Molecular Identification of UDP-Sugar-Dependent Glycosyltransferase and Acyltransferase Involved in the Phenylethanoid Glycoside Biosynthesis Induced by Methyl Jasmonate in Sesamum indicum L.

Sesame (Sesamum indicum L.) plants contain large amounts of acteoside, a typical phenylethanoid glycoside (PhG) that exhibits various pharmacological activities. Although there is increasing interest in the biosynthesis of PhGs for improved production, the pathway remains to be clarified. In this study, we established sesame-cultured cells and performed transcriptome analysis of methyl jasmonate (MeJA)-treated cultured cells to identify enzyme genes responsible for glucosylation and acylation in acteoside biosynthesis. Among the genes annotated as UDP-sugar-dependent glycosyltransferase (UGT) and acyltransferase (AT), 34 genes and one gene, respectively, were upregulated by MeJA in accordance with acteoside accumulation. Based on a phylogenetic analysis, five UGT genes (SiUGT1-5) and one AT gene (SiAT1) were selected as candidate genes involved in acteoside biosynthesis. Additionally, two AT genes (SiAT2-3) were selected based on sequence identity. Enzyme assays using recombinant SiUGT proteins revealed that SiUGT1, namely, UGT85AF10, had the highest glucosyltransferase activity among the five candidates against hydroxytyrosol to produce hydroxytyrosol 1-O-glucoside. SiUGT1 also exhibited glucosyltransferase activity against tyrosol to produce salidroside (tyrosol 1-O-glucoside). SiUGT2, namely, UGT85AF11, had similar activity against hydroxytyrosol and tyrosol. Enzyme assay using the recombinant SiATs indicated that SiAT1 and SiAT2 had activity transferring the caffeoyl group to hydroxytyrosol 1-O-glucoside and salidroside (tyrosol 1-O-glucoside) but not to decaffeoyl-acteoside. The caffeoyl group was attached mainly at the 4-position of glucose of hydroxytyrosol 1-O-glucoside, followed by attachment at the 6-position and the 3-position of glucose. Based on our results, we propose an acteoside biosynthetic pathway induced by MeJA treatment in sesame.

Sesamin: A Promising Therapeutic Agent for Ameliorating Symptoms of Diabetes.

Diabetes is a chronic metabolic disease characterized by improperly regulating proteins, carbohydrates, and lipids due to insulin deficiency or resistance. The increasing prevalence of diabetes poses a tremendous socioeconomic burden worldwide, resulting in the rise of many studies on Chinese herbal medicines to discover the most effective cure for diabetes. Sesame seeds are among these Chinese herbal medicines that were found to contain various pharmacological activities, including antioxidant and anti-inflammatory properties, lowering cholesterol, improving liver function, blood pressure and sugar lowering, regulating lipid synthesis, and anticancer activities. These medicinal benefits are attributed to sesamin, which is the main lignan found in sesame seeds and oil. In this study, Wistar rat models were induced with type 2 diabetes using streptozotocin (STZ) and nicotinamide, and the effect of sesamin on the changes in body weight, blood sugar level, glycosylated hemoglobin (HbA1c), insulin levels, and the states of the pancreas and liver of the rats were evaluated. The results indicate a reduced blood glucose level, HbA1c, TG, and ALT and AST enzymes after sesamin treatment, while increased insulin level, SOD, CAT, and GPx activities were also observed. These findings prove sesamin's efficacy in ameliorating the symptoms of diabetes through its potent pharmacological activities.

New Anti-Glycative Lignans from the Defatted Seeds of Sesamum indicum.

Seven known analogs, along with two previously undescribed lignan derivatives sesamlignans A (1) and B (2), were isolated from a water-soluble extract of the defatted sesame seeds (Sesamum indicum L.) by applying the chromatographic separation method. Structures of compounds 1 and 2 were elucidated based on extensive interpretation of 1D, 2D NMR, and HRFABMS spectroscopic data. The absolute configurations were established by analyzing the optical rotation and circular dichroism (CD) spectrum. Inhibitory effects against the formation of advanced glycation end products (AGEs) and peroxynitrite (ONOO-) scavenging assays were performed to evaluate the anti-glycation effects of all isolated compounds. Among the isolated compounds, (1) and (2) showed potent inhibition towards AGEs formation, with IC50 values of 7.5 ± 0.3 and 9.8 ± 0.5 µM, respectively. Furthermore, the new aryltetralin-type lignan 1 exhibited the most potent activity when tested in the in vitro ONOO- scavenging assay.

Sesame (Sesamum indicum L.) response to drought stress: susceptible and tolerant genotypes exhibit different physiological, biochemical, and molecular response patterns.

Drought is one of the main environmental stresses affecting the quality and quantity of sesame production worldwide. The present study was conducted to investigate the effect of drought stress and subsequent re-watering on physiological, biochemical, and molecular responses of two contrasted sesame genotypes (susceptible vs. tolerant). Results showed that plant growth, photosynthetic rate, stomatal conductance, transpiration rate, and relative water content were negatively affected in both genotypes during water deficit. Both genotypes accumulated more soluble sugars, free amino acids, and proline and exhibited an increased enzyme activity for peroxidase, catalase, superoxide dismutase, and pyruvate dehydrogenase in response to drought damages including increased lipid peroxidation and membrane disruption. However, the tolerant genotype revealed a more extended root system and a more efficient photosynthetic apparatus. It also accumulated more soluble sugars (152%), free amino acids (48%), proline (75%), and antioxidant enzymes while showing lower electrolyte leakage (26%), lipid peroxidation (31%), and starch (35%) content, compared to the susceptible genotype at severe drought. Moreover, drought-related genes such as MnSOD1, MnSOD2, and PDHA-M were more expressed in the tolerant genotype, which encode manganese-dependent superoxide dismutase and the alpha subunit of pyruvate dehydrogenase, respectively. Upon re-watering, tolerant genotype recovered to almost normal levels of photosynthesis, carboxylation efficiency, lipid peroxidation, and electrolyte leakage, while susceptible genotype still suffered critical issues. Overall, these results suggest that a developed root system and an efficient photosynthetic apparatus along with the timely and effective accumulation of protective compounds enabled the tolerant sesame to withstand stress and successfully return to a normal growth state after drought relief. The findings of this study can be used as promising criteria for evaluating genotypes under drought stress in future sesame breeding programs. Supplementary Information: The online version contains supplementary material available at 10.1007/s12298-023-01372-y.

(+)-Sesamin, a sesame lignan, is a potent inhibitor of gut bacterial tryptophan indole-lyase that is a key enzyme in chronic kidney disease pathogenesis.

The progression of chronic kidney disease (CKD) increases the risks of cardiovascular morbidity and end-stage kidney disease. Indoxyl sulfate (IS), which is derived from dietary l-tryptophan by the action of bacterial l-tryptophan indole-lyase (TIL) in the gut, serves as a uremic toxin that exacerbates CKD-related kidney disorder. A mouse model previously showed that inhibition of TIL by 2-aza-l-tyrosine effectively reduced the plasma IS level, causing the recovery of renal damage. In this study, we found that (+)-sesamin and related lignans, which occur abundantly in sesame seeds, inhibit intestinal bacteria TILs. Kinetic studies revealed that (+)-sesamin and sesamol competitively inhibited Escherichia coli TIL (EcTIL) with Ki values of 7 µM and 14 µM, respectively. These Ki values were smaller than that of 2-aza-l-tyrosine (143 µM). Molecular docking simulation of (+)-sesamin- (or sesamol-)binding to EcTIL predicted that these inhibitors potentially bind near the active site of EcTIL, where the cofactor pyridoxal 5'-phosphate is bound, consistent with the kinetic results. (+)-Sesamin is a phytochemical with a long history of consumption and is generally regarded as safe. Hence, dietary supplementation of (+)-sesamin encapsulated in enteric capsules could be a promising mechanism-based strategy to prevent CKD progression. Moreover, the present findings would provide a new structural basis for designing more potent TIL inhibitors for the development of mechanism-based therapeutic drugs to treat CKD.

QTL mapping of yield-related traits in sesame.

Improving yield is one of the most important targets of sesame breeding. Identifying quantitative trait loci (QTLs) of yield-related traits is a prerequisite for marker-assisted selection (MAS) and QTL/gene cloning. In this study, a BC1 population was developed and genotyped with the specific-locus amplified fragment (SLAF) sequencing technology, and a high-density genetic map was constructed. The map consisted of 13 linkage groups, contained 3528 SLAF markers, and covered a total of 1312.52 cM genetic distance, with an average distance of 0.37 cM between adjacent markers. Based on the map, 46 significant QTLs were identified for seven yield-related traits across three environments. These QTLs distributed on 11 linkage groups, each explaining 2.34-71.41% of the phenotypic variation. Of the QTLs, 23 were stable QTLs that were detected in more than one environment, and 20 were major QTLs that explained more than 10% of the corresponding phenotypic variation in at least one environment. Favorable alleles of 38 QTLs originated from the locally adapted variety, Yuzhi 4; the exotic germplasm line, BS, contributed favorable alleles to only 8 QTLs. The results should provide useful information for future molecular breeding and functional gene cloning. Supplementary Information: The online version contains supplementary material available at 10.1007/s11032-021-01236-x.

An Insight into Sesamolin: Physicochemical Properties, Pharmacological Activities, and Future Research Prospects.

Sesame seeds are rich in lignan content and have been well-known for their health benefits. Unlike the other sesame lignan compounds (i.e., sesamin and sesamol), the study of the pharmacological activity of sesamolin has not been explored widely. This review, therefore, summarizes the information related to sesamolin's pharmacological activities, and the mechanism of action. Moreover, the influence of its physicochemical properties on pharmacological activity is also discussed. Sesamolin possessed neuroprotective activity against hypoxia-induced reactive oxygen species (ROS) and oxidative stress in neuron cells by reducing the ROS and inhibiting apoptosis. In skin cancer, sesamolin exhibited antimelanogenesis by affecting the expression of the melanogenic enzymes. The anticancer activity of sesamolin based on antiproliferation and inhibition of migration was demonstrated in human colon cancer cells. In addition, treatment with sesamolin could stimulate immune cells to enhance the cytolytic activity to kill Burkitt's lymphoma cells. However, the toxicity and safety of sesamolin have not been reported. And there is also less information on the experimental study in vivo. The limited aqueous solubility of sesamolin becomes the main problem, which affects its pharmacological activity in the in vitro experiment and clinical efficacy. Therefore, solubility enhancement is needed for further investigation and determination of its pharmacological activity profiles. Since there are fewer reports studying this issue, it could become a future prospective research opportunity.

Anti-Inflammatory and Anticancer Properties of Bioactive Compounds from Sesamum indicum L.-A Review.

The use of foodstuff as natural medicines has already been established through studies demonstrating the pharmacological activities that they exhibit. Knowing the nutritional and pharmacological significance of foods enables the understanding of their role against several diseases. Among the foods that can potentially be considered as medicine, is sesame or Sesamum indicum L., which is part of the Pedaliaceae family and is composed of its lignans such as sesamin, sesamol, sesaminol and sesamolin. Its lignans have been widely studied and are known to possess antiaging, anticancer, antidiabetes, anti-inflammatory and antioxidant properties. Modern chronic diseases, which can transform into clinical diseases, are potential targets of these lignans. The prime example of chronic diseases is rheumatic inflammatory diseases, which affect the support structures and the organs of the body and can also develop into malignancies. In line with this, studies emphasizing the anti-inflammatory and anticancer activities of sesame have been discussed in this review.

Assessment of variability in lignan and fatty acid content in the germplasm of Sesamum indicum L.

Information on the variability available in lignan and fatty acid content in the oilseed crop of Sesamum indicum has been limited. This article presents and discusses the composition, quantity, and variability available for the two traits in the sesame germplasm that are grown in diverse agro climatic regions of India. HPLC and GC analysis of sesame seeds harvested over a period of three crop seasons revealed a considerable amount of variability in lignan and fatty acids. The antioxidant lignans sesamol, sesamin and sesamolin were observed to be in the range of 0.16-3.24, 2.10-5.98 and 1.52-3.76 mg/g of seed, respectively. Similarly oleic and linoleic acids, respectively, have ranged from 34.71 to 45.61% and 38.49 to 49.60%. The black sesame seeds were found rich in sesamin, sesamolin, total lignan content and oleic acid and are thus identified nutritionally and pharmaceutically more important than white and brown seeds. Pearson statistics showed a strong correlation between the components within a particular trait and also some correlation was found between the traits. The study revealed promising cultivars for use in sesame breeding aimed at improving lignan and fatty acid contents, and can be thus directly used in human foods, nutrition, health and welfare.

Identification of a SiCL1 gene controlling leaf curling and capsule indehiscence in sesame via cross-population association mapping and genomic variants screening.

BACKGROUND: Leaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied. RESULTS: For cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553-6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed. CONCLUSIONS: SiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame.

Genetic dissection and fine mapping of a novel dt gene associated with determinate growth habit in sesame.

BACKGROUND: As an important oil crop, growth habit of sesame (Sesamum indicum L.) is naturally indeterminate, which brings about asynchronous maturity of capsules and causes loss of yield. RESULTS: The genetic basis of determinate growth habit in sesame was investigated by classical genetic analysis through multiple populations, results revealed that it was controlled by an unique recessive gene. The genotyping by sequencing (GBS) approach was employed for high-throughput SNP identification and genotyping in the F2 population, then a high density bin map was constructed, the map was 1086.403 cM in length, which consisted of 1184 bins (13,679 SNPs), with an average of 0.918 cM between adjacent bins. Based on bin mapping in conjunction with SSR markers analysis in targeted region, the novel sesame determinacy gene was mapped on LG09 in a genome region of 41 kb. CONCLUSIONS: This study dissected genetic basis of determinate growth habit in sesame, constructed a new high-density bin map and mapped a novel determinacy gene. Results of this study demonstrate that we employed an optimized approach to get fine-accuracy, high-resolution and high-efficiency mapping result in sesame. The findings provided important foundation for sesame determinacy gene cloning and were expected to be applied in breeding for cultivars suited to mechanized production.

Sesame Seeds: A Nutrient-Rich Superfood.

Sesame seeds (Sesamum indicum L.) have been cultivated for thousands of years and have long been celebrated for their culinary versatility. Beyond their delightful nutty flavor and crunchy texture, sesame seeds have also gained recognition for their remarkable health benefits. This article provides an in-depth exploration of the numerous ways in which sesame seeds contribute to overall well-being. Sesame seeds are a powerhouse of phytochemicals, including lignans derivatives, tocopherol isomers, phytosterols, and phytates, which have been associated with various health benefits, including the preservation of cardiovascular health and the prevention of cancer, neurodegenerative disorders, and brain dysfunction. These compounds have also been substantiated for their efficacy in cholesterol management. Their potential as a natural source of beneficial plant compounds is presented in detail. The article further explores the positive impact of sesame seeds on reducing the risk of chronic diseases thanks to their rich polyunsaturated fatty acids content. Nevertheless, it is crucial to remember the significance of maintaining a well-rounded diet to achieve the proper balance of n-3 and n-6 polyunsaturated fatty acids, a balance lacking in sesame seed oil. The significance of bioactive polypeptides derived from sesame seeds is also discussed, shedding light on their applications as nutritional supplements, nutraceuticals, and functional ingredients. Recognizing the pivotal role of processing methods on sesame seeds, this review discusses how these methods can influence bioactive compounds. While roasting the seeds enhances the antioxidant properties of the oil extract, certain processing techniques may reduce phenolic compounds.

Genetic Diversity and Population Structure of a Large USDA Sesame Collection.

Sesame, Sesamum indicum L., is one of the oldest domesticated crops used for its oil and protein in many parts of the world. To build genomic resources for sesame that could be used to improve sesame productivity and responses to stresses, a USDA sesame germplasm collection of 501 accessions originating from 36 countries was used in this study. The panel was genotyped using genotyping-by-sequencing (GBS) technology to explore its genetic diversity and population structure and the relatedness among its accessions. A total of 24,735 high-quality single-nucleotide polymorphism (SNP) markers were identified over the 13 chromosomes. The marker density was 1900 SNP per chromosome, with an average polymorphism information content (PIC) value of 0.267. The marker polymorphisms and heterozygosity estimators indicated the usefulness of the identified SNPs to be used in future genetic studies and breeding activities. The population structure, principal components analysis (PCA), and unrooted neighbor-joining phylogenetic tree analyses classified two distinct subpopulations, indicating a wide genetic diversity within the USDA sesame collection. Analysis of molecular variance (AMOVA) revealed that 29.5% of the variation in this population was due to subpopulations, while 57.5% of the variation was due to variation among the accessions within the subpopulations. These results showed the degree of differentiation between the two subpopulations as well as within each subpopulation. The high fixation index (FST) between the distinguished subpopulations indicates a wide genetic diversity and high genetic differentiation among and within the identified subpopulations. The linkage disequilibrium (LD) pattern averaged 161 Kbp for the whole sesame genome, while the LD decay ranged from 168 Kbp at chromosome LG09 to 123 Kbp in chromosome LG05. These findings could explain the complications of linkage drag among the traits during selections. The selected accessions and genotyped SNPs provide tools to enhance genetic gain in sesame breeding programs through molecular approaches.

High-density genetic map construction and QTL mapping to identify genes for blight defense- and yield-related traits in sesame (Sesamum indicum L.).

Sesame (Sesamum indicum L.) is an important oilseed crop widely cultivated in subtropical and tropical areas. Low genetic yield potential and susceptibility to disease contribute to low productivity in sesame. However, the genetic basis of sesame yield- and disease-related traits remains unclear. Here, we represent the construction of a high-density bin map of sesame using whole genome sequencing of an F2 population derived from 'Yizhi' and 'Mingdeng Zhima'. A total of 2766 Bins were categorized into 13 linkage groups. Thirteen significant QTLs were identified, including ten QTLs related to yield, two QTLs related to Sesame Fusarium wilt (SFW) disease, and one QTL related to seed color. Among these QTLs, we found that SFW-QTL1.1 and SFW-QTL1.2 were major QTLs related to Fusarium wilt disease, explaining more than 20% of the phenotypic variation with LOD > 6. SCC-QTL1.1 was related to seed coat color, explaining 52% of the phenotypic variation with LOD equal to 25.3. This suggests that seed color traits were controlled by a major QTL. Candidate genes related to Fusarium wilt disease and seed color in the QTLs were annotated. We discovered a significant enrichment of genes associated with resistance to late blight. These genes could be spectral disease resistance genes and may have a role in the regulation of Fusarium wilt disease resistance. Our study will benefit the implementation of marker-assisted selection (MAS) for the genetic improvement of disease resistance and yield-related traits in sesame.

Association analysis for quality traits in a diverse panel of Chinese sesame (Sesamum indicum L.) germplasm.

The main objective of this study was to evaluate the potential of a sesame (Sesamum indicum L.) panel for association analysis, and investigate the genetic basis of oil content (OC), protein content, oleic acid concentration, and linoleic acid concentration using association mapping. A panel of 216 sesame accessions was phenotyped in a multi-environment trial and fingerprinted with 608 polymorphic loci produced by 79 primers, including simple sequence repeats (SSRs), sequence-related amplified polymorphisms (SRAPs), and amplified fragment length polymorphisms (AFLPs). Population structure analysis revealed two subgroups in the population. The Q model performed better for its ability to re-identify associations for the four traits at highly significant P-values compared to the other three mixed models. And a total of 35 and 25 associations for the four traits in 2010 and 2011 were identified, respectively, with the Q model after Bonferroni correction. Among those associations, only one for OC was re-identified in two environments, and several markers associated simultaneously with multiple traits were discovered. These results suggest the power and stability of the Q model for association analysis of nutritional traits in this sesame panel for its slight population stratification and familial relationship, which could aid in dissecting complex traits, and could help to develop strategies for improving nutritional quality.

Artificial neural network approach for predicting the sesame (Sesamum indicum L.) leaf area: A non-destructive and accurate method.

The estimative of the leaf area using a nondestructive method is paramount for successive evaluations in the same plant with precision and speed, not requiring high-cost equipment. Thus, the objective of this work was to construct models to estimate leaf area using artificial neural network models (ANN) and regression and to compare which model is the most effective model for predicting leaf area in sesame culture. A total of 11,000 leaves of four sesame cultivars were collected. Then, the length (L) and leaf width (W), and the actual leaf area (LA) were quantified. For the ANN model, the parameters of the length and width of the leaf were used as input variables of the network, with hidden layers and leaf area as the desired output parameter. For the linear regression models, leaf dimensions were considered independent variables, and the actual leaf area was the dependent variable. The criteria for choosing the best models were: the lowest root of the mean squared error (RMSE), mean absolute error (MAE), and absolute mean percentage error (MAPE), and higher coefficients of determination (R2). Among the linear regression models, the equation yˆ=0.515+0.584*LW was considered the most indicated to estimate the leaf area of the sesame. In modeling with ANNs, the best results were found for model 2-3-1, with two input variables (L and W), three hidden variables, and an output variable (LA). The ANN model was more accurate than the regression models, recording the lowest errors and higher R2 in the training phase (RMSE: 0.0040; MAE: 0.0027; MAPE: 0.0587; and R2: 0.9834) and in the test phase (RMSE: 0.0106; MAE: 0.0029; MAPE: 0.0611; and R2: 0.9828). Thus, the ANN method is the most indicated and accurate for predicting the leaf area of the sesame.

Quality of Edible Sesame Oil as Obtained by Green Solvents: In Silico versus Experimental Screening Approaches.

The present study aimed to investigate the qualitative and quantitative performance of five green solvents, namely 2-methyltetrahydrofuran (MeTHF), cyclopentyl methyl ether (CPME), p-cymene, d-limonene and ethanol to substitute n-hexane, for sesame seed oil extraction. In fact, both CPME and MeTHF gave higher crude yields than n-hexane (58.82, 54.91 and 50.84%, respectively). The fatty acid profile of the sesame seed oils remained constant across all the solvent systems, with a predominance of oleic acid (39.27-44.35%) and linoleic acid (38.88-43.99%). The total sterols gained the upmost amount with CPME (785 mg/100 g oil) and MeTHF (641 mg/100 g oil). CPME and MeTHF were also characterized by the optimum content of tocopherols (52.3 and 50.6 mg/100 g oil, respectively). The highest contents of total phenols in the sesame seed oils were extracted by CPME (23.51 mg GAE/g) and MeTHF (22.53 mg GAE/g) as compared to the other solvents, especially n-hexane (8 mg GAE/g). Additionally, sesame seed oils extracted by MeTHF and CPME also had the highest antioxidant and anti-inflammatory properties as compared to the other green solvents and n-hexane, encouraging their manufacturing use for sesame seed oil extraction.

Genetic diversity using biochemical, physiological, karyological and molecular markers of Sesamum indicum L.

The genetic diversity and the relationships among sesame cultivars were investigated using physiological and cyto/molecular analysis. To our information, no studies have yet been conducted on the genetic evaluation of sesame genotypes based on cyto/molecular analysis in Saudi Arabia. This study showed that genotype Bah-312 had the highest values from physiological and biochemical traits (plant height, harvest index, total plant dry matter, seed yield, oil content, and fatty acids content). Using 20 ISSR and 25 SCoT primers, the studied genotypes amplified 233 and 275 alleles, while the average polymorphism percentage (P%) was 65.32% (ISSR) and 77.8% (SCoT) across all the studied genotypes, respectively. To assess the markers efficiency analysis the polymorphism information contents (PIC), Marker Index (MI), Effective Multiplex Ratio (EMR), Resolving Power (Rp) were estimated. In general, primers (ISSR 2 & SCoT 21) and (ISSR 4 & SCoT 3) revealed the highest and lowest values for P %, PIC, MI, and EMR%. Furthermore, 188 positive and negative unique bands were detected, out of which ISSR generated 84, while 104 were amplified by SCoT analysis. In this regard, genotype Bah-312 generated 41 unique amplicons, and Jiz-511 genotype 23 unique amplicons. In the same context, the population genetics parameters, number of different alleles (Na), number of effective alleles (Ne), Shannon's index (I), expected heterozygosity (He), and Unbiased Expected Heterozygosity (uHe), were calculated. ISSR marker showed the highest values for all the estimated parameters. In this regard, genotype Bah-312 exhibited the highest values (1.35, 1.37, 0.31, 0.21, 0.29) & (1.31, 1.35, 0.30, 0.20, 0.27) while, genotype Ahs-670 revealed the least values (1.29, 1.31, 0.26, 0.16, 0.23) &(1.14, 1.26, 0.22, 0.15, 0.20) for ISSR and SCoT markers respectively. For cytological data, according to the highest asymmetry index (AsK%) and lowest total form percentage (TF%) values, genotype Ahs-670 was the most advanced cultivar, and genotype Bah-312 was the most primitive one. According to the degree of asymmetry of karyotype (A) and intrachromosomal asymmetry index (A1), sesame genotype Ahs-670 was the most asymmetrical, and Bah-312 was the most symmetrical genotype. This study gives some helpful information about the genetic diversity of six sesame landraces. The variation harbored by these landraces could be used in sesame breeding programs.

Comparative DNA Methylome of Phytoplasma Associated Retrograde Metamorphosis in Sesame (Sesamum indicum L.).

Phytoplasma-associated diseases such as phyllody and little leaf are critical threats to sesame cultivation worldwide. The mechanism of the dramatic conversion of flowers to leafy structures leading to yield losses and the drastic reduction in leaf size due to Phytoplasma infection remains yet to be identified. Cytosine methylation profiles of healthy and infected sesame plants studied using Whole Genome Bisulfite Sequencing (WGBS) and Quantitative analysis of DNA methylation with the real-time PCR (qAMP) technique revealed altered DNA methylation patterns upon infection. Phyllody was associated with global cytosine hypomethylation, though predominantly in the CHH (where H = A, T or C) context. Interestingly, comparable cytosine methylation levels were observed between healthy and little leaf-affected plant samples in CG, CHG and CHH contexts. Among the different genomic fractions, the highest number of differentially methylated Cytosines was found in the intergenic regions, followed by promoter, exonic and intronic regions in decreasing order. Further, most of the differentially methylated genes were hypomethylated and were mainly associated with development and defense-related processes. Loci for STOREKEEPER protein-like, a DNA-binding protein and PP2-B15, an F-Box protein, responsible for plugging sieve plates to maintain turgor pressure within the sieve tubes were found to be hypomethylated by WGBS, which was confirmed by methylation-dependent restriction digestion and qPCR. Likewise, serine/threonine-protein phosphatase-7 homolog, a positive regulator of cryptochrome signaling involved in hypocotyl and cotyledon growth and probable O-methyltransferase 3 locus were determined to be hypermethylated. Phytoplasma infection-associated global differential methylation as well as the defense and development-related loci reported here for the first time significantly elucidate the mechanism of phytoplasma-associated disease development.

First Report of Sesame Mutants Tolerant to Severe Drought Stress during Germination and Early Seedling Growth Stages.

In the context of climate change and water scarcity, there is a need to develop and use drought-tolerant sesame cultivars. This study was conducted to evaluate the response of 13 sesame genotypes, including 11 mutants and their wild-types, to drought during germination and early seedling growth. Moderate and severe drought stress was simulated by applying polyethylene glycol (PEG) at two osmotic potentials, -0.6 MPa and -1.2 MPa, respectively, on seeds of two successive mutant generations, M2 and M3. The parameters measured or calculated were germination percentage (GP), germination rate (GR), mean germination time (MGT), root length (RL), shoot length (SL), root to shoot ratio (RSR), and the seedling vigor index (SVI). Results showed the significant effect of genotype, drought, and drought × genotype interaction on all parameters investigated. Under severe drought, seeds of seven genotypes, including wild types, were not able to germinate. There was a drastic decline of all parameters for the rest, except MGT and RSR, which markedly increased. Interestingly, two mutants, "ML2-5" and "ML2-10", were identified as the most tolerant to severe drought and the most stable over both generations. The present work is the first report of sesame germplasm with such a high level of tolerance to drought during germination and early seedling growth stages.