Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 54
Filtrar
Más filtros

Banco de datos
País/Región como asunto
Tipo del documento
País de afiliación
Intervalo de año de publicación
1.
J Biol Chem ; 300(5): 107233, 2024 May.
Artículo en Inglés | MEDLINE | ID: mdl-38552738

RESUMEN

The NACHT, leucine-rich repeat, and pyrin domains-containing protein 3 (collectively known as NLRP3) inflammasome activation plays a critical role in innate immune and pathogenic microorganism infections. However, excessive activation of NLRP3 inflammasome will lead to cellular inflammation and tissue damage, and naturally it must be precisely controlled in the host. Here, we discovered that solute carrier family 25 member 3 (SLC25A3), a mitochondrial phosphate carrier protein, plays an important role in negatively regulating NLRP3 inflammasome activation. We found that SLC25A3 could interact with NLRP3, overexpression of SLC25A3 and knockdown of SLC25A3 could regulate NLRP3 inflammasome activation, and the interaction of NLRP3 and SLC25A3 is significantly boosted in the mitochondria when the NLRP3 inflammasome is activated. Our detailed investigation demonstrated that the interaction between NLRP3 and SLC25A3 disrupted the interaction of NLRP3-NEK7, promoted ubiquitination of NLRP3, and negatively regulated NLRP3 inflammasome activation. Thus, these findings uncovered a new regulatory mechanism of NLRP3 inflammasome activation, which provides a new perspective for the therapy of NLRP3 inflammasome-associated inflammatory diseases.


Asunto(s)
Inflamasomas , Proteínas Mitocondriales , Proteína con Dominio Pirina 3 de la Familia NLR , Proteínas de Transporte de Fosfato , Animales , Humanos , Ratones , Células HEK293 , Inflamasomas/metabolismo , Mitocondrias/metabolismo , Proteína con Dominio Pirina 3 de la Familia NLR/metabolismo , Proteína con Dominio Pirina 3 de la Familia NLR/genética , Proteínas de Transporte de Fosfato/metabolismo , Proteínas de Transporte de Fosfato/genética , Ubiquitinación , Línea Celular , Proteínas Mitocondriales/genética , Proteínas Mitocondriales/metabolismo , Técnicas de Silenciamiento del Gen
2.
AIDS Res Ther ; 20(1): 51, 2023 07 19.
Artículo en Inglés | MEDLINE | ID: mdl-37468905

RESUMEN

BACKGROUND: MSM are at high risk of HIV infection. Previous studies have shown that the cell cycle regulation plays an important role in HIV-1 infection, especially at the G2/M checkpoint. ATR, Chk1, Cdc25C and CDK1 are key genes of G2/M checkpoint. However, the association between SNPs of these genes and susceptibility to HIV-1 infection and AIDS progression remains unknown. METHODS: In this study, 42 tSNPs from the above four G2/M checkpoint genes were genotyped in 529 MSM and 529 control subjects from northern China to analyze this association. RESULTS: The results showed that rs34660854 A and rs75368165 A in ATR gene and rs3756766 A in Cdc25C gene could increase the risk of HIV-1 infection (P = 0.049, OR = 1.234, 95% CI 1.001-1.521; P = 0.020, OR = 1.296, 95% CI 1.042-1.611; P = 0.011, OR = 1.392, 95% CI 1.080-1.794, respectively), while Chk1 rs10893405 (P = 0.029, OR = 1.629, 95% CI 1.051-2.523) were significantly associated with AIDS progression. Besides, rs34660854 (P = 0.019, OR = 1.364, 95% CI 1.052-1.769; P = 0.022, OR = 1.337, 95% CI 1.042-1.716, under Codominant model and Dominant model, respectively) and rs75368165 (P = 0.006, OR = 1.445, 95% CI = 1.114-1.899; P = 0.007, OR = 1.418, 95% CI 1.099-1.831, under Codominant model and Dominant model, respectively) in ATR gene, rs12576279 (P = 0.013, OR = 0.343, 95% CI 0.147-0.800; P = 0.048, OR = 0.437, 95% CI 0.192-0.991, under Codominant model and Dominant model, respectively) and rs540436 (P = 0.012, OR = 1.407, 95% CI 1.077-1.836; P = 0.021, OR = 1.359, 95% CI 1.048-1.762, under Codominant model and Dominant model, respectively) in Chk1 gene, rs3756766 (P = 0.013, OR = 1.455, 95% CI 1.083-1.954; P = 0.009, OR = 1.460, 95% CI 1.098-1.940, under Codominant model and Dominant model, respectively) in Cdc25C gene and rs139245206 (P = 0.022, OR = 5.011, 95% CI 1.267-19.816; P = 0.020, OR = 5.067, 95% CI 1.286-19.970, under Codominant model and Recessive model, respectively) in CDK1 gene were significantly associated with HIV-1 infection under different models. CONCLUSIONS: We found that genetic variants of G2/M checkpoint genes had a molecular influence on the occurrence of HIV-1 infection and AIDS progression in a northern Chinese MSM population.


Asunto(s)
Síndrome de Inmunodeficiencia Adquirida , Puntos de Control del Ciclo Celular , Infecciones por VIH , Minorías Sexuales y de Género , Humanos , Masculino , Síndrome de Inmunodeficiencia Adquirida/epidemiología , Síndrome de Inmunodeficiencia Adquirida/genética , Pueblos del Este de Asia , Infecciones por VIH/epidemiología , Infecciones por VIH/genética , VIH-1 , Homosexualidad Masculina , Puntos de Control del Ciclo Celular/genética
3.
BMC Genomics ; 23(1): 769, 2022 Nov 24.
Artículo en Inglés | MEDLINE | ID: mdl-36418931

RESUMEN

BACKGROUND: Most susceptible loci of hepatocellular carcinoma (HCC) identified by genome-wide association studies (GWAS) are located in non-coding regions, and the mechanism of action remains unclear. The objective of this study was to explore the association of single nucleotide polymorphisms (SNPs) on long non-coding RNAs (lncRNAs) that affect competing endogenous RNAs (ceRNA) regulation mechanism with the risk and prognosis of HCC. METHODS: Based on a set of bioinformatics strategies, eight lncRNA genes that affect HCC through the mechanism of lncRNA-mediated ceRNA were systematically screened, and 15 SNPs that affect microRNA (miRNA) binding in these lncRNA genes were annotated. Genotyping was performed in 800 HCC cases and 801 healthy controls to examine associations of these SNPs with HCC in a northeastern Chinese Han population. RESULTS: The GG, GC and GG + GC genotypes of HOTAIR rs7958904 were associated with a 0.65, 0.59 and 0.63-fold decreased HCC risk, respectively. In addition, HCC patients with PVT1 rs3931282 AA + GA genotypes were less prone to develop late-stage cancers in a stratified analysis of clinical characteristics. When stratified by clinical biochemical indexes, rs1134492 and rs10589312 in PVT1 and rs84557 in EGFR-AS1 showed significant associations with aspartate aminotransferase (AST), alanine aminotransferase (ALT) or AST/ALT ratio in HCC patients. Furthermore, we constructed potential ceRNA regulatory axes that might be affected by five positive SNPs to explain the causes of these genetic associations. CONCLUSIONS: HOTAIR rs7958904, PVT1 rs3931282, rs1134492 and rs10589312, and EGFR-AS1 rs84557 might be predictors for HCC risk or prognosis. Our results provide new insights into how SNPs on lncRNA-mediated ceRNAs confer interindividual differences to occurrence and progression of HCC.


Asunto(s)
Carcinoma Hepatocelular , Neoplasias Hepáticas , ARN Largo no Codificante , Humanos , ARN Largo no Codificante/genética , Carcinoma Hepatocelular/genética , Polimorfismo de Nucleótido Simple , Estudio de Asociación del Genoma Completo , Neoplasias Hepáticas/genética , Pronóstico , Receptores ErbB
4.
Cleft Palate Craniofac J ; 58(6): 763-772, 2021 06.
Artículo en Inglés | MEDLINE | ID: mdl-33025822

RESUMEN

OBJECTIVES: The relationship between Noggin (NOG) and methylenetetrahydrofolate reductase and nonsyndromic cleft lip and palate (NSCLP) has been reported participate in craniofacial development but need further evidence. To indicate the susceptibility between the 2 genes and NSCLP, rs227731 and rs1801131 polymorphisms were included in the present research. This research may provide some genetic clues for disease detection and surveillance. DESIGN: Seventeen studies including 4023 cases and 5691 controls were provided for meta-analysis, and odds ratio (OR) with 95% CI were obtained to estimate NSCLP risk. RESULTS: Our analysis suggested potential association of rs227731C on increasing the risk of NSCLP in the Caucasian group and total group but not Asian group under all models: allele (OR = 1.45, 95% CI = 1.21-1.75, P < .0001), homozygote (OR = 2.03, 95% CI = 1.42-2.90, P < .0001), heterozygote (OR = 1.44, 95% CI = 1.19-1.73, P = .0001), dominant (OR = 1.61, 95% CI = 1.27-2.04, P < .0001), and recessive models (OR = 1.63, 95% CI = 1.25-2.12, P = .0003). Besides, increased risk is related to rs1801131 in Asian group under 3 models: allele (OR = 1.24, 95% CI = 1.06-1.44, P = .006), heterozygote (OR = 1.24, 95% CI = 1.02-1.52, P = .03), and dominant models (OR = 1.29, 95% CI = 1.06-1.56, P = .009). CONCLUSIONS: Our analysis indicates polymorphisms rs227731 and rs1801131 are associated with NSCLP, with predominance of different ethnic group and deepen understanding of NSCLP.


Asunto(s)
Labio Leporino , Fisura del Paladar , Estudios de Casos y Controles , Labio Leporino/genética , Fisura del Paladar/genética , Predisposición Genética a la Enfermedad , Humanos , Polimorfismo de Nucleótido Simple
5.
J Antimicrob Chemother ; 74(7): 2009-2018, 2019 07 01.
Artículo en Inglés | MEDLINE | ID: mdl-30989233

RESUMEN

BACKGROUND: Previous studies reported that DNA damage repair (DDR) genes may play an important role in HIV-1 infection. The MRE11 gene, a member of the MRN complex, plays an essential part in the homologous recombination pathway, which is one of the classical DDR pathways. Previous reports have demonstrated that MRE11 has an effect on HIV-1 replication. However, the role of SNPs in the MRE11 gene and their impact on HIV-1 infection and AIDS progression remain unknown. METHODS: In this study, 434 MSM HIV-1-infected patients in northern China and 431 age-matched healthy controls were enrolled. Five SNPs (rs2155209, rs10831234, rs13447720, rs601341 and rs11020803) at the MRE11 gene were genotyped. Another series of cases (409 MSM HIV-1-infected patients) and controls (403 age-matched healthy males) were recruited as the validation set. RESULTS: In our study, rs10831234 showed differences in allele frequencies between cases and controls (P = 0.005). Additionally, there was an association between rs10831234 and HIV-1 infection susceptibility in dominant and additive models (P = 0.005 and P = 0.006, respectively). All significant associations were replicated in the validation set, and the associations were still significant after Bonferroni correction for multiple testing when the two data sets were combined. Furthermore, in haplotype association analyses between the case and control groups, the frequencies of the haplotypes Crs11020803Crs10831234 and Trs11020803Trs10831234 showed significant differences (P = 0.0181 and P = 0.0068, respectively). CONCLUSIONS: We demonstrated that the MRE11 rs10831234-T allele may confer increased risk of HIV-1 infection.


Asunto(s)
Predisposición Genética a la Enfermedad , Infecciones por VIH/genética , Infecciones por VIH/virología , VIH-1/fisiología , Homosexualidad Masculina , Proteína Homóloga de MRE11/genética , Polimorfismo de Nucleótido Simple , Síndrome de Inmunodeficiencia Adquirida/epidemiología , Síndrome de Inmunodeficiencia Adquirida/genética , Síndrome de Inmunodeficiencia Adquirida/virología , Adolescente , Adulto , Anciano , Anciano de 80 o más Años , Alelos , Estudios de Casos y Controles , China/epidemiología , Frecuencia de los Genes , Genotipo , Infecciones por VIH/epidemiología , Infecciones por VIH/inmunología , Haplotipos , Humanos , Desequilibrio de Ligamiento , Masculino , Persona de Mediana Edad , Oportunidad Relativa , Carga Viral , Adulto Joven
6.
BMC Med Genet ; 20(1): 203, 2019 12 23.
Artículo en Inglés | MEDLINE | ID: mdl-31870337

RESUMEN

BACKGROUND: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.


Asunto(s)
Duplicación de Gen , Heterocigoto , Proteínas de Homeodominio/genética , Mutación , Sindactilia/genética , Factores de Transcripción/genética , Niño , China , Exones , Femenino , Humanos , Masculino , Linaje
7.
BMC Genomics ; 19(1): 134, 2018 02 12.
Artículo en Inglés | MEDLINE | ID: mdl-29433421

RESUMEN

BACKGROUND: Heilongjiang Province located in northeast China is a multi-ethnic region with people who have lived in cold conditions for several generations. Fatty acids are important to people with cold resistance. CPT1A encodes a protein that imports long-chain fatty acids into the mitochondria for fatty-acid oxidation. FADS is an essential enzyme for the synthesis of long-chain polyunsaturated fatty acids. RESULTS: In the present study, we investigated the distributions of three cold resistance-related SNPs (rs80356779 G > A in CPT1A, rs7115739 T > G in FADS3 and rs174570 C > T in FADS2) from six populations that included 1093 individuals who have lived in Heilongjiang Province for at least three generations. The frequencies of rs174570 and rs7115739 were different in our six north minorities compared to the Chinese Dai in Xishuangbanna (CDX) in southern China. All the SNPs in Hezhen were significantly different from other five studied populations. In addition, the genetic distribution of rs174570 in Daur was significantly different from Manchu and Korea, and the frequency of rs7115739 in Ewenki was significantly different from the other populations. The results also showed that the frequencies of the three SNPs in the six minorities were different from those of Greenlandic Inuit and Siberian population. CONCLUSIONS: Our results showed the distributions of the three cold resistance-related SNPs from six populations that included 1093 individuals in northern China. Distributions of the allele frequencies for the cold resistance-related SNPs in northern China were statistically different from those in southern China. These data help to establish the DNA genome database for the six populations and fully preserve existing minority genetic information.


Asunto(s)
Adaptación Fisiológica/genética , Frío , Etnicidad/genética , Polimorfismo de Nucleótido Simple , Pueblo Asiatico/genética , Carnitina O-Palmitoiltransferasa/genética , China , Etnicidad/clasificación , Ácido Graso Desaturasas/genética , Frecuencia de los Genes , Genotipo , Humanos , Desequilibrio de Ligamiento , Filogenia
8.
Arch Virol ; 162(1): 259-268, 2017 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-27730383

RESUMEN

Men who have sex with men (MSM) are at high risk of HIV infection. The APOBEC3G (apolipoprotein B mRNA editing catalytic polypeptide 3G) protein is a component of innate antiviral immunity that inhibits HIV-1 replication. In the present study, a total of 483 HIV-1 seropositive men and 493 HIV-1 seronegative men were selected to investigate the association between single nucleotide polymorphisms (SNPs) of the APOBEC3G gene and susceptibility to HIV-1 infection and AIDS progression among MSM residing in northern China. Genotyping of four SNPs (rs5757465, rs3736685, rs8177832, and rs2899313) of the APOBEC3G was performed using the SNPscan™ Kit, while the rs2294367 polymorphism was genotyped using the SNaPshot multiplex system. Our results disclosed no association between the SNPs of APOBEC3G and susceptibility to HIV-1, or effects of these polymorphisms on the CD4+ T cell count or clinical phase of disease. A meta-analysis of 1624 men with HIV-1 infection and 1523 controls suggested that the association between rs8177832 and susceptibility was not significant. However, we observed a trend towards association with HIV-1 infection for haplotype TTACA (p = 0.082). The potential role of variants of APOBEC3G in HIV-1/AIDS warrants further investigation.


Asunto(s)
Desaminasa APOBEC-3G/genética , Predisposición Genética a la Enfermedad , Infecciones por VIH/genética , Polimorfismo de Nucleótido Simple , Adolescente , Adulto , Anciano , Recuento de Linfocito CD4 , China , Progresión de la Enfermedad , Técnicas de Genotipaje , Infecciones por VIH/inmunología , Infecciones por VIH/patología , Homosexualidad Masculina , Humanos , Masculino , Persona de Mediana Edad , Adulto Joven
9.
Sheng Wu Yi Xue Gong Cheng Xue Za Zhi ; 31(3): 682-5, 713, 2014 Jun.
Artículo en Zh | MEDLINE | ID: mdl-25219257

RESUMEN

It is difficult to reflect the properties of samples from the signal directly collected by the low field nuclear magnetic resonance (NMR) analyzer. People must obtain the relationship between the relaxation time and the original signal amplitude of every relaxation component by inversion algorithm. Consequently, the technology of T2 spectrum inversion is crucial to the application of NMR data. This study optimized the regularization factor selection method and presented the regularization algorithm for inversion of low field NMR relaxation distribution, which is based on the regularization theory of ill-posed inverse problem. The results of numerical simulation experiments by Matlab7.0 showed that this method could effectively analyze and process the NMR relaxation data.


Asunto(s)
Algoritmos , Espectroscopía de Resonancia Magnética , Humanos
10.
J Orthop Surg (Hong Kong) ; 32(1): 10225536241238638, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-38479435

RESUMEN

BACKGROUND: Lumbar disc herniation (LDH) is a common spinal disease that can cause severe radicular pain. Massage, also known as Tuina in Chinese, has been indicated to exert an analgesic effect in patients with LDH. Nonetheless, the mechanism underlying this effect of massage on LDH remains unclarified. METHODS: Forty Sprague-Dawley rats were randomly divided into four groups. A rat LDH model was established by autologous nucleus pulpous (NP) implantation, followed by treatment with or without massage. A toll-like receptor 4 (TLR4) antagonist TAK-242 was administrated to rats for blocking TLR4. Behavioral tests were conducted to examine rat mechanical and thermal sensitivities. Western blotting was employed for determining TLR4 and NLRP3 inflammasome-associated protein levels in the spinal dorsal horn (SDH). Immunofluorescence staining was implemented for estimating the microglial marker Iba-1 expression in rat SDH tissue. RESULTS: NP implantation induced mechanical allodynia and thermal hyperalgesia in rat ipsilateral hindpaws and activated TLR4/NLRP3 inflammasome signaling transduction in the ipsilateral SDH. Massage therapy or TAK-242 administration relieved NP implantation-triggered pain behaviors in rats. Massage or TAK-242 hindered microglia activation and blocked TLR4/NLRP3 inflammasome activation in ipsilateral SDH of LDH rats. CONCLUSION: Massage ameliorates LDH-related radicular pain in rats by suppressing microglia activation and TLR4/NLRP3 inflammasome signaling transduction.


Asunto(s)
Desplazamiento del Disco Intervertebral , Sulfonamidas , Humanos , Ratas , Animales , Desplazamiento del Disco Intervertebral/complicaciones , Desplazamiento del Disco Intervertebral/terapia , Ratas Sprague-Dawley , Inflamasomas , Receptor Toll-Like 4 , Proteína con Dominio Pirina 3 de la Familia NLR , Dolor , Hiperalgesia/metabolismo , Masaje
11.
PLoS One ; 19(5): e0304137, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-38805487

RESUMEN

This study aims to evaluate the role of the peri-coronary Fat Attenuation Index (FAI) and High-Risk Plaque Characteristics (HRPC) in the assessment of coronary heart disease risk. By conducting coronary CT angiography and coronary angiography on 217 patients with newly developed chest pain (excluding acute myocardial infarction), their degree of vascular stenosis, FAI, and the presence and quantity of HRPC were assessed. The study results demonstrate a correlation between FAI and HRPC, and the combined use of FAI and HRPC can more accurately predict the risk of major adverse cardiovascular events (MACE). Additionally, the study found that patients with high FAI were more prone to exhibit high-risk plaque characteristics, severe stenosis, and multiple vessel disease. After adjustment, the combination of FAI and HRPC improved the ability to identify and reclassify MACE. Furthermore, the study identified high FAI as an independent predictor of MACE in patients undergoing revascularization, while HRPC served as an independent predictor of MACE in patients not undergoing revascularization. These findings suggest the potential clinical value of FAI and HRPC in the assessment of coronary heart disease risk, particularly in patients with newly developed chest pain excluding acute myocardial infarction.


Asunto(s)
Dolor en el Pecho , Angiografía por Tomografía Computarizada , Angiografía Coronaria , Placa Aterosclerótica , Humanos , Masculino , Femenino , Persona de Mediana Edad , Angiografía por Tomografía Computarizada/métodos , Dolor en el Pecho/diagnóstico por imagen , Placa Aterosclerótica/diagnóstico por imagen , Placa Aterosclerótica/complicaciones , Angiografía Coronaria/métodos , Anciano , Infarto del Miocardio/diagnóstico por imagen , Infarto del Miocardio/complicaciones , Medición de Riesgo , Tejido Adiposo/diagnóstico por imagen , Tejido Adiposo/patología , Enfermedad de la Arteria Coronaria/diagnóstico por imagen , Enfermedad de la Arteria Coronaria/complicaciones , Factores de Riesgo , Vasos Coronarios/diagnóstico por imagen , Vasos Coronarios/patología
12.
Front Cell Infect Microbiol ; 14: 1382029, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-38817443

RESUMEN

Infections of hepatotropic viruses cause a wide array of liver diseases including acute hepatitis, chronic hepatitis and the consequently developed cirrhosis and hepatocellular carcinoma (HCC). Among the five classical hepatotropic viruses, hepatitis B virus (HBV) and hepatitis C virus (HCV) usually infect human persistently and cause chronic hepatitis, leading to major troubles to humanity. Previous studies have revealed that several types of inflammasomes are involved in the infections of HBV and HCV. Here, we summarize the current knowledge about their roles in hepatitis B and C. NLRP3 inflammasome can be activated and regulated by HBV and HCV. It is found to exert antiviral function or mediates inflammatory response in viral infections depending on different experimental models. Besides NLRP3 inflammasome, IFI16 and AIM2 inflammasomes participate in the pathological process of hepatitis B, and NALP3 inflammasome may sense HCV infection in hepatocytes. The inflammasomes affect the pathological process of viral hepatitis through its downstream secretion of inflammatory cytokines interleukin-1ß (IL-1ß) and IL-18 or induction of pyroptosis resulting from cleaved gasdermin D (GSDMD). However, the roles of inflammasomes in different stages of viral infection remains mainly unclear. More proper experimental models of viral hepatitis should be developed for specific studies in future, so that we can understand more about the complexity of inflammasome regulation and multifunction of inflammasomes and their downstream effectors during HBV and HCV infections.


Asunto(s)
Hepacivirus , Virus de la Hepatitis B , Hepatitis B Crónica , Hepatitis C Crónica , Inflamasomas , Proteína con Dominio Pirina 3 de la Familia NLR , Humanos , Inflamasomas/metabolismo , Inflamasomas/inmunología , Hepatitis C Crónica/inmunología , Proteína con Dominio Pirina 3 de la Familia NLR/metabolismo , Hepacivirus/inmunología , Hepatitis B Crónica/inmunología , Hepatitis B Crónica/metabolismo , Virus de la Hepatitis B/inmunología , Proteínas de Unión al ADN/metabolismo , Interleucina-1beta/metabolismo , Piroptosis , Animales , Fosfoproteínas/metabolismo , Proteínas Nucleares/metabolismo , Hepatocitos/virología , Hepatocitos/inmunología , Interleucina-18/metabolismo , Proteínas de Unión a Fosfato/metabolismo , Gasderminas
13.
Biochim Biophys Acta Mol Basis Dis ; : 167497, 2024 Sep 03.
Artículo en Inglés | MEDLINE | ID: mdl-39237047

RESUMEN

Chemotherapeutic resistance is a major obstacle to the effectiveness of cisplatin-based chemotherapy for gastric cancer (GC), leading to treatment failure and poor survival rates. However, the underlying mechanisms are not fully understood. Our study demonstrated that the transcription factor myocyte enhancer factor 2A (MEF2A) plays a role in chemotherapeutic drug resistance by regulating the transcription of PGC1α and KEAP1, promoting mitochondrial biogenesis. It was found that increased MEF2A expression is linked with poor prognosis, cisplatin insensitivity, and mitochondrial function in GC. MEF2A overexpression significantly decreases GC cell sensitivity in vitro and in vivo, while MEF2A knockdown enhances the sensitivity to cisplatin. Mechanistically, MEF2A activates the transcription of PGC1α, leading to increased mitochondrial biogenesis. In addition, MEF2A inhibits KEAP1 transcription, reduces NRF2 ubiquitination degradation, and activates the KEAP1/NRF2 signaling pathway, which modulates the reactive oxygen species level. The present study identifies a new critical oncogene involved in GC chemoresistance, suggesting a novel therapeutic target for GC.

14.
Cancer Biol Ther ; 25(1): 2323768, 2024 12 31.
Artículo en Inglés | MEDLINE | ID: mdl-38465861

RESUMEN

Double minutes (DMs), extrachromosomal gene fragments found within certain tumors, have been noted to carry onco- and drug resistance genes contributing to tumor pathogenesis and progression. After screening for SUMO-related molecule expression within various tumor sample and cell line databases, we found that SUMO-conjugating enzyme UBC9 has been associated with genome instability and tumor cell DM counts, which was confirmed both in vitro and in vivo. Karyotyping determined DM counts post-UBC9 knockdown or SUMOylation inhibitor 2-D08, while RT-qPCR and Western blot were used to measure DM-carried gene expression in vitro. In vivo, fluorescence in situ hybridization (FISH) identified micronucleus (MN) expulsion. Western blot and immunofluorescence staining were then used to determine DNA damage extent, and a reporter plasmid system was constructed to detect changes in homologous recombination (HR) and non-homologous end joining (NHEJ) pathways. Our research has shown that UBC9 inhibition is able to attenuate DM formation and lower DM-carried gene expression, in turn reducing tumor growth and malignant phenotype, via MN efflux of DMs and lowering NHEJ activity to increase DNA damage. These findings thus reveal a relationship between heightened UBC9 activity, increased DM counts, and tumor progression, providing a potential approach for targeted therapies, via UBC9 inhibition.


Asunto(s)
Aberraciones Cromosómicas , Daño del ADN , Humanos , Núcleo Celular , Hibridación Fluorescente in Situ
15.
Front Microbiol ; 15: 1342843, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-38362503

RESUMEN

Six new polyketides, which includes three new lactones (talarotones A-C) (1-3), one new polyketide (talarotide A) (4), two new polyenes (talaroyenes A, B) (5, 6), together with one new meroterpenoid (talaropenoid A) (7) and 13 known compounds (8-20) were isolated from the mangrove-derived fungus Talaromyces flavus TGGP35. The structure and configuration of the compounds 1-7 were elucidated from the data obtained from HR-ESI-MS, IR, 1D/2D NMR spectroscopy, Mo2 (OAc)4-induced electronic circular dichroism (ECD), CD spectroscopy, and modified Mosher's method. Compounds 5 and 20 displayed antioxidant activity with IC50 values of 0.40 and 1.36 mM, respectively. Compounds 3, 6, 11, 16, and 17 displayed cytotoxic activity against human cancer cells Hela, A549, and had IC50 values ranging from 28.89 to 62.23 µM. Compounds 7, 10-12, and 14-18 exhibited moderate or potent anti-insect activity against newly hatched larvae of Helicoverpa armigera Hubner, with IC50 values in the range 50-200 µg/mL. Compound 18 showed antibacterial activity against Ralstonia solanacearum with the MIC value of 50 µg/mL.

16.
BMC Med Genet ; 14: 107, 2013 Oct 08.
Artículo en Inglés | MEDLINE | ID: mdl-24103489

RESUMEN

BACKGROUND: Congenital cataract is a Mendelian disorder that frequently causes blindness in infants. To date, various cataract-associated loci have been mapped; more than 30 genes have been identified by linkage analysis. However, the pathogenic loci in some affected families are still unknown, and new research strategies are needed. In this study, we used linkage-exome combinational analysis to further investigate the pedigree of a four-generation Chinese family with autosomal dominant coralliform cataract. METHODS: We combined whole exome sequencing and linkage analysis to identify the causative mutation. The exome capture and next-generation sequencing were used to sequence the protein-coding regions in the genome of the proband to identify rare mutations, which were further screened for candidate mutations in linkage regions. Candidate mutations were independently verified for co-segregation in the whole pedigree using Sanger sequencing. RESULTS: We identified a C to A transversion at nucleotide position c.70 in exon 2 of CRYGD, a cataract-associated gene. This mutation resulted in a threonine substitution for proline at amino acid residue 24. CONCLUSIONS: We identified a missense P24T mutation in CRYGD that was responsible for coralliform cataract in our studied family. Our findings suggest that the combination of exome sequencing and linkage analysis is a powerful tool for identifying Mendelian disease mutations that might be missed by the classic linkage analysis strategy.


Asunto(s)
Pueblo Asiatico/genética , Catarata/genética , gamma-Cristalinas/genética , Catarata/congénito , Catarata/patología , China , Exones , Ligamiento Genético , Haplotipos , Secuenciación de Nucleótidos de Alto Rendimiento , Humanos , Mutación Missense , Linaje , Polimorfismo de Nucleótido Simple
17.
Ann Clin Lab Sci ; 53(2): 248-258, 2023 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-37094858

RESUMEN

OBJECTIVE: Osteoarthritis (OA) is a chronic joint disease characterized by cartilage degeneration, significantly reducing the quality of life. Previous report has confirmed that MAP2K1 acts as a potential therapeutic target in OA. Nevertheless, its specific function and related molecular mechanism in OA remain uncharacterized. Our report revealed the biological significance of MAP2K1 and elucidated its regulatory mechanism in OA. METHODS: Interleukin (IL)-1ß was utilized to stimulate human chondrocyte cell line CHON-001 for establishing the in vitro models of OA. Cell apoptosis and viability were determined by flow cytometry analysis and CCK-8 assay. Protein levels and gene expression were quantified by western blotting and RT-qPCR. Binding relation between miR-16-5p and MAP2K1 (mitogen-activated protein kinase kinase 1) was confirmed by luciferase reporter assay. RESULTS: IL-1ß treatment triggered CHON-001 cell injury by repressing cell viability and facilitating cell apoptosis. Moreover, IL-1ß stimulation upregulated MAP2K1 level in CHON-001 cells. MAP2K1 depletion attenuated IL-1ß-elicited CHON-001 cell injury. Mechanistically, miR-16-5p targeted MAP2K1 in CHON-001 cells. In rescue assays, MAP2K1 upregulation counteracted the suppressive impact of miR-16-5p enhancement on IL-1ß-triggered CHON-001 cell dysfunction. In addition, upregulated miR-16-5p suppressed IL-1ß-elicited activation of MAPK pathway in CHON-001 cells. CONCLUSIONS: MiR-16-5p mitigates IL-1ß-induced damage to chondrocyte CHON-001 by targeting MAP2K1 and inactivating the MAPK signaling.


Asunto(s)
MicroARNs , Osteoartritis , Humanos , Condrocitos/metabolismo , MAP Quinasa Quinasa 1/metabolismo , Calidad de Vida , MicroARNs/genética , Interleucina-1beta/metabolismo , Apoptosis
18.
J Colloid Interface Sci ; 640: 67-77, 2023 Jun 15.
Artículo en Inglés | MEDLINE | ID: mdl-36841173

RESUMEN

Electrocatalytic N2 reduction reaction (eNRR) was an effective alternative method for green synthesis of NH3. By combining the first-principal Density functional theory (DFT) calculations and Monte Carlo (MC) simulation, we systematacially investigated 24 types equal-ratio bimetallic MXene solid solution, involving 88 different catalysts. Our focus was on the catalytic performance of these materials in eNRR. The computational result indicate that MoW(3Mo) has high stability, selectivity (93.8 % against the hydrogen evolution reaction (HER)) and activity (UL = -0.26 V), which is significantly better than that of monometal Mo2CO2 and W2CO2. This improvement in catalytic properties is attributed to the unique electronic structure (e.g. d-band center, charge) of bimetallic MXene solid solution. In explicit solvent conditions, the microenvironment of hydrogen bond in aqueous liquid thermodynamically promotes the catalytic property for eNRR and reduce the catalytic property of HER side reaction, but the kinetic barrier is also increased due to the effect of the hydrogen-bond microenvironment on proton migration. Overall, the obtained bimetallic MXene solid solution MoW(3Mo) exhibits excellent catalytic performance in eNRR.

19.
Nat Prod Res ; 37(23): 3964-3970, 2023.
Artículo en Inglés | MEDLINE | ID: mdl-36622890

RESUMEN

A series of secondary metabolites have been isolated from the genus of Bacillus velezensis, most of which show antibacterial and insecticidal activities. In order to find more bioactive secondary metabolites from B. velezensis, one new natural component aminoindole dimer baciindole A (1), together with seven known compounds (2-8) were isolated from the tomato-derived bacterium Bacillus velezensis Hnu24. The structure of compound 1 was elucidated by its HR-ESI-MS spectral data and 1 D/2D NMR spectroscopic analysis. Compound 3 showed antibacterial activity against Staphylococcus aureus, S. epidermidis and Ralstonia solanacearum with the MIC values of 3.125, 12.5 and 50 µg/mL, respectively. Compound 4 showed antibacterial activity against S. aureus with the MIC value of 12.5 µg/mL. Compound 3 showed cytotoxic activity for human colon cancer HTC116 cancer cells with the IC50 value of 8.42 ± 0.48 µM. Five compounds (1-4 and 8) were obtained from the strain of B. velezensis for the first time. These results indicated that 3 will be useful in developing antimicrobial and treatment of colon cancer agents.


Asunto(s)
Neoplasias del Colon , Solanum lycopersicum , Humanos , Staphylococcus aureus , Antibacterianos/farmacología , Staphylococcus epidermidis
20.
Front Cell Infect Microbiol ; 13: 1309128, 2023.
Artículo en Inglés | MEDLINE | ID: mdl-38249297

RESUMEN

Virus infection is one of the greatest threats to human life and health. In response to viral infection, the host's innate immune system triggers an antiviral immune response mostly mediated by inflammatory processes. Among the many pathways involved, the nucleotide-binding oligomerization domain (NOD)-like receptor protein 3 (NLRP3) inflammasome has received wide attention in the context of viral infection. The NLRP3 inflammasome is an intracellular sensor composed of three components, including the innate immune receptor NLRP3, adaptor apoptosis-associated speck-like protein containing CARD (ASC), and the cysteine protease caspase-1. After being assembled, the NLRP3 inflammasome can trigger caspase-1 to induce gasdermin D (GSDMD)-dependent pyroptosis, promoting the maturation and secretion of proinflammatory cytokines such as interleukin-1 (IL-1ß) and interleukin-18 (IL-18). Recent studies have revealed that a variety of viruses activate or inhibit the NLRP3 inflammasome via viral particles, proteins, and nucleic acids. In this review, we present a variety of regulatory mechanisms and functions of the NLRP3 inflammasome upon RNA viral infection and demonstrate multiple therapeutic strategies that target the NLRP3 inflammasome for anti-inflammatory effects in viral infection.


Asunto(s)
Inflamasomas , Infecciones por Virus ARN , Humanos , Proteína con Dominio Pirina 3 de la Familia NLR , Caspasa 1 , Interleucina-1beta
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA