Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 14 de 14
Filtrar
1.
Crit Rev Food Sci Nutr ; : 1-20, 2024 Jul 23.
Artículo en Inglés | MEDLINE | ID: mdl-39041177

RESUMEN

The spicy properties of foods are contributed by various spicy flavor substances (SFs) such as capsaicin, piperine, and allicin. Beyond their distinctive sensory characteristics, SFs also influence health conditions and numerous studies have associated spicy flavors with disease treatment. In this review, we enumerate different types of SFs and describe their role in food processing, with a specific emphasis on critically examining their influence on human wellness. Particularly, detailed insights into the mechanisms through which SFs enhance physiological balance and alleviate neurological diseases are provided, and a systematic analysis of the significance of transient receptor potential vanilloid type-1 (TRPV1) in regulating metabolism and nervous system homeostasis is presented. Moreover, enhancing the accessibility and utilization of SFs can potentially amplify the physiological effects. This review aims to provide compelling evidence for the integration of food flavor and human health.

2.
Mol Ther ; 31(4): 1136-1158, 2023 04 05.
Artículo en Inglés | MEDLINE | ID: mdl-36793212

RESUMEN

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.


Asunto(s)
COVID-19 , Vacunas Virales , Humanos , SARS-CoV-2/genética , Transducción de Señal , ARN Mensajero/genética
3.
Environ Microbiol ; 23(11): 6587-6602, 2021 11.
Artículo en Inglés | MEDLINE | ID: mdl-34672071

RESUMEN

Hotspots of N2 O emissions are generated from legume residues during decomposition. Arbuscular mycorrhizal fungi (AMF) from co-cultivated intercropped plants may proliferate into the microsites and interact with soil microbes to reduce N2 O emissions. Yet, the mechanisms by which or how mycorrhizal hyphae affect nitrifiers and denitrifiers in the legume residues remain ambiguous. Here, a split-microcosm experiment was conducted to assess hyphae of Rhizophagus aggregatus from neighbouring maize on overall N2 O emissions from stubbles of nodulated or non-nodulated soybean. Soil microbes from fields intercropped with maize/soybean amended with fertilizer nitrogen (SS-N1) or unamended (SS-N0) were added to the soybean chamber only. AMF hyphae consistently reduced N2 O emissions by 20.8%-61.5%. Generally, AMF hyphae promoted the abundance of N2 O-consuming (nosZ-type) denitrifiers and altered their community composition. The effects were partly associated with increasing MBC and DOC. By contrast, AMF reduced the abundance of nirK-type denitrifiers in the nodulated SS-N0 treatment only and that of AOB in the non-nodulated SS-N1 treatment. Taken together, our results show that AMF reduced N2 O emissions from soybean stubbles, mainly through the promotion of N2 O-consuming denitrifiers. This holds promise for mitigating N2 O emissions by manipulating the efficacious AMF and their associated microbes in cereal/legume intercropping systems.


Asunto(s)
Fabaceae , Micorrizas , Micorrizas/química , Óxido Nitroso , Suelo/química , Microbiología del Suelo , Glycine max
4.
Langmuir ; 35(35): 11435-11442, 2019 Sep 03.
Artículo en Inglés | MEDLINE | ID: mdl-31403803

RESUMEN

The Fe3O4@SiO2 paramagnetic Janus particles with phenyl groups and amino groups segmented on two different sides were fabricated by the Pickering emulsion method. Then, the poly(ionic liquid)s were selectively modified onto the amino side via in situ induced ATRP polymerization. Different anions were introduced onto the poly(ionic liquid)s region by exchanging anions to adjust the wettability of the side. Meanwhile, after the PW12O403- anions were employed, the poly(ionic liquid)-modified Fe3O4@SiO2 Janus particles can be used as a catalytic solid emulsifier and degraded water-soluble dyes with the aid of stabilizing emulsion.

5.
Front Microbiol ; 15: 1372866, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-38525071

RESUMEN

Soil enzymes play a central role in carbon and nutrient cycling, and their activities can be affected by drought-induced oxygen exposure. However, a systematic global estimate of enzyme sensitivity to drought in wetlands is still lacking. Through a meta-analysis of 55 studies comprising 761 paired observations, this study found that phosphorus-related enzyme activity increased by 38% as result of drought in wetlands, while the majority of other soil enzyme activities remained stable. The expansion of vascular plants under long-term drought significantly promoted the accumulation of phenolic compounds. Using a 2-week incubation experiment with phenol supplementation, we found that phosphorus-related enzyme could tolerate higher biotoxicity of phenolic compounds than other enzymes. Moreover, a long-term (35 years) drainage experiment in a northern peatland in China confirmed that the increased phenolic concentration in surface layer resulting from a shift in vegetation composition inhibited the increase in enzyme activities caused by rising oxygen availability, except for phosphorus-related enzyme. Overall, these results demonstrate the complex and resilient nature of wetland ecosystems, with soil enzymes showing a high degree of adaptation to drought conditions. These new insights could help evaluate the impact of drought on future wetland ecosystem services and provide a theoretical foundation for the remediation of degraded wetlands.

6.
Front Endocrinol (Lausanne) ; 14: 1241962, 2023.
Artículo en Inglés | MEDLINE | ID: mdl-37780612

RESUMEN

Objectives: To evaluate the effectiveness and potential mechanism of traditional Chinese medicine Jiawei-Xiaoyao-San (JWXYS) as an adjunct or mono- therapy for antithyroid drugs (ATDs) in the treatment of hyperthyroidism. Methods: Eight databases and three trial registries were searched from inception until May 2023. Randomized controlled trials (RCTs) were included and meta-analysis was conducted using RevMan 5.4 and Stata 14.0. The Cochrane risk of bias (ROB) tool 1.0 and GRADE tool was used for quality appraisal. The findings from case reports using mono-JWXYS and pharmacological studies were summarized in tables. Results: Thirteen RCTs with 979 participants were included. The majority of the included studies were assessed as high risk of bias in one ROB domain. Compared with ATDs, JWXYS plus ATDs resulted in lower free triiodothyronine (FT3) (MD = -1.31 pmol/L, 95% CI [-1.85, -0.76]; low-certainty), lower free thyroxine (MD = -3.24 pmol/L, 95% CI [-5.06, -1.42]; low-certainty), higher thyroid stimulating hormone (MD = 0.42 mIU/L, 95% CI [0.26, 0.59]; low-certainty), higher effectiveness rate of traditional Chinese medicine syndrome (RR = 1.28, 95% CI [1.08, 1.52]; low-certainty), lower goiter score (MD = -0.66, 95% CI [-1.04, -0.29]; very low-certainty), lower thyrotrophin receptor antibody (SMD = -0.44, 95% CI [-0.73, -0.16]; low-certainty) and fewer adverse events (AEs) (RR = 0.34, 95% CI [0.18, 0.67]; moderate-certainty). Compared with regular dosage of ATDs, JWXYS plus half-dose ATDs resulted in fewer AEs (RR = 0.24, 95% CI [0.10, 0.59]; low-certainty). Compared with ATDs in 1 trial, JWXYS resulted in higher FT3, lower goiter score and fewer AEs. Three case reports showed that the reasons patients sought TCM-only treatment include severe AEs and multiple relapses. Three pharmacological studies demonstrated that JWXYS restored Th17/Treg balance, lowered deiodinases activity, regulated thyroid cell proliferation and apoptosis, and alleviated liver oxidative stress in mouse or rat models. Conclusion: JWXYS may enhance the effectiveness of ATDs for hyperthyroidism, particularly in relieving symptoms and reducing AEs. Mono-JWXYS is not recommended except in patients intolerant to ATDs. The findings should be interpreted with caution due to overall high risk of bias. Further pharmacological studies with more reliable models are needed. Systematic review registration: https://www.crd.york.ac.uk/prospero/, identifier CRD42023394923.


Asunto(s)
Bocio , Hipertiroidismo , Animales , Humanos , Ratones , Ratas , Hipertiroidismo/tratamiento farmacológico , Informes de Casos como Asunto
7.
Exp Neurol ; 364: 114386, 2023 06.
Artículo en Inglés | MEDLINE | ID: mdl-36934866

RESUMEN

The brain is one of the important reservoir sites for HIV persistent/latent infection that often leads to HIV-associated neurocognitive disorders (HAND). However, HIV dynamics in the brain is an understudied area and little is known about mechanisms underlying the development and progression of HAND. This issue is mainly due to the lack of suitable in vitro models that can recapitulate the cellular and molecular complexity of the human brain. Hence, there is an urgent need for such models to study HIV neuropathogenesis and to develop therapeutics for HAND. The emergence of three-dimensional (3D) brain organoids generated from induced pluripotent stem cells (iPSCs) has now provided a clinically relevant in vitro model to study HIV brain infection and neuropathogenesis. Recently, there have been a noticeable number of publications that demonstrate the feasibility and advantages of this model for studies of neurobiology and brain disorders as well as HIV infection. Here, we describe the development of iPSC-derived human microglia-containing brain organoids, including advantages/challenges, and focus on their applicability for modeling HIV brain infection.


Asunto(s)
Infecciones por VIH , Células Madre Pluripotentes Inducidas , Humanos , Encéfalo/patología , Organoides
8.
Integr Med Res ; 12(4): 101004, 2023 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-38033651

RESUMEN

Background: Advanced pancreatic cancer (APC) is a fatal disease with limited treatment options. This study aims to evaluate the effectiveness and safety of different Chinese herbal injections (CHIs) as adjuvants for radiotherapy (RT) in APC and compare their treatment potentials using network meta-analysis. Methods: We systematically searched three English and four Chinese databases for randomized controlled trials (RCTs) from inception to July 25, 2023. The primary outcome was the objective response rate (ORR). Secondary outcomes included Karnofsky performance status (KPS) score, overall survival (OS), and adverse events (AEs). The treatment potentials of different CHIs were ranked using the surface under the cumulative ranking curve (SUCRA). The Cochrane RoB 2 tool and CINeMA were used for quality assessment and evidence grading. Results: Eighteen RCTs involving 1199 patients were included. Five CHIs were evaluated. Compound Kushen injection (CKI) combined with RT significantly improved ORR compared to RT alone (RR 1.49, 95 % CrI 1.21-1.86). Kanglaite (KLT) plus RT (RR 1.58, 95 % CrI 1.20-2.16) and CKI plus RT (RR 1.49, 95 % CrI 1.16-1.95) were associated with improved KPS score compared to radiation monotherapy, with KLT+RT being the highest rank (SUCRA 72.28 %). Regarding AEs, CKI plus RT was the most favorable in reducing the incidence of leukopenia (SUCRA 90.37 %) and nausea/vomiting (SUCRA 85.79 %). Conclusions: CKI may be the optimal choice of CHIs to combine with RT for APC as it may improve clinical response, quality of life, and reduce AEs. High-quality trials are necessary to establish a robust body of evidence. Protocol registration: PROSPERO, CRD42023396828.

9.
Int J Biol Sci ; 19(10): 3226-3248, 2023.
Artículo en Inglés | MEDLINE | ID: mdl-37416774

RESUMEN

Loss of function in transport protein particles (TRAPP) links a new set of emerging genetic disorders called "TRAPPopathies". One such disorder is NIBP syndrome, characterized by microcephaly and intellectual disability, and caused by mutations of NIBP/TRAPPC9, a crucial and unique member of TRAPPII. To investigate the neural cellular/molecular mechanisms underlying microcephaly, we developed Nibp/Trappc9-deficient animal models using different techniques, including morpholino knockdown and CRISPR/Cas mutation in zebrafish and Cre/LoxP-mediated gene targeting in mice. Nibp/Trappc9 deficiency impaired the stability of the TRAPPII complex at actin filaments and microtubules of neurites and growth cones. This deficiency also impaired elongation and branching of neuronal dendrites and axons, without significant effects on neurite initiation or neural cell number/types in embryonic and adult brains. The positive correlation of TRAPPII stability and neurite elongation/branching suggests a potential role for TRAPPII in regulating neurite morphology. These results provide novel genetic/molecular evidence to define patients with a type of non-syndromic autosomal recessive intellectual disability and highlight the importance of developing therapeutic approaches targeting the TRAPPII complex to cure TRAPPopathies.


Asunto(s)
Discapacidad Intelectual , Microcefalia , Animales , Ratones , Discapacidad Intelectual/genética , Discapacidad Intelectual/metabolismo , Microcefalia/genética , Microcefalia/metabolismo , Neuritas/fisiología , Neuronas/metabolismo , Pez Cebra
10.
Microbiome ; 11(1): 45, 2023 03 09.
Artículo en Inglés | MEDLINE | ID: mdl-36890606

RESUMEN

BACKGROUND: Arbuscular mycorrhizal fungi (AMF) are key soil organisms and their extensive hyphae create a unique hyphosphere associated with microbes actively involved in N cycling. However, the underlying mechanisms how AMF and hyphae-associated microbes may cooperate to influence N2O emissions from "hot spot" residue patches remain unclear. Here we explored the key microbes in the hyphosphere involved in N2O production and consumption using amplicon and shotgun metagenomic sequencing. Chemotaxis, growth and N2O emissions of isolated N2O-reducing bacteria in response to hyphal exudates were tested using in vitro cultures and inoculation experiments. RESULTS: AMF hyphae reduced denitrification-derived N2O emission (max. 63%) in C- and N-rich residue patches. AMF consistently enhanced the abundance and expression of clade I nosZ gene, and inconsistently increased that of nirS and nirK genes. The reduction of N2O emissions in the hyphosphere was linked to N2O-reducing Pseudomonas specifically enriched by AMF, concurring with the increase in the relative abundance of the key genes involved in bacterial citrate cycle. Phenotypic characterization of the isolated complete denitrifying P. fluorescens strain JL1 (possessing clade I nosZ) indicated that the decline of net N2O emission was a result of upregulated nosZ expression in P. fluorescens following hyphal exudation (e.g. carboxylates). These findings were further validated by re-inoculating sterilized residue patches with P. fluorescens and by an 11-year-long field experiment showing significant positive correlation between hyphal length density with the abundance of clade I nosZ gene. CONCLUSIONS: The cooperation between AMF and the N2O-reducing Pseudomonas residing on hyphae significantly reduce N2O emissions in the microsites. Carboxylates exuded by hyphae act as attractants in recruiting P. fluorescens and also as stimulants triggering nosZ gene expression. Our discovery indicates that reinforcing synergies between AMF and hyphosphere microbiome may provide unexplored opportunities to stimulate N2O consumption in nutrient-enriched microsites, and consequently reduce N2O emissions from soils. This knowledge opens novel avenues to exploit cross-kingdom microbial interactions for sustainable agriculture and for climate change mitigation. Video Abstract.


Asunto(s)
Micorrizas , Suelo , Suelo/química , Desnitrificación , Óxido Nitroso/análisis , Óxido Nitroso/metabolismo , Microbiología del Suelo , Bacterias/genética
11.
Math Biosci Eng ; 19(12): 11840-11853, 2022 Aug 16.
Artículo en Inglés | MEDLINE | ID: mdl-36653977

RESUMEN

The total variation (TV) method favors solutions with the piece-wise constant assumption of the desired image from sparse-view sampling, for example, simple geometric images with flat intensity. When the phantoms become more complex and contain complicated textures, for example, high-resolution phantom and lung CT images, the images reconstructed by TV regularization may lose their contrast and fine structures. One of the optimally sparse transforms for images, the shearlet transform, has C2 without discontinuities on C2 curves, giving excellent sensitive directional information as compared with other wavelet transform approaches. Here, we developed a Shearlet-Sparse Regularization (SSR) algorithm solved with the Alternating Direction Method of Multipliers (ADMM) to overcome this limitation. With the strengthened characteristics of SSR, we performed one simulation experiment and two real experiments using a NeuViz 64 X-ray CT scanning system to measure the performance and properties of proposed algorithm. The results demonstrate that the SSR method exhibits the advantage of providing high-quality directional information and contrast as compared with TV.


Asunto(s)
Algoritmos , Tomografía Computarizada por Rayos X , Simulación por Computador , Fantasmas de Imagen , Procesamiento de Imagen Asistido por Computador/métodos
12.
Transl Neurosci ; 13(1): 354-360, 2022 Jan 01.
Artículo en Inglés | MEDLINE | ID: mdl-36304097

RESUMEN

Objectives: This study aimed to investigate the changes in serum levels of retinol-binding protein 4 (RBP4) with cerebral infarction, relationship of RBP4 with oxidative stress and carotid atherosclerosis, and its possible role in cerebral infarction. Materials and methods: According to the results of cervical vascular ultrasound, the experimental group was divided into three groups: intima thickening group (n = 31), stable plaque group (n = 51), and unstable plaque group (n = 54). Forty healthy subjects were selected as the control group. Their serum levels of RBP4, 8-iso-prostaglandin-F2alpha (8-iso-PGF2α), and catalase (CAT) were measured. Carotid vascular ultrasound was used to measure the plaque area and intima-media thickness (IMT). Results: The serum RBP4 and 8-iso-PGF2α levels, IMT and plaque area in the control, intimal thickening, stable plaque, and unstable plaque groups increased, while the serum level of CAT decreased (P < 0.001). The serum levels of RBP4 positively correlated with 8-iso-PGF2α, IMT, and plaque area and negatively correlated with CAT level. The area under the receiver operating characteristic curve was 0.778 in predicting unstable plaques. Conclusions: The serum levels of RBP4 were significantly elevated in elderly patients with cerebral infarction and correlated with oxidative stress injury and the degree of atherosclerosis. Serum RBP4 has diagnostic value for unstable plaques in carotid arteries.

13.
Front Neurosci ; 16: 929383, 2022.
Artículo en Inglés | MEDLINE | ID: mdl-36081656

RESUMEN

Background: Cognitive dysfunction (CI) is frequently reported in patients with systemic lupus erythematosus (SLE), but the identification and assessment of SLE-related CI remain challenging. Previous studies have focused on changes in static brain activity, and no studies have investigated the characteristics of dynamic brain activity in SLE patients with CI. Objects: We calculated the dynamic amplitude of low-frequency fluctuation (dALFF) by combining the ALFF with a sliding window method to assess the temporal variability of brain functional activity in SLE patients with and without CI. Methods: Thirty-eight SLE with CI, thirty-eight SLE without CI, and thirty-eight healthy controls (HCs) were recruited. By comparing static ALFF (sALFF) and dALFF among the three groups, changes in brain activity intensity and its temporal variability were assessed in patients with SLE with or without CI. Spearman correlation coefficients were calculated between the brain function indicator and Mini-mental State Examination (MMSE) scores of SLE with CI. Results: Subjects among the three groups exhibited significant sALFF differences in the right parahippocampal gyrus, left caudate nucleus, right putamen, and left cuneus. Compared to the SLE without CI, the right parahippocampal gyrus exhibited higher sALFF in the SLE with CI group. Compared to the HCs, the left caudate nucleus exhibited increased sALFF in the SLE with CI group. Participants in the three groups exhibited significant dALFF variability in the right parahippocampal gyrus, right lingual gyrus, and bilateral inferior occipital gyrus. Compared to the HCs, the right lingual gyrus exhibited reduced dALFF in the SLE without CI group. Compared to the HCs, the right parahippocampal gyrus exhibited increased dALFF, left calcarine fissure, and the surrounding cortex exhibited reduced dALFF in the SLE with CI group. There was no significant correlation between the MMSE score, sALFF, and dALFF in the SLE with CI group. Conclusion: SLE patients with CI have abnormal brain activity intensity and stability. By analyzing the dynamics of intrinsic brain activity, it provides a new idea for evaluating SLE-related CI. However, more research and validation with multiple metrics are needed to determine the link between the severity of cognitive impairment (CI) and brain activity in patients with SLE.

14.
Arthritis Res Ther ; 24(1): 259, 2022 11 28.
Artículo en Inglés | MEDLINE | ID: mdl-36443835

RESUMEN

BACKGROUND: Non-neuropsychiatric systemic lupus erythematosus (non-NPSLE) has been confirmed to have subtle changes in brain structure before the appearance of obvious neuropsychiatric symptoms. Previous literature mainly focuses on brain structure loss in non-NPSLE; however, the results are heterogeneous, and the impact of structural changes on the topological structure of patients' brain networks remains to be determined. In this study, we combined neuroimaging and network analysis methods to evaluate the changes in cortical thickness and its structural covariance networks (SCNs) in patients with non-NPSLE. METHODS: We compare the cortical thickness of non-NPSLE patients (N=108) and healthy controls (HCs, N=88) using both surface-based morphometry (SBM) and regions of interest (ROI) methods, respectively. After that, we analyzed the correlation between the abnormal cortical thickness results found in the ROI method and a series of clinical features. Finally, we constructed the SCNs of two groups using the regional cortical thickness and analyzed the abnormal SCNs of non-NPSLE. RESULTS: By SBM method, we found that cortical thickness of 34 clusters in the non-NPSLE group was thinner than that in the HC group. ROI method based on Destrieux atlas showed that cortical thickness of 57 regions in the non-NPSLE group was thinner than that in the HC group and related to the course of disease, autoantibodies, the cumulative amount of immunosuppressive agents, and cognitive psychological scale. In the SCN analysis, the cortical thickness SCNs of the non-NPSLE group did not follow the small-world attribute at a few densities, and the global clustering coefficient appeared to increase. The area under the curve analysis showed that there were significant differences between the two groups in clustering coefficient, degree, betweenness, and local efficiency. There are a total of seven hubs for non-NPSLE, and five hubs in HCs, the two groups do not share a common hub distribution. CONCLUSION: Extensive and obvious reduction in cortical thickness and abnormal topological organization of SCNs are observed in non-NPSLE patients. The observed abnormalities may not only be the realization of brain damage caused by the disease, but also the contribution of the compensatory changes within the nervous system.


Asunto(s)
Lupus Eritematoso Sistémico , Humanos , Lupus Eritematoso Sistémico/diagnóstico por imagen , Autoanticuerpos , Inmunosupresores , Neuroimagen , Encéfalo
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA