explore the function of the FAM83H (family with sequence similarity 83 member H) in the enamel formation. MATERIALS AND METHODS: We investigated a five-generation Chinese family diagnosed with AI; clinical data was collected, whole-exome sequencing (WES) was conducted to explore the pathogenic gene and variants and Sanger sequencing was used to verify the variants. The three-dimensional protein structures of wild-type and mutant FAM83H were predicted using alpha fold 2. To study the possible regulatory function of Fam83h on amelogenesis, immunolocalization was performed to observe the expression of Fam83h protein in Sprague-Dawley rat postnatal incisors. The mRNA and protein level of amelogenin, enamelin, kallikrein-related peptidase-4 and ameloblastin were also detected after the Fam83h was knocked down by small interfering RNA (siRNA) in HAT-7 cells. RESULTS: A known nonsense variant (c.973 C > T) in exon 5 of FAM83H gene was found in this family, causing a truncated protein (p.R325X). Immunolocalization of Fam83h in Sprague-Dawley rat postnatal incisors showed that Fam83h protein expression was detected in presecretory and secretory stages. When Fam83h expression was reduced by siRNA, the expression of amelogenin, enamelin, kallikrein-related peptidase-4 decreased. However, the expression of ameloblastin increased. CONCLUSIONS: FAM83H gene variant (c.973 C > T) causes AI. FAM83H regulates the secretion of enamel matrix proteins and affects ameloblast differentiation. CLINICAL RELEVANCE: This study provided that FAM83H variants could influence enamel formation and provided new insights into the pathogenesis of AI.

Identification of DSPP novel variants and phenotype analysis in dentinogenesis dysplasia Shields type II patients.

OBJECTIVES: To investigate the genetic causes and teeth characteristics of dentin dysplasia Shields type II(DD-II) in three Chinese families. MATERIALS AND METHODS: Data from three Chinese families affected with DD-II were collected. Whole-exome sequencing (WES) and whole-genome sequencing (WGS) were conducted to screen for variations, and Sanger sequencing was used to verify mutation sites. The physical and chemical characteristics of the affected teeth including tooth structure, hardness, mineral content, and ultrastructure were investigated. RESULTS: A novel frameshift deletion mutation c.1871_1874del(p.Ser624fs) in DSPP was found in families A and B, while no pathogenic mutation was found in family C. The affected teeth's pulp cavities were obliterated, and the root canals were smaller than normal teeth and irregularly distributed comprising a network. The patients' teeth also had reduced dentin hardness and highly irregular dentinal tubules. The Mg content of the teeth was significantly lower than that of the controls, but the Na content was obviously higher than that of the controls. CONCLUSIONS: A novel frameshift deletion mutation, c.1871_1874del (p.Ser624fs), in the DPP region of the DSPP gene causes DD-II. The DD-II teeth demonstrated compromised mechanical properties and changed ultrastructure, suggesting an impaired function of DPP. Our findings expand the mutational spectrum of the DSPP gene and strengthen the understanding of clinical phenotypes related to the frameshift deletion in the DPP region of the DSPP gene. CLINICAL RELEVANCE: A DSPP mutation can alter the characteristics of the affected teeth, including tooth structure, hardness, mineral content, and ultrastructure.

SnRK1A-mediated phosphorylation of a cytosolic ATPase positively regulates rice innate immunity and is inhibited by Ustilaginoidea virens effector SCRE1.

Rice false smut caused by Ustilaginoidea virens is becoming one of the most recalcitrant rice diseases worldwide. However, the molecular mechanisms underlying rice immunity against U. virens remain unknown. Using genetic, biochemical and disease resistance assays, we demonstrated that the xb24 knockout lines generated in non-Xa21 rice background exhibit an enhanced susceptibility to the fungal pathogens U. virens and Magnaporthe oryzae. Consistently, flg22- and chitin-induced oxidative burst and expression of pathogenesis-related genes in the xb24 knockout lines were greatly attenuated. As a central mediator of energy signaling, SnRK1A interacts with and phosphorylates XB24 at Thr83 residue to promote ATPase activity. SnRK1A is activated by pathogen-associated molecular patterns and positively regulates plant immune responses and disease resistance. Furthermore, the virulence effector SCRE1 in U. virens targets host ATPase XB24. The interaction inhibits ATPase activity of XB24 by blocking ATP binding to XB24. Meanwhile, SCRE1 outcompetes SnRK1A for XB24 binding, and thereby suppresses SnRK1A-mediated phosphorylation and ATPase activity of XB24. Our results indicate that the conserved SnRK1A-XB24 module in multiple crop plants positively contributes to plant immunity and uncover an unidentified molecular strategy to promote infection in U. virens and a novel host target in fungal pathogenesis.

Characterization of pyruvate metabolism and citric acid cycle patterns predicts response to immunotherapeutic and ferroptosis in gastric cancer.

BACKGROUND: Gastric cancer is one of the most common malignancies of the digestive system with a high lethal rate. Studies have shown that inherited and acquired mutations in pyruvate metabolism and citric acid cycle (P-CA) enzymes are involved in tumorigenesis and tumor development. However, it is unclear how different P-CA patterns affect the tumor microenvironment (TME), which is critical for cancer progression. METHODS: This study mainly concentrated on investigating the role of the P-CA patterns in multicellular immune cell infiltration of GC TME. First, the expression levels of P-CA regulators were profiled in GC samples from The Cancer Genome Atlas and Gene Expression Omnibus cohorts to construct a consensus clustering analysis and identify three distinct P-CA clusters. GSVA was conducted to reveal the different biological processes in three P-CA clusters. Subsequently, 1127 cluster-related differentially expressed genes were identified, and prognostic-related genes were screened using univariate Cox regression analysis. A scoring system was then set up to quantify the P-CA gene signature and further evaluate the response of the patients to the immunotherapy. RESULTS: We found that GC patients in the high P-CA score group had a higher tumor mutational burden, higher microsatellite instability, and better prognosis. The opposite was observed in the low P-CA score group. Interestingly, we demonstrated P-CA gene cluster could predict the sensitivity to immunotherapy and ferroptosis-induced therapy. CONCLUSION: Collectively, the P-CA gene signature in this study exhibits potential roles in the tumor microenvironment and predicts the response to immunotherapeutic. The identification of these P-CA patterns may significantly accelerate the strategic development of immunotherapy for GC.

Ustilaginoidea virens Nuclear Effector SCRE4 Suppresses Rice Immunity via Inhibiting Expression of a Positive Immune Regulator OsARF17.

Rice false smut caused by the biotrophic fungal pathogen Ustilaginoidea virens has become one of the most important diseases in rice. The large effector repertory in U. virens plays a crucial role in virulence. However, current knowledge of molecular mechanisms how U. virens effectors target rice immune signaling to promote infection is very limited. In this study, we identified and characterized an essential virulence effector, SCRE4 (Secreted Cysteine-Rich Effector 4), in U. virens. SCRE4 was confirmed as a secreted nuclear effector through yeast secretion, translocation assays and protein subcellular localization, as well as up-regulation during infection. The SCRE4 gene deletion attenuated the virulence of U. virens to rice. Consistently, ectopic expression of SCRE4 in rice inhibited chitin-triggered immunity and enhanced susceptibility to false smut, substantiating that SCRE4 is an essential virulence factor. Furthermore, SCRE4 transcriptionally suppressed the expression of OsARF17, an auxin response factor in rice, which positively regulates rice immune responses and resistance against U. virens. Additionally, the immunosuppressive capacity of SCRE4 depended on its nuclear localization. Therefore, we uncovered a virulence strategy in U. virens that transcriptionally suppresses the expression of the immune positive modulator OsARF17 through nucleus-localized effector SCRE4 to facilitate infection.

The Fungal Endophyte Epicoccum dendrobii as a Potential Biocontrol Agent Against Colletotrichum gloeosporioides.

Anthracnose caused by Colletotrichum gloeosporioides is one of most serious fungal diseases on Chinese fir (Cunninghamia lanceolata). Eight fungal endophytes were isolated from a young heathy branch of Chinese fir and screened against the pathogen in vitro. One isolate, designated as SMEL1 and subsequently identified as Epicoccum dendrobii based on morphological and phylogenetic analyses, suppressed mycelial growth of Colletotrichum gloeosporioides on dual-culture plates. Additionally, E. dendrobii metabolites significantly decreased the biomass of Colletotrichum gloeosporioides. E. dendrobii was able to enter the internal tissues of the host plant via stomatal cells. Metabolites of E. dendrobii significantly inhibited conidial germination and appressorium formation, which at least partly explained why the endophyte significantly inhibited lesion development caused by Colletotrichum gloeosporioides on various host plants. We further confirmed that some components with antifungal activity could be extracted from E. dendrobii using ethyl acetate as an organic solvent. To our knowledge, this is the first report of E. dendrobii as a potential biocontrol agent against a fungal phytopathogen.

[Analysis of clinical phenotype and genetic variants in a Chinese pedigree affected with Angelman syndrome].

OBJECTIVE: To explore the genetic etiology for a Chinese pedigree affected with Angelman syndrome (AS). METHODS: The proband with phenotypes suggestive of AS was subjected to copy number variation sequencing (CNV-seq), methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) and high-throughput next generation sequencing (NGS). Variant of the UBE3A gene was verified among family members by Sanger sequencing and bioinformatic analysis. RESULTS: NGS revealed that the proband has carried a heterozygous variant of the UBE3A gene, namely c.1517G>A (p.R506H). The variant has co-segregated with the disease in the pedigree. Multiple amino acid sequence alignment showed that the site of mutant residue is conserved among nine homologous species. The variant was predicted to be deleterious by bioinformatic analysis. CONCLUSION: A novel variant of the UBE3A gene has been identified in a Chinese pedigree affected with AS. Above finding has further expanded the spectrum of UBE3A gene variants and phenotypes of AS, which also facilitated molecular diagnosis and genetic counseling for the family.

Alterations of functional connectivity density in a Chinese family with a mild phenotype associated with a novel inherited variant of SCN8A.

OBJECTIVE: Only a few heritable SCN8A variants have been described in patients with a mild phenotype of epilepsy. Here, we describe a Chinese family with a novel inherited SCN8A variant and investigate changes in spontaneous cerebral activity during the resting-state in magnetic resonance imaging (MRI)-negative patients with epilepsy and their unaffected siblings. METHODS: A gene panel targeting 535 epilepsy genes was performed on the proband and his parents. The identified variant was confirmed in other affected members by Sanger sequencing. Resting-state functional MRI (fMRI) data were gathered from the family (4 affected individuals and 3 unaffected siblings) and 72 healthy controls (HCs). Functional connectivity density (FCD) was used to assess whether distant or local functional network changes occurred in patients with epilepsy. RESULTS: A heterozygous missense variant (c.4568C>A; p.A1523D) in SCN8A was identified in the Chinese family, with a total of 7 members who presented with a mild phenotype (childhood seizures and normal cognition). All patients remained seizure-free, and one patient remained seizure-free without medication. Increased FCD values in the thalamocortical network and basal ganglia network were observed in both patients with epilepsy and their unaffected siblings compared with the HCs. Direct comparison between SCN8A variant patients and unaffected siblings showed that more serious and distributed abnormal changes occurred in the mesial frontal regions of patients with epilepsy. CONCLUSIONS: We identified a novel SCN8A variant with a mild familial epilepsy phenotype. A similar pattern of FCD alterations in patients and their unaffected siblings might represent an endophenotype of benign epilepsy associated with the SCN8A inherited variant, and more extensive alterations in mesial frontal regions may help us to further understand the pathogenesis of SCN8A-related mild epilepsy.

Two novel likely pathogenic variants of HARS2 identified in a Chinese family with sensorineural hearing loss.

Mutations in HARS2 are one of the genetic causes of Perrault syndrome, characterized by sensorineural hearing loss (SNHL) and ovarian dysfunction. Here, we identified two novel putative pathogenic variants of HARS2 in a Chinese family with sensorineural hearing loss including two affected male siblings, c.349G > A (p.Asp117Asn) and c.908 T > C (p.Leu303Pro), through targeted next-generation sequencing methods. The two affected siblings (13 and 11 years old) presented with early-onset, rapidly progressive SNHL. The affected siblings did not have any inner ear malformations or delays in gross motor development. Combined with preexisting clinical reports, Perrault syndrome may be latent in some families with non-syndromic deafness associated with HARS2 mutations. The definitive diagnosis of Perrault syndrome based on clinical features alone is a challenge in sporadic males, and preadolescent females with no signs of POI. Our findings further expanded the existing spectrum of HARS2 variants and Perrault syndrome phenotypes, which will assist in molecular diagnosis and genetic counselling of patients with HARS2 mutations.

[Clinical practice guidelines for retinitis pigmentosa].

Retinitis pigmentosa (RP) is a group of hereditary retinitis disorders which mainly affect the rod cells. In the early stage, the function of rod cells is affected. At the same time or later, the function of cone cells can also be affected. With the progress of the disease, the visual function is gradually damaged until the patient becomes completely blind. Many types of morphological changes suggestive of retinal degeneration may be noticed in the fundus, in particular pigment abnormality. RP features great genetic heterogeneity and phenotypic diversity. Over 90 pathogenic genes have so far been discovered. This guideline aims to standardize the clinical diagnosis and treatment of RP from the aspects of etiology, pathogenesis, genetic diagnosis and clinical consultation.

[Clinical practice guidelines for single gene glaucoma disorder].

Glaucoma is a group of progressive optic neuropathies featuring retinal ganglion cell and axonal degeneration, which typically manifest as sunken atrophy of optic papilla and characteristic visual field defect. Genetic factors play an important role in the pathogenesis of glaucoma. This guideline mainly focuses on single gene mutation-related glaucoma by summarizing the pathogenic genes, disease diagnosis and clinical consultation of primary congenital glaucoma (PCG) and primary open-angle glaucoma (POAG), with an aim to regulate their molecular diagnosis, genetic counseling and treatment.

A High-Quality Draft Genome Sequence of Colletotrichum gloeosporioides sensu stricto SMCG1#C, a Causal Agent of Anthracnose on Cunninghamia lanceolata in China.

Colletotrichum has a broad host range and causes major yield losses of crops. The fungus Colletotrichum gloeosporioides is associated with anthracnose on Chinese fir. In this study, we present a high-quality draft genome sequence of C. gloeosporioides sensu stricto SMCG1#C, providing a reference genomic data for further research on anthracnose of Chinese fir and other hosts.

Mutant RAMP2 causes primary open-angle glaucoma via the CRLR-cAMP axis.

PURPOSE: Primary open-angle glaucoma (POAG) is the leading cause of irreversible blindness worldwide and mutations in known genes can only explain 5-6% of POAG. This study was conducted to identify novel POAG-causing genes and explore the pathogenesis of this disease. METHODS: Exome sequencing was performed in a Han Chinese cohort comprising 398 sporadic cases with POAG and 2010 controls, followed by replication studies by Sanger sequencing. A heterozygous Ramp2 knockout mouse model was generated for in vivo functional study. RESULTS: Using exome sequencing analysis and replication studies, we identified pathogenic variants in receptor activity-modifying protein 2 (RAMP2) within three genetically diverse populations (Han Chinese, German, and Indian). Six heterozygous RAMP2 pathogenic variants (Glu39Asp, Glu54Lys, Phe103Ser, Asn113Lysfs*10, Glu143Lys, and Ser171Arg) were identified among 16 of 4763 POAG patients, whereas no variants were detected in any exon of RAMP2 in 10,953 control individuals. Mutant RAMP2s aggregated in transfected cells and resulted in damage to the AM-RAMP2/CRLR-cAMP signaling pathway. Ablation of one Ramp2 allele led to cAMP reduction and retinal ganglion cell death in mice. CONCLUSION: This study demonstrated that disruption of RAMP2/CRLR-cAMP axis could cause POAG and identified a potential therapeutic intervention for POAG.

[Genetic diagnosis and prenatal diagnosis of autosomal dominant polycystic kidney disease].

OBJECTIVE: To explore the genetic etiology for 17 pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD). METHODS: Peripheral blood samples were derived from the probands and their parents with informed consent. Following DNA extraction, targeted capture and next generation sequencing were carried out in search for potential disease-causing variants. Sanger sequencing was used to validate candidate pathogenic variants co-segregating with the disease in each pedigree. Prenatal diagnosis was provided for one family. RESULTS: Among the 17 probands, 14 PKD1 mutations and 3 PKD2 mutations were detected, which included 6 missense mutations, 4 nonsense mutations and 7 frameshift mutations. Of these, 8 have been associated with ADPKD previously and 9 were novel, which included c.7625G>T (p.Gly2542Val), c.3673C>T (p.Gln1225*), c.11048dupT (p.Thr3684Aspfs*38), c.9083_9084delAG (p.Glu3028Glyfs*40), c.10560delG (p.Pro3521Hisfs*6), c.7952_7974del TGTCCCTGAGGGTCCACACTGTG (p.Val2651Glyfs*2) of PKD1, and c.662T>G (p.Leu221*), c.1202_1203 insCT (p.Glu401Aspfs*2), and c.919 delA (p.Ser307Valfs*10) of PKD2. Prenatal testing showed that the fetus did not carry the same mutation as the proband. CONCLUSION: Identification of causative mutations in the 17 pedigrees affected with ADPKD has provided a basis for genetic counseling and reproductive guidance. The novel findings have enriched the mutational spectrum of the PKD1 and PKD2 genes.

Shoot Blight on Chinese Fir (Cunninghamia lanceolata) is Caused by Bipolaris oryzae.

Chinese fir (Cunninghamia lanceolata) is a significant timber species that has been broadly cultivated in southern China. A shoot blight disease on Chinese fir seedlings was discovered in Fujian, China and a fungus was then consistently associated with the symptoms. This fungus was determined to be causing this disease, among others by fulfilling Koch's postulates. Based on morphological characteristics and multilocus phylogenetic analyses with the sequences of the internal transcribed spacer, partial glyceraldehyde-3-phosphate dehydrogenase gene, partial translation elongation factor 1-α gene, and partial 28S large subunit ribosomal RNA gene, the fungus was identified as Bipolaris oryzae. These characteristics and phylogenetic analyses clearly support that this pathogen is different from B. sacchari, which was, until now, considered to be the causal agent of a similar blight on Chinese fir in Guangdong, China. The fungus was also shown to be strongly pathogenic to rice, one of the most susceptible hosts to B. oryzae. Crop rotation involving rice is often carried out with Chinese fir in southern China, a practice that most likely increases the risk of shoot blight on C. lanceolata. To our knowledge, shoot blight caused by B. oryzae is reported for the first time in a gymnosperm species.

[Analysis of NF1 gene mutations among eleven sporadic patients with neurofibromatosis type 1].

OBJECTIVE: To explore the genetic etiology for 11 sporadic patients with neurofibromatosis type 1. METHODS: Chip targeting capture and high-throughput sequencing were employed to detect potential mutations of NF1 and NF2 genes among the 11 patients. The data was filtered through multiple mutational databases and in-house whole exome sequence database. Sanger sequencing was used for analysis of family members of the patients. RESULTS: Eleven pathogenic variants were found among the 11 patients, which included two splicing mutations, one missense mutation, two nonsense mutations, and six frame-shifting mutations. None of the mutations was recorded by the public database or the in-house database generated from 1775 samples through whole exome sequencing. None of the unaffected parents carried the same mutation. Seven mutations were associated with neurofibromatosis type 1 previously, while the remaining four were discovered for the first time. Prenatal diagnosis of two high-risk pregnancies suggested that neither fetus has inherited the NF1 mutation from their affected parents. CONCLUSION: Identification of causative mutations in patients with sporadic-type neurofibromatosis type 1 has provided a basis for genetic counseling. The four novel mutations have enriched the spectrum of NF1 gene mutations.

A genome-wide meta-analysis identifies two novel loci associated with high myopia in the Han Chinese population.

High myopia, highly prevalent in the Chinese population, is a leading cause of visual impairment worldwide. Genetic factors play a critical role in the development of this visual disorder. Genome-wide association studies in recent years have revealed several chromosomal regions that contribute to its progression. To identify additional genetic variants for high myopia susceptibility, we used a genome-wide meta-analysis to examine the associations between the disease and 286 031 single-nucleotide polymorphisms (SNPs) in a combined cohort of 665 cases and 960 controls. The most significant SNPs (n = 61) were genotyped in a replication cohort (850 cases and 1197 controls), and 14 SNPs were further tested through genotyping in two additional validation cohorts (combined 1278 cases and 2486 controls). As a result of this analysis, four SNPs reached genome-wide significance (P < 2.0 × 10(-7)). The most significantly associated SNP, rs2730260 [overall P = 8.95 × 10(-14); odds ratio (95% CI) =1.33 (1.23-1.44)], is located in the VIPR2 gene, which is located in the MYP4 locus. The other three SNPs (rs7839488, rs4395927 and rs4455882) in the same linkage disequilibrium block are located in the SNTB1 gene, with -P values ranging from 1.13 × 10(-8) to 2.13 × 10(-11). The VIPR2 and SNTB1 genes are expressed in the retina and the retinal pigment epithelium and have been previously reported to have potential functions for the pathogenesis of myopia. Our results suggest that variants of the VIPR2 and SNTB1 genes increase susceptibility to high myopia in Han Chinese.

Physiological and morphological adaptations of herbaceous perennial legumes allow differential access to sources of varyingly soluble phosphate.

The aim of this study was to investigate the capacity of three perennial legume species to access sources of varyingly soluble phosphorus (P) and their associated morphological and physiological adaptations. Two Australian native legumes with pasture potential (Cullen australasicum and Kennedia prostrata) and Medicago sativa cv. SARDI 10 were grown in sand under two P levels (6 and 40 µg P g(-1) ) supplied as Ca(H2 PO4 )2 ·H2 O (Ca-P, highly soluble, used in many fertilizers) or as one of three sparingly soluble forms: Ca10 (OH)2 (PO4 )6 (apatite-P, found in relatively young soils; major constituent of rock phosphate), C6 H6 O24 P6 Na12 (inositol-P, the most common form of organic P in soil) and FePO4 (Fe-P, a poorly-available inorganic source of P). All species grew well with soluble P. When 6 µg P g(-1) was supplied as sparingly soluble P, plant dry weight (DW) and P uptake were very low for C. australasicum and M. sativa (0.1-0.4 g DW) with the exception of M. sativa supplied with apatite-P (1.5 g). In contrast, K. prostrata grew well with inositol-P (1.0 g) and Fe-P (0.7 g), and even better with apatite-P (1.7 g), similar to that with Ca-P (1.9 g). Phosphorus uptake at 6 µg P g(-1) was highly correlated with total root length, total rhizosphere carboxylate content and total rhizosphere acid phosphatase (EC 3.1.3.2) activity. These findings provide strong indications that there are opportunities to utilize local Australian legumes in low P pasture systems to access sparingly soluble soil P and increase perennial legume productivity, diversity and sustainability.