The Arabidopsis SR45 splicing factor bridges the splicing machinery and the exon-exon junction complex.

The Arabidopsis splicing factor serine/arginine-rich 45 (SR45) contributes to several biological processes. The sr45-1 loss-of-function mutant exhibits delayed root development, late flowering, unusual numbers of floral organs, shorter siliques with decreased seed sets, narrower leaves and petals, and altered metal distribution. SR45 bears a unique RNA recognition motif (RRM) flanked by one serine/arginine-rich (RS) domain on both sides. Here, we studied the function of each SR45 domains by examining their involvement in: (i) the spatial distribution of SR45; (ii) the establishment of a protein-protein interaction network including spliceosomal and exon-exon junction complex (EJC) components; and (iii) the RNA binding specificity. We report that the endogenous SR45 promoter is active during vegetative and reproductive growth, and that the SR45 protein localizes in the nucleus. We demonstrate that the C-terminal arginine/serine-rich domain is a determinant of nuclear localization. We show that the SR45 RRM domain specifically binds purine-rich RNA motifs via three residues (H101, H141, and Y143), and is also involved in protein-protein interactions. We further show that SR45 bridges both mRNA splicing and surveillance machineries as a partner of EJC core components and peripheral factors, which requires phosphoresidues probably phosphorylated by kinases from both the CLK and SRPK families. Our findings provide insights into the contribution of each SR45 domain to both spliceosome and EJC assemblies.

Distribution of prostatic markers in glands of the female urethra and anterior vaginal wall-a rapid autopsy study.

BACKGROUND: There are varying reports of immunohistochemically detected prostatic marker protein distribution in glands associated with the female urethra that may be related to tissue integrity at the time of fixation. AIM: In this study we used tissue derived from rapid autopsies of female patients to determine the distribution of glandular structures expressing prostate-specific antigen (PSA) and prostate-specific acid phosphatase (PSAP) along the female urethra and in surrounding tissues, including the anterior vaginal wall (AVW). METHODS: Tissue blocks from 7 donors that contained the entire urethra and adjacent AVW were analyzed. These tissue samples were fixed within 4-12 hours of death and divided into 5-mm transverse slices that were paraffin embedded. Sections cut from each slice were immunolabeled for PSA or PSAP and a neighboring section was stained with hematoxylin and eosin. The sections were reviewed by light microscopy and analyzed using QuPath software. OBSERVATIONS: In tissue from all donors, glandular structures expressing PSA and/or PSAP were located within the wall of the urethra and were present along its whole length. RESULTS: In the proximal half of the urethra from all donors, small glands expressing PSAP, but not PSA, were observed adjacent to the and emptying into the lumen. In the distal half of the urethra from 5 of the 7 donors, tubuloacinar structures lined by a glandular epithelium expressed both PSA and PSAP. In addition, columnar cells at the surface of structures with a multilayered transitional epithelium in the distal half of the urethra from all donors expressed PSAP. No glands expressing PSA or PSAP were found in tissues surrounding the urethra, including the AVW. CLINICAL IMPLICATIONS: Greater understanding of the distribution of urethral glands expressing prostatic proteins in female patients is important because these glands are reported to contribute to the female sexual response and to urethral pathology, including urethral cysts, diverticula, and adenocarcinoma. STRENGTHS AND LIMITATIONS: Strengths of the present study include the use of rapid autopsy to minimize protein degradation and autolysis, and the preparation of large tissue sections to demonstrate precise anatomical relations within all the tissues surrounding the urethral lumen. Limitations include the sample size and that all donors had advanced malignancy and had undergone previous therapy which may have had unknown tissue effects. CONCLUSION: Proximal and distal glands expressing prostate-specific proteins were observed in tissue from all donors, and these glands were located only within the wall of the urethra.

What's in a name? A systematic review and meta-analysis to assess the effectiveness of non-medical amplification devices in adults with mild and moderate hearing losses.

OBJECTIVE: To assess non-medical amplification devices in adults with mild-to-moderate hearing loss, and the impact of device features on outcomes. DESIGN: A prospectively registered systematic review. STUDY SAMPLE: Ten studies evaluating personal sound amplification products (PSAPs), and four evaluating smartphone amplification applications (or apps). Devices were classified as "premium" or "basic" based on the number of compression channels (≥16 or <16, respectively). RESULTS: Meta-analyses showed that premium PSAPs improved speech intelligibility in noise performance compared to unaided, whereas basic PSAPs and smartphone apps did not. Premium PSAPs performed better than basic hearing aids. Premium hearing aids performed better than premium and basic PSAPs, smartphone apps, and basic hearing aids. Although data could not be pooled, similar findings were also found for quality of life, listening ability, cognition, feasibility, and adverse effects. CONCLUSIONS: Premium PSAPs appear to be an effective non-medical amplification device for adults with mild-to-moderate hearing loss. Given the overlap in features available, it may be that this is a key consideration when drawing comparisons between devices, rather than the device being named a PSAP or hearing aid. Nevertheless, the extent to which PSAPs are effective without audiological input remains to be determined.

Combined saposin deficiency: A rare occurrence.

Combined saposin deficiency (OMIM #611721), an exceedingly rare lysosomal storage disorder, is caused by a mutation in the gene PSAP. This gene encodes a protein, prosaposin, that cleaves into four constituent proteins, each of which has a role as a cofactor for the enzymes whose deficiency results in Krabbe disease, metachromatic leukodystrophy, Gaucher disease, and Farber disease, respectively. Intact prosaposin itself is essential for neuronal survival. The typical manifestation of combined saposin deficiency is of severe neurological features in the neonatal period, hepatosplenomegaly, thrombocytopenia, and early death. We report, to the best of our knowledge, the first Indian case with these clinical manifestations and confirmation by genetic and enzymatic testing.

Exploring of InDel in bovine PSAP gene and their association with growth traits in different development stages.

PSAP (prosaposin) is widely expressed in different organs, and plays an important role in fat deposit. Insertion/Deletion (InDel) is a relatively simple and effective DNA marker. However, the association of molecular marker at different stages of animal development has not received enough attention, especially fat deposition related traits. Therefore, eight cattle breeds were used to explore novel InDels variants within bovine PSAP gene, and to evaluate their effects on growth traits in different development stages. Herein, two novel InDels (P5:NC037355.1g.27974439-27974440 ins AGTGTGGTTAATGTCAAC and P8:NC037355.1g.27980734-27980752 del GTCAAAAAATCAGGGGAAAC) within the bovine PSAP gene were found, and their association with growth traits in different development stages were analyzed. Interestingly, the dominant genotype was different in different development stages both in NY cattle and JX cattle for daily gain and body weight. PSAP Gene expression patterns were analyzed in this study, high expression in the middle stage of adipocytes differentiation suggests that it plays a certain role in fat development. It reveals that InDels could affect phenotype in different development stages, which depend on the expression pattern of the host gene and their function in different tissues. These findings could provide a new way for molecular marker studies in bovine breeding and genetics.

Saposin C, Key Regulator in the Alpha-Synuclein Degradation Mediated by Lysosome.

Lysosomal dysfunction has been proposed as one of the most important pathogenic molecular mechanisms in Parkinson disease (PD). The most significant evidence lies in the GBA gene, which encodes for the lysosomal enzyme ß-glucocerebrosidase (ß-GCase), considered the main genetic risk factor for sporadic PD. The loss of ß-GCase activity results in the formation of α-synuclein deposits. The present study was aimed to determine the activity of the main lysosomal enzymes and the cofactors Prosaposin (PSAP) and Saposin C in PD and healthy controls, and their contribution to α-synuclein (α-Syn) aggregation. 42 PD patients and 37 age-matched healthy controls were included in the study. We first analyzed the ß-GCase, ß-galactosidase (ß-gal), ß-hexosaminidase (Hex B) and Cathepsin D (CatD) activities in white blood cells. We also measured the GBA, ß-GAL, ß-HEX, CTSD, PSAP, Saposin C and α-Syn protein levels by Western-blot. We found a 20% reduced ß-GCase and ß-gal activities in PD patients compared to controls. PSAP and Saposin C protein levels were significantly lower in PD patients and correlated with increased levels of α-synuclein. CatD, in contrast, showed significantly increased activity and protein levels in PD patients compared to controls. Increased CTSD protein levels in PD patients correlated, intriguingly, with a higher concentration of α-Syn. Our findings suggest that lysosomal dysfunction in sporadic PD is due, at least in part, to an alteration in Saposin C derived from reduced PSAP levels. That would lead to a significant decrease in the ß-GCase activity, resulting in the accumulation of α-syn. The accumulation of monohexosylceramides might act in favor of CTSD activation and, therefore, increase its enzymatic activity. The evaluation of lysosomal activity in the peripheral blood of patients is expected to be a promising approach to investigate pathological mechanisms and novel therapies aimed to restore the lysosomal function in sporadic PD.

Rare Saposin A deficiency: Novel variant and psychosine analysis.

Saposin A is a post-translation product of the prosaposin (PSAP) gene that serves as an activator protein of the galactocerebrosidase (GALC) enzyme, and is necessary for the degradation of certain glycosphingolipids. Deficiency of saposin A leads to a clinical picture identical to that of early-infantile Krabbe disease caused by GALC enzyme deficiency. Galactosylsphingosine, also known as psychosine, is a substrate of the GALC enzyme that is known to be elevated in classic Krabbe disease. We present the case of an 18-month-old male with clinical and radiological findings concerning for Krabbe disease who had preserved GALC enzyme activity and negative GALC gene sequencing, but was found to have a homozygous variant, c.257 T > A (p.I86N), in the saposin A peptide of PSAP. Psychosine determination on dried blood spot at 18 months of age was elevated to 12 nmol/L (normal <3 nmol/L). We present this case to add to the literature on the rare diagnosis of atypical Krabbe disease due to saposin A deficiency, to report a novel presumed pathogenic variant within PSAP, and to suggest that individuals with saposin A deficiency may have elevated levels of psychosine, similar to children with classic Krabbe disease due to GALC deficiency.

Prosaposin is a biomarker of mesenchymal glioblastoma and regulates mesenchymal transition through the TGF-ß1/Smad signaling pathway.

Mesenchymal glioblastoma (GBM) is the most aggressive subtype of GBM. Our previous study found that neurotrophic factor prosaposin (PSAP) is highly expressed and secreted in glioma and can promote the growth of glioma. The role of PSAP in mesenchymal GBM is still unclear. In this study, bioinformatic analysis, western blotting and RT-qPCR were used to detect the expression of PSAP in different GBM subtypes. Human glioma cell lines and patient-derived glioma stem cells were studied in vitro and in vivo, revealing that mesenchymal GBM expressed and secreted the highest level of PSAP among four subtypes of GBM, and PSAP could promote GBM invasion and epithelial-mesenchymal transition (EMT)-like processes in vivo and in vitro. Bioinformatic analysis and western blotting showed that PSAP mainly played a regulatory role in GBM invasion and EMT-like processes via the TGF-ß1/Smad signaling pathway. In conclusion, the overexpression and secretion of PSAP may be an important factor causing the high invasiveness of mesenchymal GBM. PSAP is therefore a potential target for the treatment of mesenchymal GBM. © 2019 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Immunohistochemistry, carcinomas of unknown primary, and incidence rates.

Pathologists use immunohistochemistry is their day-to-day practices to assist in distinguishing site of origin of metastatic carcinomas. Here, the work-up is discussed neuroendocrine carcinomas, squamous cell carcinomas and adenocarcinomas with particular attention to tumor incident rates and predictive values of the best-performing immunohistochemical markers.

From provocation to aggression: the neural network.

BACKGROUND: In-vivo observations of neural processes during human aggressive behavior are difficult to obtain, limiting the number of studies in this area. To address this gap, the present study implemented a social reactive aggression paradigm in 29 healthy men, employing non-violent provocation in a two-player game to elicit aggressive behavior in fMRI settings. RESULTS: Participants responded more aggressively after high provocation reflected in taking more money from their opponents. Comparing aggression trials after high provocation to those after low provocation revealed activations in neural circuits involved in aggression: the medial prefrontal cortex (mPFC), the orbitofrontal cortex (OFC), the dorsolateral prefrontal cortex (dlPFC), the anterior cingulate cortex (ACC), and the insula. In general, our findings indicate that aggressive behavior activates a complex, widespread brain network, reflecting a cortico-limbic interaction and overlapping with circuits underlying negative emotions and conflicting decision-making. Brain activation during provocation in the OFC was associated with the degree of aggressive behavior in this task. CONCLUSION: Therefore, data suggest there is greater susceptibility for provocation, rather than less inhibition of aggressive tendencies, in individuals with higher aggressive responses. This further supports the hypothesis that reactive aggression can be seen as a consequence of provocation of aggressive emotional responses and parallel evaluative regulatory processes mediated mainly by the insula and prefrontal areas (OFC, mPFC, dlPFC, and ACC) respectively.

Skene's gland adenocarcinoma with intestinal differentiation: A case report and literature review.

Adenocarcinoma of Skene's gland (the female homolog to the male prostate) is extremely rare, with only a few cases reported. We present a case of Skene's gland adenocarcinoma with intestinal differentiation. The patient was a 69-year-old Japanese woman who was operated on for a recurrent tumor of the external ostium of the urethra. Histopathologically, the tumor showed glandular and cribriform patterns with a signet-ring cell component in a mucus lake. Immunohistochemically, the tumor cells were positive for prostate specific acid phosphatase (PSAP), and AMACR, and negative for Nkx3.1 or prostate specific antigen (PSA). Although in situ lesion could not be discovered, positive immunostainings for Nkx3.1, PSAP, and androgen receptor in the remaining paraurethral glands around the tumor indirectly but strongly suggest that the tumor had originated from Skene's gland. This tumor also showed intestinal differentiation as suggested histologically and by positive immunostainings for CDX2, MUC2, and CK20, along with negative immunostaining for CK7. It is often very difficult to identify the origin of a female urethral carcinoma. In such cases, immunohistochemical features can be an essential clue to the origin. We therefore present this instructive case with a literature review.

Aggression-related brain function assessed with the Point Subtraction Aggression Paradigm in fMRI.

The Point Subtraction Aggression Paradigm (PSAP) measures aggressive behavior in response to provocations. The aim of the study was to implement the PSAP in a functional neuroimaging environment (fMRI) and evaluate aggression-related brain reactivity including response to provocations and associations with aggression within the paradigm. Twenty healthy participants completed two 12-min PSAP sessions within the scanner. We evaluated brain responses to aggressive behavior (removing points from an opponent), provocations (point subtractions by the opponent), and winning points. Our results showed significant ventral and dorsal striatal reactivity when participants won a point and removed one from the opponent. Provocations significantly activated the amygdala, dorsal striatum, insula, and prefrontal areas. Task-related aggressive behavior was positively correlated with neural reactivity to provocations in the insula, the dorsal striatum, and prefrontal areas. Our findings suggest the PSAP within an fMRI environment may be a useful tool for probing aggression-related neural pathways. Activity in the amygdala, dorsal striatum, insula, and prefrontal areas during provocations is consistent with the involvement of these brain regions in emotional and impulsive behavior. Striatal reactivity may suggest an involvement of reward during winning and stealing points.

Sensitivity of HOXB13 as a Diagnostic Immunohistochemical Marker of Prostatic Origin in Prostate Cancer Metastases: Comparison to PSA, Prostein, Androgen Receptor, ERG, NKX3.1, PSAP, and PSMA.

AIMS: Determining the origin of metastases is an important task of pathologists to allow for the initiation of a tumor-specific therapy. Recently, homeobox protein Hox-B13 (HOXB13) has been suggested as a new marker for the detection of prostatic origin. The aim of this study was to evaluate the diagnostic sensitivity of HOXB13 in comparison to commonly used immunohistochemical markers for prostate cancer. MATERIALS AND METHODS: Histologically confirmed prostate cancer lymph node metastases from 64 cases were used to test the diagnostic value of immunohistochemical markers: prostate specific antigen (PSA), Prostatic acid phosphatase (PSAP), prostate specific membrane antigen (PSMA), homeobox gene NKX3.1, prostein, androgen receptor (AR), HOXB13, and ETS-related gene (ERG). All markers were evaluated semi-quantitatively using Remmele's immune reactive score. RESULTS: The detection rate of prostate origin of metastasis for single markers was 100% for NKX3.1, 98.1% for AR, 84.3% for PSMA, 80.8% for PSA, 66% for PSAP, 60.4% for HOXB13, 59.6% for prostein, and 50.0% for ERG. CONCLUSIONS: Our data suggest that HOXB13 on its own lacks sensitivity for the detection of prostatic origin. Therefore, this marker should be only used in conjunction with other markers, preferably the highly specific PSA. The combination of PSA with NKX3.1 shows a higher sensitivity and thus appears preferable in this setting.

Mutation Update of ARSA and PSAP Genes Causing Metachromatic Leukodystrophy.

Metachromatic leukodystrophy is a neurodegenerative disorder characterized by progressive demyelination. The disease is caused by variants in the ARSA gene, which codes for the lysosomal enzyme arylsulfatase A, or, more rarely, in the PSAP gene, which codes for the activator protein saposin B. In this Mutation Update, an extensive review of all the ARSA- and PSAP-causative variants published in the literature to date, accounting for a total of 200 ARSA and 10 PSAP allele types, is presented. The detailed ARSA and PSAP variant lists are freely available on the Leiden Online Variation Database (LOVD) platform at http://www.LOVD.nl/ARSA and http://www.LOVD.nl/PSAP, respectively.

Diagnostic Role and Prognostic Impact of PSAP Immunohistochemistry: A Tissue Microarray Study on 31,358 Cancer Tissues.

Prostate-specific acid phosphatase (PSAP) is a marker for prostate cancer. To assess the specificity and prognostic impact of PSAP, 14,137 samples from 127 different tumor (sub)types, 17,747 prostate cancers, and 76 different normal tissue types were analyzed via immunohistochemistry in a tissue microarray format. In normal tissues, PSAP staining was limited to the prostate epithelial cells. In prostate cancers, PSAP was seen in 100% of Gleason 3 + 3, 95.5% of Gleason 4 + 4, 93.8% of recurrent cancer under androgen deprivation therapy, 91.0% of Gleason 5 + 5, and 31.2% of small cell neuroendocrine cancer. In non-prostatic tumors, PSAP immunostaining was only found in 3.2% of pancreatic neuroendocrine tumors and in 0.8% of diffuse-type gastric adenocarcinomas. In prostate cancer, reduced PSAP staining was strongly linked to an advanced pT stage, a high classical and quantitative Gleason score, lymph node metastasis, high pre-operative PSA levels, early PSA recurrence (p < 0.0001 each), high androgen receptor expression, and TMPRSS2:ERG fusions. A low level of PSAP expression was linked to PSA recurrence independent of pre- and postoperative prognostic markers in ERG-negative cancers. Positive PSAP immunostaining is highly specific for prostate cancer. Reduced PSAP expression is associated with aggressive prostate cancers. These findings make PSAP a candidate marker for prognostic multiparameter panels in ERG-negative prostate cancers.

Integrative Transcriptomic Analyses of Hippocampal-Entorhinal System Subfields Identify Key Regulators in Alzheimer's Disease.

The hippocampal-entorhinal system supports cognitive function and is selectively vulnerable to Alzheimer's disease (AD). Little is known about global transcriptomic changes in the hippocampal-entorhinal subfields during AD. Herein, large-scale transcriptomic analysis is performed in five hippocampal-entorhinal subfields of postmortem brain tissues (262 unique samples). Differentially expressed genes are assessed across subfields and disease states, and integrated genotype data from an AD genome-wide association study. An integrative gene network analysis of bulk and single-nucleus RNA sequencing (snRNA-Seq) data identifies genes with causative roles in AD progression. Using a system-biology approach, pathology-specific expression patterns for cell types are demonstrated, notably upregulation of the A1-reactive astrocyte signature in the entorhinal cortex (EC) during AD. SnRNA-Seq data show that PSAP signaling is involved in alterations of cell- communications in the EC during AD. Further experiments validate the key role of PSAP in inducing astrogliosis and an A1-like reactive astrocyte phenotype. In summary, this study reveals subfield-, cell type-, and AD pathology-specific changes and demonstrates PSAP as a potential therapeutic target in AD.

Methamphetamine, amphetamine, and aggression in humans: A systematic review of drug administration studies.

The relationship between amphetamine use and aggressive or violent behaviour is unclear. This review examined laboratory data collected in humans, who were administered an acute dose of amphetamine or methamphetamine, in order to investigate the link between amphetamines and aggression. It is registered with PROSPERO (CRD42019127711). Included in the analysis are data from twenty-eight studies. Behavioural and/or subjective measures of aggression were assessed in one thousand and sixty-nine research participants, with limited amphetamine-use histories, following a single amphetamine dose (0-35 mg). The available published evidence indicates that neither amphetamine nor methamphetamine acutely increased aggression as assessed by traditional laboratory measures. Future research should assess supratherapeutic amphetamine doses as well as include a broader range of multiple aggression measures, facilitating simultaneous assessment of the various components that comprise this complex, multifaceted construct.

Comparison of personal sound amplification products and conventional hearing aids for patients with hearing loss: A systematic review with meta-analysis.

Background: Hearing loss is a common morbidity that requires a hearing device to improve quality of life and prevent sequelae, such as dementia, depression falls, and cardiovascular disease. However, conventional hearing aids have some limitations, including poor accessibility and unaffordability. Consequently, personal sound amplification products (PSAPs) are considered a potential first-line alternative remedy for patients with hearing loss. The main objective of this study was to compare the efficacy of PSAPs and conventional hearing aids regarding hearing benefits in patients with hearing loss. Methods: This systematic review and meta-analysis followed the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. Five databases and reference lists were searched from inception to January 12, 2022. Studies including randomised, controlled trials; nonrandomised, controlled trials; or observational studies comparing PSAPs and hearing aids with regard to hearing gain performance (e.g., speech intelligence) were considered eligible. The review was registered prospectively on PROSPERO (CRD42021267187). Findings: Of 599 records identified in the preliminary search, five studies were included in the review and meta-analysis. A total of 124 patients were divided into the PSAP group and the conventional hearing aid group. Five studies including seven groups compared differences for speech intelligence in the signal-noise ratio (SNR) on the hearing in noise test (HINT) between PSAPs and conventional hearing aids. The pooled results showed nonsignificant differences in speech intelligence (SMD, 0.14; 95% CI, -0.19 to 0.47; P = .41; I 2=65%), sound quality (SMD, -0.37; 95% CI, -0.87 to 0.13; P = .15; I 2=77%) and listening effort (SMD 0.02; 95% CI, -0.24 to 0.29; P = .86; I 2=32%). Nonsignificant results were also observed in subsequent analyses after excluding patients with moderately severe hearing loss. Complete sensitivity analyses with all of the possible combinations suggested nonsignificant results in most of the comparisons between PSAPs and conventional hearing aids. Interpretation: PSAPs are potentially beneficial as conventional hearing aids are in patients with hearing loss. The different features among PSAPs should be considered for patients indicated for hearing devices. Funding: This work was supported by grants from Ministry of Science and Technology (MOST-10-2622-8-075-001) and Veterans General Hospitals and University System of Taiwan Joint Research Program (VGHUST111-G6-11-2 and VGHUST111c-140).

Rare PSAP Variants and Possible Interaction with GBA in REM Sleep Behavior Disorder.

BACKGROUND: PSAP encodes saposin C, the co-activator of glucocerebrosidase, encoded by GBA. GBA mutations are associated with idiopathic/isolated REM sleep behavior disorder (iRBD), a prodromal stage of synucleinopathy. OBJECTIVE: To examine the role of PSAP mutations in iRBD. METHODS: We fully sequenced PSAP and performed Optimized Sequence Kernel Association Test in 1,113 iRBD patients and 2,324 controls. We identified loss-of-function (LoF) mutations, which are very rare in PSAP, in three iRBD patients and none in controls (uncorrected p = 0.018). RESULTS: Two variants were stop mutations, p.Gln260Ter and p.Glu166Ter, and one was an in-frame deletion, p.332_333del. All three mutations have a deleterious effect on saposin C, based on in silico analysis. In addition, the two carriers of p.Glu166Ter and p.332_333del mutations also carried a GBA variant, p.Arg349Ter and p.Glu326Lys, respectively. The co-occurrence of these extremely rare PSAP LoF mutations in two (0.2%) GBA variant carriers in the iRBD cohort, is unlikely to occur by chance (estimated co-occurrence in the general population based on gnomAD data is 0.00035%). Although none of the three iRBD patients with PSAP LoF mutations have phenoconverted to an overt synucleinopathy at their last follow-up, all manifested initial signs suggestive of motor dysfunction, two were diagnosed with mild cognitive impairment and all showed prodromal clinical markers other than RBD. Their probability of prodromal PD, according to the Movement Disorder Society research criteria, was 98% or more. CONCLUSION: These results suggest a possible role of PSAP variants in iRBD and potential genetic interaction with GBA, which requires additional studies.

Assessment of telecommunicator cardiopulmonary resuscitation performance during out-of-hospital cardiac arrest using a standardized tool for audio review.

OBJECTIVE: Telecommunicator cardiopulmonary resuscitation (T-CPR) is a critical component of optimized out-of-hospital cardiac arrest (OHCA) care. We assessed a pilot tool to capture American Heart Association (AHA) T-CPR measures and T-CPR coaching by telecommunicators using audio review. METHODS: Using a pilot tool, we conducted a retrospective review of 911 call audio from 65 emergency medical services-treated out-of-hospital cardiac arrest (OHCA) patients. Data collection included events (e.g., OHCA recognition), time intervals, and coaching quality measures. We calculated summary statistics for all performance and quality measures. RESULTS: Among 65 cases, the patients' mean age was 64.7 years (SD: 14.6) and 17 (26.2%) were women. Telecommunicator recognition occurred in 72% of cases (47/65). Among 18 non-recognized cases, reviewers determined 12 (66%) were not recognizable based on characteristics of the call. Median time-to-recognition was 76 seconds (n = 40; IQR:39-138), while median time-to-first-instructed-compression was 198 seconds (n = 26; IQR:149-233). In 36 cases where coaching was needed, coaching on compression-depth occurred in 27 (75%); -rate in 28 (78%); and chest recoil in 10 (28%) instances. In 30 cases where repositioning was needed, instruction to position the patient's body flat occurred in 18 (60%) instances, on-back in 22 (73%) instances, and on-ground in 22 (73%) instances. CONCLUSIONS: Successful collection of data to calculate AHA T-CPR measures using a pilot tool for audio review revealed performance near AHA benchmarks, although coaching instructions did not occur in many instances. Application of this standardized tool may aid in T-CPR quality review.