Long-term follow-up of Chinese patients with methylmalonic acidemia of the cblC and mut subtypes.

BACKGROUND: Methylmalonic acidemia (MMA) is the most common organic acidemia in China, with cblC (cblC-MMA) and mut (mut-MMA) being the predominant subtypes. The present study aimed to investigate the prognostic manifestations and their possible influence in patients with these two subtypes. METHODS: A national multicenter retrospective study of patients with cblC-MMA and mut-MMA between 2004 and 2022 was performed. We compared the clinical features between patients with two subtypes or diagnosed with or without newborn screening (NBS) and further explored the potentially influential factors on the prognosis. RESULTS: The 1617 enrolled MMA patients included 81.6% cblC-MMA patients and 18.4% mut-MMA patients, with an overall poor prognosis rate of 71.9%. These two subtypes of patients showed great differences in poor prognostic manifestations. The role of NBS in better outcomes was more pronounced in cblC-MMA patients. Predictors of outcomes are "pre-treatment onset", "NBS", variants of c.80A > G and c.482G > A and baseline levels of propionylcarnitine and homocysteine for cblC-MMA; "pre-treatment onset", "responsive to vitB12", variants of c.914T > C and baseline propionylcarnitine and propionylcarnitine/acetylcarnitine ratio for mut-MMA. Besides, prognostic biochemical indicators have diagnostic value for poor outcomes in mut-MMA. CONCLUSIONS: The study provided potential predictors of the long-term outcome of patients with cblC-MMA and mut-MMA. IMPACT: Predictors of outcomes are "pre-treatment onset", "NBS", MMACHC variants of c.80A > G and c.482G > A and baseline propionylcarnitine and homocysteine for cblC-MMA, "pre-treatment onset", "responsive to vitB12", MMUT variants of c.914T > C and baseline propionylcarnitine and propionylcarnitine/acetylcarnitine ratio for mut-MMA. This study with larger sample sizes effectively validated the prediction power and emphasized the importance of NBS in improving the outcomes of both MMA subtypes. The study enhances understanding of the phenotypic and prognostic variations of MMA disease and the predictors will help in the improvement of diagnosis and treatment strategies to achieve a better prognosis for MMA.

Genetic and phenotypic spectrum of non-21-hydroxylase-deficiency primary adrenal insufficiency in childhood: data from 111 Chinese patients.

BACKGROUND: Primary adrenal insufficiency (PAI) is a rare but life-threatening condition. Differential diagnosis of numerous causes of PAI requires a thorough understanding of the condition. METHODS: To describe the genetic composition and presentations of PAI. The following data were collected retrospectively from 111 patients with non-21OHD with defined genetic diagnoses: demographic information, onset age, clinical manifestations, laboratory findings and genetic results. Patients were divided into four groups based on the underlying pathogenesis: (1) impaired steroidogenesis, (2) adrenal hypoplasia, (3) resistance to adrenocorticotropic hormone (ACTH) and (4) adrenal destruction. The age of onset was compared within the groups. RESULTS: Mutations in the following genes were identified: NR0B1 (n=39), STAR (n=33), CYP11B1 (n=12), ABCD1 (n=8), CYP17A1 (n=5), HSD3B2 (n=4), POR (n=4), MRAP (n=2), MC2R (n=1), CYP11A1 (n=1), LIPA (n=1) and SAMD9 (n=1). Frequent clinical manifestations included hyperpigmentation (73.0%), dehydration (49.5%), vomiting (37.8%) and abnormal external genitalia (23.4%). Patients with adrenal hypoplasia typically presented manifestations earlier than those with adrenal destruction but later than those with impaired steroidogenesis (both p<0.01). The elevated ACTH (92.6%) and decreased cortisol (73.5%) were the most common laboratory findings. We generated a differential diagnosis flowchart for PAI using the following clinical features: 17-hydroxyprogesterone, very-long-chain fatty acid, external genitalia, hypertension and skeletal malformation. This flowchart identified 84.8% of patients with PAI before next-generation DNA sequencing. CONCLUSIONS: STAR and NR0B1 were the most frequently mutated genes in patients with non-21OHD PAI. Age of onset and clinical characteristics were dependent on aetiology. Combining clinical features and molecular tests facilitates accurate diagnosis.

Gut microbiota and metabolic changes in children with idiopathic short stature.

BACKGROUND: Idiopathic short stature (ISS) is characterized by short stature with unknown causes. Recent studies showed different gut microbiota flora and reduced fecal short-chain fatty acids in ISS children. However, the roles of the microbiome and metabolites in the pathogenesis of ISS remains largely unknown. METHODS: We recruited 51 Chinese subjects, comprising 26 ISS children and 25 normal-height control individuals. Untargeted metabolomics was performed to explore the fecal metabolic profiles between groups. A shotgun metagenomic sequencing approach was used to investigate the microbiome at the strains level. Mediation analyses were done to reveal correlations between the height standard deviation (SD) value, the gut microbiome and metabolites. RESULTS: We detected marked differences in the composition of fecal metabolites in the ISS group, particularly a significant increase in erucic acid and a decrease in spermidine, adenosine and L-5-Hydroxytryptophan, when compared to those of controls. We further identified specific groups of bacterial strains to be associated with the different metabolic profile. Through mediation analysis, 50 linkages were established. KEGG pathway analysis of microbiota and metabolites indicated nutritional disturbances. 13 selected features were able to accurately distinguish the ISS children from the controls (AUC = 0.933 [95%CI, 79.9-100%]) by receiver operating characteristic (ROC) analysis. CONCLUSION: Our study suggests that the microbiome and the microbial-derived metabolites play certain roles in children's growth. These findings provide a new research direction for better understanding the mechanism(s) underlying ISS.

[Analysis of disease spectrum for abnormal 3-hydroxyisovalerylcarnitine metabolism identified through newborn screening and clinical diagnosis].

OBJECTIVE: To explore the disease spectrum for abnormal 3-hydroxyisovalerylcarnitine (C5OH) metabolism identified through newborn screening and clinical diagnosis patients and the key points for differential diagnosis so as to raise the awareness of pediatricians for such diseases. METHODS: Clinical data of 85 neonates with abnormal C5OH metabolism identified from February 2004 to January 2022 at Xinhua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine were collected. Their clinical manifestations and results of tandem mass spectrometry (MS/MS), gas chromatography mass spectrometry (GC-MS) and genetic testing were retrospectively analyzed. RESULTS: Among the 85 cases, 46 (54.1%) were identified by neonate screening, whilst 39 (45.9%) were clinically diagnosed patients. Five diseases were diagnosed, including 28 cases with multiple carboxylase deficiency (MCD, 32.9%), 29 cases with 3-methylcrotonyl-coenzymeAcarboxylasedeficiency (MCCD, 34.1%), 4 cases with 3-methylglutaconic acid (3-MGA, 4.7%), 7 cases with 3-hydroxy-3-methylglutaric acid (3-HMG, 8.2%), and 17 cases with beta-ketothiolase deficiency (BKD, 20.0%). The disorders were characterized by sudden onset, anorexia, vomiting, diarrhea, abnormal breathing, consciousness disorder, spasm and developmental delay. CONCLUSION: Among newborns with abnormal C5OH metabolism, MCCD is the most common disorder, which was followed by BKD and MCD. For patients with abnormal C5OH metabolism, MCD is the most common, followed by BKD and 3-HMG. C5OH related diseases have great heterogeneity. Combination of blood acylcarnitine levels, urinary organic acid levels and genetic testing based on clinical characteristics can help to attain the diagnosis.

Preparation and characterization of small-diameter decellularized scaffolds for vascular tissue engineering in an animal model.

BACKGROUND: The development of a suitable extracellular matrix (ECM) scaffold is the first step in vascular tissue engineering (VTE). Synthetic vascular grafts are available as an alternative to autologous vessels in large-diameter arteries (>8 mm) and medium-diameter arteries (6-8 mm). In small-diameter vessels (<6 mm), synthetic vascular grafts are of limited use due to poor patency rates. Compared with a vascular prosthesis, natural tissue ECM has valuable advantages. Despite considerable progress in recent years, identifying an optimal protocol to create a scaffold for use in small-diameter (<6 mm) fully natural tissue-engineered vascular grafts (TEVG), remains elusive. Although reports on different decellularization techniques have been numerous, combination of and comparison between these methods are scarce; therefore, we have compared five different decellularization protocols for making small-diameter (<6 mm) ECM scaffolds and evaluated their characteristics relative to those of fresh vascular controls. RESULTS: The protocols differed in the choice of enzymatic digestion solvent, the use of non-ionic detergent, the durations of the individual steps, and UV crosslinking. Due to their small diameter and ready availability, rabbit arteria carotis were used as the source of the ECM scaffolds. The scaffolds were subcutaneously implanted in rats and the results were evaluated using various microscopy and immunostaining techniques. CONCLUSIONS: Our findings showed that a 2 h digestion time with 1× EDTA, replacing non-ionic detergent with double-distilled water for rinsing and the application of UV crosslinking gave rise to an ECM scaffold with the highest biocompatibility, lowest cytotoxicity and best mechanical properties for use in vivo or in situ pre-clinical research in VTE in comparison.

[Analysis of NF2 gene mutations in intraspinal Schwannomas].

OBJECTIVE: To explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene. METHODS: Samples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing. RESULTS: Four de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations. CONCLUSION: The occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.

Glass-Forming Ability, Mechanical Properties, and Energetic Characteristics of ZrCuNiAlNbHfY Bulk Metallic Glasses.

The effects of partially substituting Al for Cu in Zr59.62Cu18.4-xNi12Al6+xNb3Hf0.78Y0.2 (x = 0, 2, 4, 6, 8 at.%) bulk metallic glasses (BMGs) on their glass-forming ability (GFA), quasi-static and dynamic mechanical properties, and energy characteristics were investigated. The results showed that an appropriate substitution of Al for Cu can improve GFA and reach a critical casting size up to 10 mm. Additionally, with Al replacement of Cu, the change in the distribution and content of free volume inside the BMGs was the main reason for the quasi-static compression plasticity. In contrast, the BMGs exhibited no plasticity during dynamic compression and high-speed impact, owing to the short loading time and thermal softening effect. In terms of energy characteristics, all alloys have a high combustion enthalpy. And on the surface of the fragments collected from impact, the active elements Zr, Al, and Nb reacted because of the adiabatic temperature rise. Further, x = 4 at.% Zr-based BMG with its superior overall performance could penetrate a 6 mm Q235 plate at a speed of 1038 m/s, combining excellent mechanical properties and energy characteristics. This study contributes to the development of Zr-based BMGs as novel energetic structural materials.

KaryoXpert: An accurate chromosome segmentation and classification framework for karyotyping analysis without training with manually labeled metaphase-image mask annotations.

Automated karyotyping is of great importance for cytogenetic research, as it speeds up the process for cytogeneticists through incorporating AI-driven automated segmentation and classification techniques. Existing frameworks confront two primary issues: Firstly the necessity for instance-level data annotation with either detection bounding boxes or semantic masks for training, and secondly, its poor robustness particularly when confronted with domain shifts. In this work, we first propose an accurate segmentation framework, namely KaryoXpert. This framework leverages the strengths of both morphology algorithms and deep learning models, allowing for efficient training that breaks the limit for the acquirement of manually labeled ground-truth mask annotations. Additionally, we present an accurate classification model based on metric learning, designed to overcome the challenges posed by inter-class similarity and batch effects. Our framework exhibits state-of-the-art performance with exceptional robustness in both chromosome segmentation and classification. The proposed KaryoXpert framework showcases its capacity for instance-level chromosome segmentation even in the absence of annotated data, offering novel insights into the research for automated chromosome segmentation. The proposed method has been successfully deployed to support clinical karyotype diagnosis.

Long-read sequencing solves complex structure of CYP21A2 in a large 21-hydroxylase deficiency cohort.

CONTEXT: Genetic testing for 21-hydroxylase deficiency (21-OHD) is always challenging. Current approaches, short-read sequencing and multiplex ligation-dependent probe amplification (MLPA), are insufficient for the detection of chimeric genes or complicated variants from multiple copies. Recently developed long-read sequencing (LRS) can solve this problem. OBJECTIVE: To investigate the clinical utility of LRS in precision diagnosis of 21-hydroxylase deficiency. METHODS: In the cohort of 832 patients with 21-OHD, the current approaches provided the precise molecular diagnosis for 81.7% (680/832) of cases. LRS was performed to solve the remaining 144 cases with complex chimeric variants and eight cases with variants from multiple copies. Clinical manifestations in patients with continuous deletions of CYP21A2 extending to TNXB (namely CAH-X) were further evaluated. RESULTS: Using LRS in combination with previous genetic test results, a total of 16.9% (281/1664) CYP21A1P/CYP21A2 or TNXA/TNXB chimeric alleles were identified in 832 patients, with CYP21A1P/CYP21A2 accounting for 10.4% and TNXA/TNXB for 6.5%. The top three common chimeras were CYP21 CH-1, TNX CH-1 and TNX CH-2, accounting for 77.2% (217/281) of all chimeric alleles. The eight patients with variants on multiple copies of CYP21A2 were accurately identified with LRS. The prevalence of CAH-X in our cohort was 12.1%, and a high frequency of connective tissue-related symptoms was observed in CAH-X patients. CONCLUSION: LRS can detect all types of CYP21A2 variants, including complex chimeras and pathogenic variants on multiple copies in patients with 21-OHD, which could be utilized as a first-tier routine test for the precision diagnosis and categorization of congenital adrenal hyperplasia.

Clinical, genetic profile and therapy evaluation of 11 Chinese pediatric patients with Fanconi-Bickel syndrome.

BACKGROUND: Fanconi-Bickel syndrome (FBS) is a rare autosomal recessive disorder characterized by impaired glucose and galactose utilization as well as proximal renal tubular dysfunction. METHODS: Clinical, biochemical, genetic, treatment, and follow-up data for 11 pediatric patients with FBS were retrospectively analysed. RESULTS: Hepatomegaly (10/11), short stature (10/11) and hypophosphataemic rickets (7/11) were the most common initial symptoms. At diagnosis, all patients had decreased fasting blood glucose (FBG), plasma bicarbonate (HCO3-) and serum phosphorus, as well as elevated liver transaminases, alkaline phosphatase (AKP) and proximal renal tubular dysfunction. Two infant patients were misdiagnosed with transient neonatal diabetes mellitus. After therapy with uncooked cornstarch and conventional rickets treatment, remission of hepatomegaly was observed in all patients, with significant improvements in pre-prandial blood glucose, liver transaminases, triglyceride, plasma HCO3- and AKP (p < 0.05). At the last follow-up, 5/7 patients with elevated AKP had nephrocalcinosis. The mean height standard deviation score (Ht SDS) of eight patients with regular treatment increased from - 4.1 to -3.5 (p = 0.02). Recombinant human growth hormone (rhGH) was administered to 4/9 patients, but their Ht SDS did not improve significantly (p = 0.13). Fourteen variants of the SLC2A2 gene were identified, with six being novel, among which one was recurrent: c.1217T > G (p.L406R) (allele frequency: 4/22, 18%). Patients with biallelic missense variants showed milder metabolic acidosis than those with null variants. Two of five patients from nonconsanguineous families with rare homozygous variations showed 5.3 Mb and 36.6 Mb of homozygosity surrounding the variants, respectively; a region of homozygosity (ROH) involving the entire chromosome 3 covering the SLC2A2 gene, suggesting uniparental disomy 3, was detected in one patient. CONCLUSIONS: Early diagnosis of FBS is difficult due to the heterogeneity of initial symptoms. Although short stature is a major issue of treatment for FBS, rhGH is not recommended in FBS patients who have normal GH stimulation tests. Patients with biallelic null variants may require alkali supplementation since urine bicarbonate loss is genetically related. ROH is a mechanism for rare homozygous variants of FBS in nonconsanguineous families.

A Novel Mutation in Melanocortin Receptor 2 and a Reported Mutation in Melanocortin Receptor 2 Accessory Protein: Three Chinese Cases with Familial Glucocorticoid Deficiency.

Background: Familial glucocorticoid deficiency (FGD) is a rare autosomal recessive disease characterized by glucocorticoid deficiency without mineralocorticoid deficiency. We report 3 Chinese patients with MRAP or MC2R mutations. Case Reports: Patient 1 presented with hyperpigmentation. Endocrine investigations revealed low serum cortisol levels and elevated adrenocorticotropic hormone (ACTH) levels. Furthermore, low serum sodium was evident. She was diagnosed with FGD type 2 due to a homozygous mutation in MRAP (c.106+1delG), revealed through exome sequencing (ES). After 2-year treatment with hydrocortisone, skin hyperpigmentation was improved. Patient 2 initially presented with hyponatremia. Low cortisol levels and high levels of ACTH were subsequently detected; he was subjected to a hydrocortisone treatment during which he experienced repeated hypoglycemic attacks and pigmentation. ES revealed the same mutation as in patient 1 in MRAP (c.106+1delG), thus he was diagnosed with FGD type 2. After 6 years of age, his symptoms remarkably improved, and there was no episode of hypoglycemia. Patient 3 mainly presented with hyperpigmentation, hypoglycemic attack, and tall stature. Laboratory findings were normal except for low serum cortisol levels and high ACTH levels. She was diagnosed with FGD type 1 as ES revealed a novel homozygous mutation in MC2R (c.712C>A, p.His238Tyr). After nearly 2 years of hydrocortisone replacement therapy, the excessive growth was reduced to near normal, and the skin color returned to normal. Conclusions: Three patients were diagnosed with FGD (one with FGD type 1 and two with FGD type 2). They all presented with hyperpigmentation and hypoglycemia; however, compared with patient 1, the clinical manifestations of patient 2 were more complicated. Patient 3 had later onset and taller stature than patients 1 and 2. A novel mutation in patient 3 expands the mutation spectrum of MC2R.

Clinical profile, genetic spectrum and therapy evaluation of 19 Chinese pediatric patients with lipoprotein lipase deficiency.

BACKGROUND: Lipoprotein lipase (LPL) deficiency, the most common familial chylomicronemia syndrome (FCS), is a rare autosomal recessive disease characterized by chylomicronemia and severe hypertriglyceridemia (HTG), with limited clinical and genetic characterization. OBJECTIVE: To describe the manifestations and management of 19 pediatric patients with LPL-FCS. METHODS: LPL-FCS patients from 2014 to 2022 were divided into low-fat (LF), very-low-fat (VLF) and medium-chain-triglyceride (MCT) groups. Their clinical data were evaluated to investigate the effect of different diets. The genotype-phenotype relationship was assessed. Linear regression comparing long-chain triglyceride (LCT) intake and TG levels was analyzed. RESULTS: Nine novel LPL variants were identified in 19 LPL-FCS pediatric patients. At baseline, eruptive xanthomas occurred in 3/19 patients, acute pancreatitis in 2/19, splenomegaly in 6/19 and hepatomegaly in 3/19. The median triglyceride (TG) level (30.3 mmol/L) was markedly increased. The MCT group and VLF group with LCT intakes <20 en% (energy percentage) had considerably lower TG levels than the LF group (both p<0.05). The LF group presented with severe HTG and significantly decreased TG levels after restricting LCT intakes to <20 en% (p<0.05). Six infants decreased TG levels to <10 mmol/L by keeping LCT intake <10 en%. TG levels and LCT intake were positively correlated in both patients under 2 years (r=0.84) and those aged 2-9 years (r=0.89). No genotype-phenotype relationship was observed. CONCLUSIONS: This study broadens the clinical and genetic spectra of LPL-FCS. The primary therapy for LPL-FCS pediatric patients is restricting dietary LCTs to <10 en% or <20 en% depending on different ages. MCTs potentially provide extra energy.

Clinical and genetic characteristics of 42 Chinese paediatric patients with X-linked adrenal hypoplasia congenita.

BACKGROUND: X-linked adrenal hypoplasia congenita (AHC) is a rare disorder characterized by primary adrenal insufficiency (PAI) and hypogonadotropic hypogonadism (HH), with limited clinical and genetic characterization. METHODS: The clinical, biochemical, genetic, therapeutic, and follow-up data of 42 patients diagnosed with X-linked AHC were retrospectively analysed. RESULTS: Hyperpigmentation (38/42, 90%), vomiting/diarrhoea (20/42, 48%), failure to thrive (13/42, 31%), and convulsions (7/42, 17%) were the most common symptoms of X-linked AHC at onset. Increased adrenocorticotropic hormone (ACTH) (42/42, 100%) and decreased cortisol (37/42, 88%) were the most common laboratory findings, followed by hyponatremia (32/42, 76%) and hyperkalaemia (29/42, 69%). Thirty-one patients presented with PAI within the first year of life, and 11 presented after three years of age. Three of the thirteen patients over the age of 14 exhibited spontaneous pubertal development, and ten of them experienced delayed puberty due to HH. Six patients receiving human chorionic gonadotropin (hCG) therapy exhibited a slight increase in testicular size and had rising testosterone levels (both P < 0.05). The testicular volumes of the three patients with pulsatile gonadotropin-releasing hormone (GnRH) therapy were larger than those of the six patients undergoing hCG therapy (P < 0.05), and they also exhibited some growth in terms of luteinizing hormone (LH), follicle-stimulating hormone (FSH), and testosterone. Of the 42 patients, three had an Xp21 deletion, and 39 had an isolated DAX1 defect. Most patients (9/10) with entire DAX1 deletion accounting for 23.8% (10/42) of the total variants had early onset age of less than one year. CONCLUSIONS: This study details the clinical features and genetic spectra of X-linked AHC. Patients with X-linked AHC show a bimodal distribution of the age of onset, with approximately 70% presenting within the first year of life. Pulsatile GnRH may be recommended for HH when hCG therapy is not satisfactory, although it is difficult to achieve normal testicular volume. The combination of clinical features and molecular tests provides information for an accurate diagnosis.

Variable phenotypes and outcomes associated with the MMACHC c.482G > A mutation: follow-up in a large CblC disease cohort.

BACKGROUND: The aim of this study was to characterize the variable phenotypes and outcomes associated with the methylmalonic aciduria and homocystinuria type C protein gene (MMACHC) c.482G > A mutation in 195 Chinese cases with CblC disease. METHODS: We carried out a national, retrospective multicenter study of 195 Chinese patients with CblC disease attributable to the MMACHC c.482G > A variant either in a homozygous or compound heterozygous state. The control group consisted of 200 patients diagnosed with CblC disease who did not possess the c.482G > A mutation. Clinical features, including disease onset, symptoms, biochemical metabolites, gene mutation, and follow-up outcomes were reviewed and analyzed in detail. The median follow-up period spanned 3 years and 8 months, with a range of 1 year and 2 months to 12 years and 10 months. RESULTS: Among 195 patients carrying the c.482G > A variant, 125 (64.1%) cases were diagnosed by newborn screening (NBS), 60 (30.8%) cases were detected due to disease onset, and 10 (5.1%) cases were identified from sibling diagnoses. One hundred and seventeen (93.6%) individuals who were diagnosed by NBS, and nine patients who came from sibling diagnoses remained asymptomatic in this study. From 69 symptomatic patients of the c.482G > A group, more patients presented with later onset, and the top six common clinical symptoms at disease onset were developmental delay (59.4%), lower limb weakness and poor exercise tolerance (50.7%), cognitive decline (37.7%), gait instability and abnormal posture (36.2%), seizures (26.1%), and psychiatric and behavioral disturbances (24.6%). In the 159 symptomatic patients lacking c.482G > A variants, the most frequently observed clinical manifestations at disease onset included developmental delay (81.8%), lethargy and feeding difficulty (62.9%), lower limb weakness and poor exercise tolerance (54.7%), prolonged neonatal jaundice (51.6%), vomiting (47.2%), and seizures (32.7%). Before treatment, the levels of blood propionylcarnitine, propionylcarnitine/acetylcarnitine ratio, and homocysteine in the c.482G > A group were significantly lower (P < 0.05) than those in the non-c.482G > A group, while the concentration of urinary methylmalonic acid was slightly lower (P > 0.05). The degree of decline in the above metabolites after treatment in different groups significantly differed in both plasma total homocysteine values and urinary methylmalonic acid levels (P < 0.05). In patients carrying the c.482G > A variant compared with the non-c.428G > A group, there were markedly lower rates of mortality (0.5% vs. 2.0%) and developmental delay (20.5% vs. 65.5%). When compared with individuals diagnosed due to disease onset, those identified through NBS in either group exhibited a reduced proportion of disease onset (6.7% vs. 100% in the c.482G > A group, 54.4% vs. 100% in the non-c.482G > A group), lower mortality (0.0% vs. 1.7% in the c.482G > A group, 0.0% vs. 3.6% in the non-c.482G > A group), and had a higher percentage of patients exhibiting normal psychomotor and language development (99.3% vs. 33.3% in the c.482G > A group, 58.9% vs. 10.9% in the non-c.482G > A group). CONCLUSIONS: The c.482G > A variant in MMACHC is associated with late-onset and milder phenotypes of CblC disease. Patients with this mutation tend to have a relatively better response to hydroxocobalamin, better metabolic control, and more favorable neurological outcomes. NBS and other appropriate pre-symptomatic treatments seem to be helpful in early diagnosis, resulting in favorable clinical outcomes. Video Abstract (MP4 136794 kb).

Ignition and Combustion Characteristic of B·Mg Alloy Powders.

Boron and its alloys have been explored a lot and it is expected that they can replace pure aluminum powder in the energetic formulation of active materials. MgB2 compounds were prepared and characterized by a combination of mechanical alloying and heat treatment. The ignition and combustion of boron-magnesium alloys were studied with the ignition wire method and laser ignition infrared temperature measurement. The results show that MgB2 has good ignition characteristics with maximum ignition temperatures obtained by the two various methods of 1292 K and 1293 K, respectively. Compared with boron, the ignition temperature of MgB2 is greatly reduced after alloying. The ignition reaction of MgB2 mainly occurs on the surface and the ignition process has two stages. In the initial stage of ignition, the large flame morphology and combustion state are close to the combustion with gaseous Mg, whereas the subsequent combustion process is close to the combustion process of B. Compared with boron, the ignition temperature of MgB2 is greatly reduced which suggests that MgB2 may be used in gunpowder, propellant, explosives, and pyrotechnics due to its improved ignition performance.

Effects of Cerium Doping on the Mechanical Properties and Energy-Releasing Behavior of High-Entropy Alloys.

Energetic structural materials play an important role in improving the damage performance of future weapons. To improve the energy-releasing behavior, Al0.5NbZrTi1.5Ta0.8Cex high-entropy alloys were prepared by vacuum-arc melting. The results showed the presence of BCC and FCC phases in the alloy with dendritic-morphology-element segregation and there were significant dislocations in the alloys. The current study focused on the effects of cerium content on the dynamic compressive mechanical and energetic characteristics. Cerium doping enhanced the energy-releasing characteristics of high-entropy alloys. The severity of the reaction increased with the increase in the cerium content, while the dynamic compressive strength generally decreased with the increase in cerium content. The Al0.5NbZrTi1.5Ta0.8Ce0.25 showed excellent mechanical and energy-releasing characteristics. The ballistic experiments indicated that Al0.5NbZrTi1.5Ta0.8Ce0.25 can penetrate 6-millimeter A3 plates and ignite the cotton behind the target at a velocity of 729 m/s, making it an ideal energetic structural material.

Clinical, biochemical, and molecular genetic characteristics of patients with primary carnitine deficiency identified by newborn screening in Shanghai, China.

Background: Primary carnitine deficiency (PCD) is an autosomal recessive disease caused by mutations in the SLC22A5 gene, which encodes the organic cation transporter 2 (OCTN2). Patients with PCD may be at risk of skeletal or cardiac myopathy, metabolic decompensation, and even sudden death. This study aimed to analyze the biochemical, clinical, and genetic characteristics of PCD patients identified by newborn screening (NBS) in Shanghai. Methods: Dried blood spot (DBS) samples of newborns were analyzed through tandem mass spectrometry (MS/MS) from January 2003 to December 2021. Newborns with low free carnitine (C0) levels were recalled. Mutation in the SLC22A5 gene was analyzed on suspected positive newborns with low C0 levels after recall. Results: 1,247,274 newborns were screened by MS/MS and 40 newborns were diagnosed with PCD, therefore the incidence of PCD in Shanghai was approximately 1:31,200. The mean C0 level in newborns with PCD was 5.37 ± 1.79 µmol/L before treatment and increased to 24.45 ± 10.87 µmol/L after treatment with L-carnitine. Twenty-three different variants were identified in the SLC22A5 gene, including 8 novel variants, of which c.51C>G (p.F17L) was the most frequent (27.27%, 18/66), followed by c.1400C>G (p.S467C) (25.76%, 17/66). Almost all the screened PCD patients were asymptomatic. Conclusion: NBS via MS/MS was a quick and efficient method for the early diagnosis of PCD. The incidence of PCD in Shanghai was 1:31,200. Eight novel variants were identified, which greatly expanded the variant spectrum of SLC22A5. MS/MS combined with genetic testing could effectively improve the diagnostic accuracy of PCD.

Cobalt nanofibers coated with layered nickel silicate coaxial core-shell composites as excellent anode materials for lithium ion batteries.

A novel type of cobalt nanofibers coated with layered nickel silicate (Co nanofibers @ voids @ Ni3Si2O5(OH)4) coaxial core-shell composites were successfully prepared via a well-known Stöber process and two hydrothermal methods. In the composites, the international nanosheet structure of the nickel silicate provided interlayer spaces for lithium ions in the process of insertion and extraction. The cobalt nanofibers served as a mechanical support for the nickel silicate nanosheets, which increased the electrical conductivity of the whole electrode. In addition, one-dimensional coaxial structure was stable to buffer the volume change and avoid the destruction of the structure. Moreover, the voids provided effective channels for the transportation of lithium ions. The Co nanofibers @ voids @ Ni3Si2O5(OH)4) coaxial core-shell composites presented superior electrochemical properties compared with the published Ni3Si2O5(OH)4-related materials. With the advantages of exceptional performances and facile preparation, the composites show prospective application potential as advanced anode materials in lithium ion batteries.

Cobalt fibers anchored with tin disulfide nanosheets as high-performance anode materials for lithium ion batteries.

Well-designed hierarchical nanostructured composites consisting of one dimensional cobalt fibers and thin tin disulfide nanosheets were successfully synthesized for the first time through a hydrothermal method. The SnS2 nanosheets were uniformly grown onto the Co fibers and were almost perpendicular to the Co fibers. The composites as one kind anode materials exhibited more remarkable lithium ion storage properties than SnS2 nanosheets. The composites exhibited a capacity of 500.5mAh/g after 100 cycles even at 1000mA/g. The improved electrochemical performance could be assigned to the Co fiber substrate support, which could provide short lithium ion and electron pathways, alleviate large volume expansion, contribute to the capacity, and offer mechanical stability for the anode electrode. This special designing perhaps could lay a foundation for the preparation of high performance lithium ion battery anode materials.