ß-Hydroxybutyrate Prevents Vascular Senescence through hnRNP A1-Mediated Upregulation of Oct4.

ß-hydroxybutyrate (ß-HB) elevation during fasting or caloric restriction is believed to induce anti-aging effects and alleviate aging-related neurodegeneration. However, whether ß-HB alters the senescence pathway in vascular cells remains unknown. Here we report that ß-HB promotes vascular cell quiescence, which significantly inhibits both stress-induced premature senescence and replicative senescence through p53-independent mechanisms. Further, we identify heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) as a direct binding target of ß-HB. ß-HB binding to hnRNP A1 markedly enhances hnRNP A1 binding with Octamer-binding transcriptional factor (Oct) 4 mRNA, which stabilizes Oct4 mRNA and Oct4 expression. Oct4 increases Lamin B1, a key factor against DNA damage-induced senescence. Finally, fasting and intraperitoneal injection of ß-HB upregulate Oct4 and Lamin B1 in both vascular smooth muscle and endothelial cells in mice in vivo. We conclude that ß-HB exerts anti-aging effects in vascular cells by upregulating an hnRNP A1-induced Oct4-mediated Lamin B1 pathway.

Coordinate regulation of alternative pre-mRNA splicing events by the human RNA chaperone proteins hnRNPA1 and DDX5.

Alternative premessenger RNA (pre-mRNA) splicing is a post-transcriptional mechanism for controlling gene expression. Splicing patterns are determined by both RNA-binding proteins and nuclear pre-mRNA structure. Here, we analyzed pre-mRNA splicing patterns, RNA-binding sites, and RNA structures near these binding sites coordinately controlled by two splicing factors: the heterogeneous nuclear ribonucleoprotein hnRNPA1 and the RNA helicase DDX5. We identified thousands of alternative pre-mRNA splicing events controlled by these factors by RNA sequencing (RNA-seq) following RNAi. Enhanced cross-linking and immunoprecipitation (eCLIP) on nuclear extracts was used to identify protein-RNA-binding sites for both proteins in the nuclear transcriptome. We found a significant overlap between hnRNPA1 and DDX5 splicing targets and that they share many closely linked binding sites as determined by eCLIP analysis. In vivo SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension) chemical RNA structure probing data were used to model RNA structures near several exons controlled and bound by both proteins. Both sequence motifs and in vivo UV cross-linking sites for hnRNPA1 and DDX5 were used to map binding sites in their RNA targets, and often these sites flanked regions of higher chemical reactivity, suggesting an organized nature of nuclear pre-mRNPs. This work provides a first glimpse into the possible RNA structures surrounding pre-mRNA splicing factor-binding sites.

Splicing factor hnRNPA1 regulates alternative splicing of LOXL2 to enhance the production of LOXL2Δ13.

Lysyl oxidase-like 2 (LOXL2) is a member of the lysyl oxidase family and has the ability to catalyze the cross-linking of extracellular matrix collagen and elastin. High expression of LOXL2 is related to tumor cell proliferation, invasion, and metastasis. LOXL2 contains 14 exons. Previous studies have found that LOXL2 has abnormal alternative splicing and exon skipping in a variety of tissues and cells, resulting in a new alternatively spliced isoform denoted LOXL2Δ13. LOXL2Δ13 lacks LOXL2WT exon 13, but its encoded protein has greater ability to induce tumor cell proliferation, invasion, and metastasis. However, the molecular events that produce LOXL2Δ13 are still unclear. In this study, we found that overexpression of the splicing factor hnRNPA1 in cells can regulate the alternative splicing of LOXL2 and increase the expression of LOXL2Δ13. The exonic splicing silencer exists at the 3' splice site and 5' splice site of LOXL2 exon 13. HnRNPA1 can bind to the exonic splicing silencer and inhibit the inclusion of exon 13. The RRM domain of hnRNPA1 and phosphorylation of hnRNPA1 at S91 and S95 are important for the regulation of LOXL2 alternative splicing. These results show that hnRNPA1 is a splicing factor that enhances the production of LOXL2Δ13.

A splicing silencer in SMN2 intron 6 is critical in spinal muscular atrophy.

Spinal muscular atrophy (SMA) is a fatal neuromuscular disease caused by homozygous deletions or mutations of the SMN1 gene. SMN2 is a paralogous gene of SMN1 and a modifying gene of SMA. A better understanding of how SMN2 exon 7 splicing is regulated helps discover new therapeutic targets for SMA therapy. Based on an antisense walk method to map exonic and intronic splicing silencers (ESSs and ISSs) in SMN2 exon 7 and the proximal regions of its flanking introns, we identified one ISS (ISS6-KH) at upstream of the branch point site in intron 6. By using mutagenesis-coupled RT-PCR with SMN1/2 minigenes, immunochromatography, overexpression and siRNA-knockdown, we found this ISS consists of a bipartite hnRNP A1 binding cis-element and a poly-U sequence located between the proximal hnRNP A1 binding site (UAGCUA) and the branch site. Both HuR and hnRNP C1 proteins promote exon 7 skipping through the poly-U stretch. Mutations or deletions of these motifs lead to efficient SMN2 exon 7 inclusion comparable to SMN1 gene. Furthermore, we identified an optimal antisense oligonucleotide that binds the intron six ISS and causes striking exon 7 inclusion in the SMN2 gene in patient fibroblasts and SMA mouse model. Our findings demonstrate that this novel ISS plays an important role in SMN2 exon 7 skipping and highlight a new therapeutic target for SMA therapy.

NHP2 downregulation counteracts hTR-mediated activation of the DNA damage response at ALT telomeres.

About 10% of cancer cells employ the "alternative lengthening of telomeres" (ALT) pathway instead of re-activating the hTERT subunit of human telomerase. The hTR RNA subunit is also abnormally silenced in some ALT+ cells not expressing hTERT, suggesting a possible negative non-canonical impact of hTR on ALT. Indeed, we show that ectopically expressed hTR reduces phosphorylation of ssDNA-binding protein RPA (p-RPAS33 ) at ALT telomeres by promoting the hnRNPA1- and DNA-PK-dependent depletion of RPA. The resulting defective ATR checkpoint signaling at telomeres impairs recruitment of the homologous recombination protein, RAD51. This induces ALT telomere fragility, increases POLD3-dependent C-circle production, and promotes the recruitment of the DNA damage marker 53BP1. In ALT+ cells that naturally retain hTR expression, NHP2 H/ACA ribonucleoprotein levels are downregulated, likely in order to restrain DNA damage response (DDR) activation at telomeres through reduced 53BP1 recruitment. This unexpected role of NHP2 is independent from hTR's non-canonical function in modulating telomeric p-RPAS33 . Collectively, our study shines new light on the interference between telomerase- and ALT-dependent pathways and unravels a crucial role for hTR and NHP2 in DDR regulation at ALT telomeres.

Embryonic stem cell related gene regulates alternative splicing of transcription factor 3 to maintain human embryonic stem cells' self-renewal and pluripotency.

Exploring the mechanism of self-renewal and pluripotency maintenance of human embryonic stem cells (hESCs) is of great significance in basic research and clinical applications, but it has not been fully elucidated. Long non-coding RNAs (lncRNAs) have been shown to play a key role in the self-renewal and pluripotency maintenance of hESCs. We previously reported that the lncRNA ESRG, which is highly expressed in undifferentiated hESCs, can maintain the self-renewal and pluripotency of hPSCs. RNA pull-down mass spectrometry showed that ESRG could bind to other proteins, among which heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1) attracted our attention. In this study, we showed that HNRNPA1 can maintain self-renewal and pluripotency of hESCs. ESRG bound to and stabilized HNRNPA1 protein through the ubiquitin-proteasome pathway. In addition, knockdown of ESRG or HNRNPA1 resulted in alternative splicing of TCF3, which originally and primarily encoded E12, to mainly encode E47 and inhibit CDH1 expression. HNRNPA1 could rescue the biological function changes of hESCs caused by ESRG knockdown or overexpression. Our results suggest that ESRG regulates the alternative splicing of TCF3 to affect CDH1 expression and maintain hESCs self-renewal and pluripotency by binding and stabilizing HNRNPA1 protein. This study lays a good foundation for exploring the new molecular regulatory mechanism by which ESRG maintains hESCs self-renewal and pluripotency.

ZAP isoforms regulate unfolded protein response and epithelial- mesenchymal transition.

Human ZAP inhibits many viruses, including HIV and coronaviruses, by binding to viral RNAs to promote their degradation and/or translation suppression. However, the regulatory role of ZAP in host mRNAs is largely unknown. Two major alternatively spliced ZAP isoforms, the constitutively expressed ZAPL and the infection-inducible ZAPS, play overlapping yet different antiviral and other roles that need further characterization. We found that the splicing factors hnRNPA1/A2, PTBP1/2, and U1-snRNP inhibit ZAPS production and demonstrated the feasibility to modulate the ZAPL/S balance by splice-switching antisense oligonucleotides in human cells. Transcriptomic analysis of ZAP-isoform-specific knockout cells revealed uncharacterized host mRNAs targeted by ZAPL/S with broad cellular functions such as unfolded protein response (UPR), epithelial-mesenchymal transition (EMT), and innate immunity. We established that endogenous ZAPL and ZAPS localize to membrane compartments and cytosol, respectively, and that the differential localization correlates with their target-RNA specificity. We showed that the ZAP isoforms regulated different UPR branches under resting and stress conditions and affected cell viability during ER stress. We also provided evidence for a different function of the ZAP isoforms in EMT-related cell migration, with effects that are cell-type dependent. Overall, this study demonstrates that the competition between splicing and IPA is a potential target for the modulation of the ZAPL/S balance, and reports new cellular transcripts and processes regulated by the ZAP isoforms.

SNHG15-mediated feedback loop interplays with HNRNPA1/SLC7A11/GPX4 pathway to promote gastric cancer progression.

Dysregulation of long noncoding RNA (lncRNA) expression plays a pivotal role in the initiation and progression of gastric cancer (GC). However, the regulation of lncRNA SNHG15 in GC has not been well studied. Mechanisms for ferroptosis by SNHG15 have not been revealed. Here, we aimed to explore SNHG15-mediated biological functions and underlying molecular mechanisms in GC. The novel SNHG15 was identified by analyzing RNA-sequencing (RNA-seq) data of GC tissues from our cohort and TCGA dataset, and further validated by qRT-PCR in GC cells and tissues. Gain- and loss-of-function assays were performed to examine the role of SNHG15 on GC both in vitro and in vivo. SNHG15 was highly expressed in GC. The enhanced SNHG15 was positively correlated with malignant stage and poor prognosis in GC patients. Gain- and loss-of-function studies showed that SNHG15 was required to affect GC cell growth, migration and invasion both in vitro and in vivo. Mechanistically, the oncogenic transcription factors E2F1 and MYC could bind to the SNHG15 promoter and enhance its expression. Meanwhile, SNHG15 increased E2F1 and MYC mRNA expression by sponging miR-24-3p. Notably, SNHG15 could also enhance the stability of SLC7A11 in the cytoplasm by competitively binding HNRNPA1. In addition, SNHG15 inhibited ferroptosis through an HNRNPA1-dependent regulation of SLC7A11/GPX4 axis. Our results support a novel model in which E2F1- and MYC-activated SNHG15 regulates ferroptosis via an HNRNPA1-dependent modulation of the SLC7A11/GPX4 axis, which serves as the critical effectors in GC progression, and provides a new therapeutic direction in the treatment of GC.

Downregulation of HNRNPA1 induced neoantigen generation via regulating alternative splicing.

BACKGROUND: Immunotherapies effectively treat human malignancies, but the low response and resistance are major obstacles. Neoantigen is an emerging target for tumor immunotherapy that can enhance anti-tumor immunity and improve immunotherapy. Aberrant alternative splicing is an important source of neoantigens. HNRNPA1, an RNA splicing factor, was found to be upregulated in the majority of tumors and play an important role in the tumor immunosuppressive microenvironment. METHODS: Whole transcriptome sequencing was performed on shHNRNPA1 SKOV3 cells and transcriptomic data of shHNRNPA1 HepG2, MCF-7M, K562, and B-LL cells were downloaded from the GEO database. Enrichment analysis was performed to elucidate the mechanisms underlying the activation of anti-tumor immunity induced by HNRNPA1 knockdown. mRNA alternative splicing was analyzed and neoantigens were predicted by JCAST v.0.3.5 and Immune epitope database. The immunogenicity of candidate neoantigens was calculated by Class I pMHC Immunogenicity and validated by the IFN-γ ELISpot assay. The effect of shHNRNPA1 on tumor growth and immune cells in vivo was evaluated by xenograft model combined with immunohistochemistry. RESULTS: HNRNPA1 was upregulated in a majority of malignancies and correlated with immunosuppressive status of the tumor immune microenvironment. Downregulation of HNRNPA1 could induce the activation of immune-related pathways and biological processes. Disruption of HNRNPA1 resulted in aberrant alternative splicing events and generation of immunogenic neoantigens. Downregulation of HNRNPA1 inhibited tumor growth and increased CD8+ T cell infiltration in vivo. CONCLUSION: Our study demonstrated that targeting HNRNPA1 could produce immunogenic neoantigens that elicit anti-tumor immunity by inducing abnormal mRNA splicing. It suggests that HNRNPA1 may be a potential target for immunotherapy.

Exosomes secreted by Fusobacterium nucleatum-infected colon cancer cells transmit resistance to oxaliplatin and 5-FU by delivering hsa_circ_0004085.

BACKGROUND: A large number of Fusobacterium nucleatum (Fn) are present in colorectal cancer (CRC) tissues of patients who relapse after chemotherapy, and Fn has been reported to promote oxaliplatin and 5-FU chemoresistance in CRC. Pathogens such as bacteria and parasites stimulate exosome production in tumor cells, and the regulatory mechanism of exosomal circRNA in the transmission of oxaliplatin and 5-FU chemotherapy resistance in Fn-infected CRC remains unclear. METHODS: Hsa_circ_0004085 was screened by second-generation sequencing of CRC tissues. The correlation between hsa_circ_0004085 and patient clinical response to oxaliplatin/5-FU was analyzed. Exosome tracing experiments and live imaging systems were used to test the effect of Fn infection in CRC on the distribution of hsa_circ_0004085. Colony formation, ER tracking analysis and immunofluorescence were carried out to verify the regulatory effect of exosomes produced by Fn-infected CRC cells on chemotherapeutic resistance and ER stress. RNA pulldown, LC-MS/MS analysis and RIP were used to explore the regulatory mechanism of downstream target genes by hsa_circ_0004085. RESULTS: First, we screened out hsa_circ_0004085 with abnormally high expression in CRC clinical samples infected with Fn and found that patients with high expression of hsa_circ_0004085 in plasma had a poor clinical response to oxaliplatin/5-FU. Subsequently, the circular structure of hsa_circ_0004085 was identified. Fn infection promoted hsa_circ_0004085 formation by hnRNP L and packaged hsa_circ_0004085 into exosomes by hnRNP A1. Exosomes produced by Fn-infected CRC cells transferred hsa_circ_0004085 between cells and delivered oxaliplatin/5-FU resistance to recipient cells by relieving ER stress. Hsa_circ_0004085 enhanced the stability of GRP78 mRNA by binding to RRBP1 and promoted the nuclear translocation of ATF6p50 to relieve ER stress. CONCLUSIONS: Plasma levels of hsa_circ_0004085 are increased in colon cancer patients with intracellular Fn and are associated with a poor response to oxaliplatin/5-FU. Fn infection promoted hsa_circ_0004085 formation by hnRNP L and packaged hsa_circ_0004085 into exosomes by hnRNP A1. Exosomes secreted by Fn-infected CRC cells deliver hsa_circ_0004085 between cells. Hsa_circ_0004085 relieves ER stress in recipient cells by regulating GRP78 and ATF6p50, thereby delivering resistance to oxaliplatin and 5-FU.

Initiation of hnRNPA1 Low-Complexity Domain Condensation Monitored by Dynamic Light Scattering.

Biomolecular condensates (BMCs) exhibit physiological and pathological relevance in biological systems. Both liquid and solid condensates play significant roles in the spatiotemporal regulation and organization of macromolecules and their biological activities. Some pathological solid condensates, such as Lewy Bodies and other fibrillar aggregates, have been hypothesized to originate from liquid condensates. With the prevalence of BMCs having functional and dysfunctional roles, it is imperative to understand the mechanism of biomolecular condensate formation and initiation. Using the low-complexity domain (LCD) of heterogenous ribonuclear protein A1 (hnRNPA1) as our model, we monitored initial assembly events using dynamic light scattering (DLS) while modulating pH and salt conditions to perturb macromolecule and condensate properties. We observed the formation of nanometer-sized BMCs (nano-condensates) distinct from protein monomers and micron-sized condensates. We also observed that conditions that solubilize micron-sized protein condensates do not solubilize nano-condensates, indicating that the balance of forces that stabilize nano-condensates and micron-sized condensates are distinct. These findings provide insight into the forces that drive protein phase separation and potential nucleation structures of macromolecular condensation.

Cross-Effects in Folding and Phase Transitions of hnRNP A1 and C9Orf72 RNA G4 In Vitro.

Abnormal intracellular phase transitions in mutant hnRNP A1 may underlie the development of several neurodegenerative diseases. The risk of these diseases increases upon C9Orf72 repeat expansion and the accumulation of the corresponding G-quadruplex (G4)-forming RNA, but the link between this RNA and the disruption of hnRNP A1 homeostasis has not been fully explored so far. Our aim was to clarify the mutual effects of hnRNP A1 and C9Orf72 G4 in vitro. Using various optical methods and atomic force microscopy, we investigated the influence of the G4 on the formation of cross-beta fibrils by the mutant prion-like domain (PLD) of hnRNP A1 and on the co-separation of the non-mutant protein with a typical SR-rich fragment of a splicing factor (SRSF), which normally drives the assembly of nuclear speckles. The G4 was shown to act in a holdase-like manner, i.e., to restrict the fibrillation of the hnRNP A1 PLD, presumably through interactions with the PLD-flanking RGG motif. These interactions resulted in partial unwinding of the G4, suggesting a helicase-like activity of hnRNP A1 RGG. At the same time, the G4 was shown to disrupt hnRNP A1 co-separation with SRSF, suggesting its possible contribution to pathology through interference with splicing regulation.

hnRNP A1 dysfunction in oligodendrocytes contributes to the pathogenesis of multiple sclerosis.

Oligodendrocyte (OL) damage and death are prominent features of multiple sclerosis (MS) pathology, yet mechanisms contributing to OL loss are incompletely understood. Dysfunctional RNA binding proteins (RBPs), hallmarked by nucleocytoplasmic mislocalization and altered expression, have been shown to result in cell loss in neurologic diseases, including in MS. Since we previously observed that the RBP heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) was dysfunctional in neurons in MS, we hypothesized that it might also contribute to OL pathology in MS and relevant models. We discovered that hnRNP A1 dysfunction is characteristic of OLs in MS brains. These findings were recapitulated in the experimental autoimmune encephalomyelitis (EAE) mouse model of MS, where hnRNP A1 dysfunction was characteristic of OLs, including oligodendrocyte precursor cells and mature OLs in which hnRNP A1 dysfunction correlated with demyelination. We also found that hnRNP A1 dysfunction was induced by IFNγ, indicating that inflammation influences hnRNP A1 function. To fully understand the effects of hnRNP A1 dysfunction on OLs, we performed siRNA knockdown of hnRNP A1, followed by RNA sequencing. RNA sequencing detected over 4000 differentially expressed transcripts revealing alterations to RNA metabolism, cell morphology, and programmed cell death pathways. We confirmed that hnRNP A1 knockdown was detrimental to OLs and induced apoptosis and necroptosis. Together, these data demonstrate a critical role for hnRNP A1 in proper OL functioning and survival and suggest a potential mechanism of OL damage and death in MS that involves hnRNP A1 dysfunction.

The microRNA-195-5p/hnRNP A1 axis contributes to the progression of hepatocellular carcinoma by regulating the migration of cancer cells.

Dysregulation of gene expression is critical for the progression of cancer. The augmented expression of hnRNP A1 in patients with hepatocellular carcinoma (HCC) has been related to its oncogenic functions. However, the underlying mechanisms responsible for upregulation of hnRNP A1 have not been fully elucidated. In the present study, we identified microRNA-195-5p (miR-195-5p), a miRNA downregulated in HCC, as a novel regulator governing hnRNP A1 expression. Notably, our investigations showed an inverse correlation between hnRNP A1 level, which was increased in HCC, and miR-195-5p level, which was decreased. Our findings demonstrated that hnRNP A1 significantly enhanced the migration and invasion of PLC/PRF/5 cells through its association with mRNAs regulating metastasis. MiR-195-5p also interfered with the hnRNP A1-mediated cell migration by targeting hnRNP A1. Our results underscore the significance of the miR-195-5p/hnRNP A1 axis in regulating the migratory potential of cancer cells and its role in promoting HCC by orchestrating cell migration processes.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

HNRNPA1-induced spliceopathy in a transgenic mouse model of myotonic dystrophy.

Studies on myotonic dystrophy type 1 (DM1) have led to the RNA-mediated disease model for hereditary disorders caused by noncoding microsatellite expansions. This model proposes that DM1 disease manifestations are caused by a reversion to fetal RNA processing patterns in adult tissues due to the expression of toxic CUG RNA expansions (CUGexp) leading to decreased muscleblind-like, but increased CUGBP1/ETR3-like factor 1 (CELF1), alternative splicing activities. Here, we test this model in vivo, using the mouse HSALR poly(CUG) model for DM1 and recombinant adeno-associated virus (rAAV)-mediated transduction of specific splicing factors. Surprisingly, systemic overexpression of HNRNPA1, not previously linked to DM1, also shifted DM1-relevant splicing targets to fetal isoforms, resulting in more severe muscle weakness/myopathy as early as 4 to 6 wk posttransduction, whereas rAAV controls were unaffected. Overexpression of HNRNPA1 promotes fetal exon inclusion of representative DM1-relevant splicing targets in differentiated myoblasts, and HITS-CLIP of rAAV-mycHnrnpa1-injected muscle revealed direct interactions of HNRNPA1 with these targets in vivo. Similar to CELF1, HNRNPA1 protein levels decrease during postnatal development, but are elevated in both regenerating mouse muscle and DM1 skeletal muscle. Our studies suggest that CUGexp RNA triggers abnormal expression of multiple nuclear RNA binding proteins, including CELF1 and HNRNPA1, that antagonize MBNL activity to promote fetal splicing patterns.

Role of Heterogeneous Nuclear Ribonucleoproteins in the Cancer-Immune Landscape.

Cancer remains the second leading cause of death, accounting for approximately 20% of all fatalities. Evolving cancer cells and a dysregulated immune system create complex tumor environments that fuel tumor growth, metastasis, and resistance. Over the past decades, significant progress in deciphering cancer cell behavior and recognizing the immune system as a hallmark of tumorigenesis has been achieved. However, the underlying mechanisms controlling the evolving cancer-immune landscape remain mostly unexplored. Heterogeneous nuclear ribonuclear proteins (hnRNP), a highly conserved family of RNA-binding proteins, have vital roles in critical cellular processes, including transcription, post-transcriptional modifications, and translation. Dysregulation of hnRNP is a critical contributor to cancer development and resistance. HnRNP contribute to the diversity of tumor and immune-associated aberrant proteomes by controlling alternative splicing and translation. They can also promote cancer-associated gene expression by regulating transcription factors, binding to DNA directly, or promoting chromatin remodeling. HnRNP are emerging as newly recognized mRNA readers. Here, we review the roles of hnRNP as regulators of the cancer-immune landscape. Dissecting the molecular functions of hnRNP will provide a better understanding of cancer-immune biology and will impact the development of new approaches to control and treat cancer.

Autoimmunity to a ribonucleoprotein drives neuron loss in multiple sclerosis models.

Neurodegeneration, the progressive loss or damage to neurons and axons, underlies permanent disability in multiple sclerosis (MS); yet its mechanisms are incompletely understood. Recent data indicates autoimmunity to several intraneuronal antigens, including the RNA binding protein (RBP) heterogenous nuclear ribonucleoprotein A1 (hnRNP A1), as contributors to neurodegeneration. We previously showed that addition of anti-hnRNP A1 antibodies, which target the same immunodominant domain of MS IgG, to mice with experimental autoimmune encephalomyelitis (EAE) worsened disease and resulted in an exacerbation of hnRNP A1 dysfunction including cytoplasmic mislocalization of hnRNP A1, stress granule (SG) formation and neurodegeneration in the chronic stages of disease. Because this previous study focused on a singular timepoint during EAE, it is unclear whether anti-hnRNP A1 antibody induced hnRNP A1 dysfunction caused neurodegeneration or was result of it. In the present study, we analyzed in vivo and in vitro models of anti-hnRNP A1 antibody-mediated autoimmunity for markers of hnRNP A1 dysfunction and neurodegeneration over a time course to gain a better understanding of the connection between hnRNP A1 dysfunction and neurodegeneration. Anti-hnRNP A1 antibody treatment resulted in increased neuronal hnRNP A1 mislocalization and nuclear depletion temporally followed by altered RNA expression and SG formation, and lastly an increase in necroptotic signalling and neuronal cell death. Treatment with necrostatin-1s inhibited necroptosis and partially rescued anti-hnRNP A1 antibody-mediated neurodegeneration while clathrin knockdown specifically inhibited anti-hnRNP A1 antibody uptake into neurons. This data identifies a novel antibody-mediated mechanism of neurodegeneration, which may be targeted to inhibit neurodegeneration and prevent permanent neurological decline in persons living with MS.

Tau protein liquid-liquid phase separation can initiate tau aggregation.

The transition between soluble intrinsically disordered tau protein and aggregated tau in neurofibrillary tangles in Alzheimer's disease is unknown. Here, we propose that soluble tau species can undergo liquid-liquid phase separation (LLPS) under cellular conditions and that phase-separated tau droplets can serve as an intermediate toward tau aggregate formation. We demonstrate that phosphorylated or mutant aggregation prone recombinant tau undergoes LLPS, as does high molecular weight soluble phospho-tau isolated from human Alzheimer brain. Droplet-like tau can also be observed in neurons and other cells. We found that tau droplets become gel-like in minutes, and over days start to spontaneously form thioflavin-S-positive tau aggregates that are competent of seeding cellular tau aggregation. Since analogous LLPS observations have been made for FUS, hnRNPA1, and TDP43, which aggregate in the context of amyotrophic lateral sclerosis, we suggest that LLPS represents a biophysical process with a role in multiple different neurodegenerative diseases.

Tetracaine hydrochloride induces cell cycle arrest in melanoma by downregulating hnRNPA1.

Recent evidence suggests potential benefits of applying local anesthetics in cancer patients. Specifically, tetracaine has a potent antitumor effect in diverse cancers, including neuroblastoma, breast cancer, and melanoma; however, the underlying molecular mechanisms remain unclear. Here, we reported that tetracaine hydrochloride inhibited the growth of melanoma cells and arrested melanoma cells in the G0/G1 phase. Tetracaine hydrochloride treatment resulted in translocation of hnRNPA1 from the nucleoplasm to the nuclear envelope and reduced the protein stability of hnRNPA1 possibly by disrupting the dynamic balance of ubiquitination and neddylation. Elevated hnRNPA1 upregulated cyclin D1 to promote cell cycle in melanoma. The hnRNPA1 overexpression attenuated the effect of tetracaine hydrochloride on melanoma cell growth suppression and cell cycle arrest. Furthermore, melanoma homograft experiments demonstrated that tetracaine hydrochloride suppressed melanoma growth, while hnRNPA1 overexpression alleviated tetracaine's antitumor effect on melanoma. Taken together, our findings suggest that tetracaine hydrochloride exerts a potent antitumor effect on melanoma both in vitro and in vivo, and the effect involves cell cycle arrest induction via downregulation of hnRNPA1.