Research trends on cancer neuroscience: a bibliometric and visualized analysis.

Background: Recently, cancer neuroscience has become the focus for scientists. Interactions between the nervous system and cancer (both systemic and local) can regulate tumorigenesis, progression, treatment resistance, compromise of anti-cancer immunity, and provocation of tumor-promoting inflammation. We assessed the related research on cancer neuroscience through bibliometric analysis and explored the research status and hotspots from 2020 to 2024. Methods: Publications on cancer neuroscience retrieved from the Web of Science Core Collection. CiteSpace, VOSviewer, and Scimago Graphica were used to analyze and visualize the result. Results: A total of 744 publications were retrieved, with an upward trend in the overall number of articles published over the last 5 years. As it has the highest number of publications (n = 242) and citations (average 13.63 citations per article), the United States holds an absolute voice in the field of cancer neuroscience. The most productive organizations and journals were Shanghai Jiaotong University (n = 24) and Cancers (n = 45), respectively. Monje M (H-index = 53), Hondermarck H (H-index = 42), and Amit M (H-index = 39) were the three researchers who have contributed most to the field. From a global perspective, research hotspots in cancer neuroscience comprise nerve/neuron-tumor cell interactions, crosstalk between the nervous system and other components of the tumor microenvironment (such as immune cells), as well as the impact of tumors and tumor therapies on nervous system function. Conclusion: The United States and European countries are dominating the field of cancer neuroscience, while developing countries such as China are growing rapidly but with limited impact. The next focal point in this field is likely to be neurotrophic factors. Cancer neuroscience is still in its infancy, which means that many of the interactions and mechanisms between the nervous system and cancer are not yet fully understood. Further investigation is necessary to probe the interactions of the nervous system with cancer cell subpopulations and other components of the tumor microenvironment.

Procyanidin B1 Promotes PSMC3-NRF2 Ubiquitination to Induce Ferroptosis in Glioblastoma.

NRF2 signaling is a crucial antioxidant defense mechanism against ferroptosis in tumors, and targeting NRF2 is essential for tumor therapy. However, the effectiveness of NRF2 inhibitors remains unexplored. The active ingredients of traditional Chinese medicine serve as important sources of NRF2 inhibitors. In this study, we established an intracranial glioblastoma (GBM) orthotopic model and observed the effects of procyanidin B1 on tumor growth and ferroptosis. Using protein-small-molecule docking, z-stack assay of laser confocal imaging, surface plasmon resonance assay, immunoprecipitation, mass spectrometry, and western blotting, we detected the binding between procyanidin B1 and NRF2 and the effect of PSMC3 on the ubiquitin-dependent degradation of NRF2 in GBM cells. Our results showed that procyanidin B1 acted as a novel NRF2 inhibitor to suppress GBM cell proliferation and prolonged the survival of GBM-bearing mice; it also mediated the interaction between PSMC3 and NRF2 to promote ubiquitin-dependent protein degradation of NRF2, which induced ferroptosis in GBM cells. In addition, we found that procyanidin B1 enhanced H2O2 accumulation by downregulating NRF2 during ferroptosis in GBM cells. The botanical agent procyanidin B1 induced ferroptosis and exerted anti-tumor effects through PSMC3-mediated ubiquitin-dependent degradation of NRF2 proteins, providing a potential drug candidate for adjuvant therapy in patients with GBM.

Study of LY9 as a potential biomarker for prognosis and prediction of immunotherapy efficacy in lung adenocarcinoma.

Background: Lymphocyte antigen 9 (LY9) participates in the development of several tumors and diseases but has not been reported yet in lung adenocarcinoma (LUAD). Methods: First, we analyzed the expression and prognostic value of LY9 in pan-cancer, including LUAD. Additionally, we conducted a correlation analysis of LY9 expression in LUAD with immune cell infiltration using the TIMER database and the CIBERSORT algorithm, and with immune checkpoints using the GEPIA database. Also, we constructed a potential ceRNA network for LY9. Furthermore, we explored LY9-related pathways by Gene Set Enrichment Analysis (GSEA). Finally, validation of differential expression at the mRNA level was obtained from the GEO database. We collected LUAD tissues for Quantitative Real-time PCR (qRT-PCR) to verify the expression of LY9, CD8, and CD4 and calculated the correlation between them. We also conducted immunohistochemistry (IHC) to verify the protein expression of LY9. Results: Results showed that LY9 was highly expressed in various tumors, including LUAD. Besides, patients with high LY9 expression presented longer overall survival (OS) and more multiple lymphocyte infiltrations. The expression of LY9 in LUAD strongly and positively correlates with multiple immune cell infiltration and immune checkpoints. The functional enrichment analysis indicated that LY9 was involved in multiple immune-related pathways and non-small cell lung cancer. Moreover, a ceRNA regulatory network of LINC00943-hsa-miR-141-3p-LY9 might be involved. Finally, GSE68465 dataset confirmed differential expression of LY9 mRNA levels in LUAD and the qRT-PCR results verified LY9 had a strong and positive correlation with CD4 and CD8 T cells. Unfortunately, IHC did not detect the expression of LY9 protein level in tumor tissues and WB experiments validated the protein expression of LY9 in the OCI-AML-2 cell line. Conclusions: Therefore, we hypothesized that LY9 could serve as a potential, novel prognostic biomarker for LUAD and could predict immunotherapy efficacy at the mRNA level.

Metabolic reprogramming-driven homologous recombination and TCA cycle dysregulation contribute to poor prognoses in lung adenocarcinoma.

Increasing evidence has shown that homologous recombination (HR) and metabolic reprogramming are essential for cellular homeostasis. These two processes are independent as well as closely intertwined. Nevertheless, they have rarely been reported in lung adenocarcinoma (LUAD). We analysed the genomic, immune microenvironment and metabolic microenvironment features under different HR activity states. Using cell cycle, EDU and cell invasion assays, we determined the impacts of si-SHFM1 on the LUAD cell cycle, proliferation and invasion. The levels of isocitrate dehydrogenase (IDH) and α-ketoglutarate dehydrogenase (α-KGDH) were determined by ELISA in the NC and si-SHFM1 groups of A549 cells. Finally, cell samples were used to extract metabolites for HPIC-MS/MS to analyse central carbon metabolism. We found that high HR activity was associated with a poor prognosis in LUAD, and HR was an independent prognostic factor for TCGA-LUAD patients. Moreover, LUAD samples with a high HR activity presented low immune infiltration levels, a high degree of genomic instability, a good response status to immune checkpoint blockade therapy and a high degree of drug sensitivity. The si-SHFM1 group presented a significantly higher proportion of cells in the G0/G1 phase, lower levels of DNA replication, and significantly lower levels of cell migration and both TCA enzymes. Our current results indicated that there is a strong correlation between HR and the TCA cycle in LUAD. The TCA cycle can promote SHFM1-mediated HR in LUAD, raising their activities, which can finally result in a poor prognosis and impair immunotherapeutic efficacy.

Resection of the entire first rib for giant osteochondroma by trans manubrial approach: a case report and review of the literature.

BACKGROUND: First rib tumors are extremely rare. Its compression of neurovascularity can easily lead to severe complications such as thoracic outlet syndrome, so early surgical resection is crucial. However, there is no standardized approach to surgery. CASE PRESENTATION: A previously healthy 18-year-old Chinese male undergoes a chest computed tomography (CT) scan that incidentally reveals a raised calcified mass on the right first rib, which is most likely an osteochondroma when combined with magnetic resonance imaging (MRI). We achieved excellent results with resection and thoracic reconstruction by adopting an inverse L-shaped incision in the anterior chest and a longitudinal split of the sternum. CONCLUSIONS: Our practice provides great reference for the surgical management of first rib tumors.

ScRNA-seq reveals novel immune-suppressive T cells and investigates CMV-TCR-T cells cytotoxicity against GBM.

BACKGROUND: Glioblastoma (GBM) is a fatal primary brain malignancy in adults. Previous studies have shown that cytomegalovirus (CMV) is a risk factor for tumorigenesis and aggressiveness for glioblastoma. However, little is known about how CMV infection affects immune cells in the tumor microenvironment of GBM. Furthermore, there has been almost no engineered T-cell receptor (TCR)-T targeting CMV for GBM research to date. METHODS: We evaluated the CMV infection status of patients with GBM's tumor tissue by immune electron microscopy, immunofluorescence, and droplet digital PCR. We performed single-cell RNA sequencing for CMV-infected GBM to investigate the effects of CMV on the GBM immune microenvironment. CellChat was applied to analyze the interaction between cells in the GBM tumor microenvironment. Additionally, we conducted single-cell TCR/B cell receptor (BCR) sequencing and Grouping of Lymphocyte Interactions with Paratope Hotspots 2 algorithms to acquire specific CMV-TCR sequences. Genetic engineering was used to introduce CMV-TCR into primary T cells derived from patients with CMV-infected GBM. Flow cytometry was used to measure the proportion and cytotoxicity status of T cells in vitro. RESULTS: We identified two novel immune cell subpopulations in CMV-infected GBM, which were bipositive CD68+SOX2+ tumor-associated macrophages and FXYD6+ T cells. We highlighted that the interaction between bipositive TAMs or cancer cells and T cells was predominantly focused on FXYD6+ T cells rather than regulatory T cells (Tregs), whereas, FXYD6+ T cells were further identified as a group of novel immunosuppressive T cells. CMV-TCR-T cells showed significant therapeutic effects on the human-derived orthotopic GBM mice model. CONCLUSIONS: These findings provided an insight into the underlying mechanism of CMV infection promoting the GBM immunosuppression, and provided a novel potential immunotherapy strategy for patients with GBM.

Global research trends on innate lymphoid cells in the brain, gut and lung field: a bibliometric and visualized analysis.

Background: ILCs play important roles in the brain, gut, and lungs. Researchers are attempting to establish a research framework on the brain-gut-lung axis using ILCs. However, no one has yet conducted a bibliometric analysis to summarize the findings. In this study, we utilized bibliometrics to analyze the emerging trends and focal areas of ILCs in the brain, intestine, and lung. We aim to provide references for future research on the brain-gut-lung axis. Methods: To conduct a comprehensive bibliometric analysis on ILCs in the fields of brain, intestine, and lung, we utilized software such as HistCite, VOSviewer, and CiteSpace. Our analysis focused on various aspects, including the number of publications, countries, authors, journals, co-cited documents, and keywords. This approach allowed us to gain valuable insights into the research landscape surrounding ILCs in these specific fields. Results: A total of 8411 articles or reviews on ILCs in the fields of brain, intestine, and lung were included. The number of published articles has shown a consistent upward trend since 2003. A total of 45279 authors from 99 countries have contributed to these articles. The United States has the highest number of publications (n=3044) and the most cited articles (TGCS=210776). The top three published authors in this field are David Artis, Marco Colonna and Andrew NJ McKenzie. The journal Immunity is the most authoritative choice for researchers. The main research focuses in this field include NK cell, ILC2, tumor immunity, multiple sclerosis, inflammatory bowel disease, airway inflammation, RORγT, and immunotherapy. In recent years, cancer and tumor microenvironment have emerged as hot keywords, particularly immunotherapy, PD-1 related directions, indicating a potential shift in research focus. Conclusion: European and American countries have been pivotal in conducting research on ILCs, while China has produced a significant number of publications, its impact is still limited. Tumors are likely to emerge as the next focal points in this field. The connection and regulation between the brain and the lung are not yet fully understood, and further investigation is necessary to explore the role of ILCs in the brain-lung axis.

Construction of a cleavable linker chemistry-based HBEXO-Chip to isolate circulating exosomes for breast cancer diagnosis.

Breast cancer is presently the most common form of malignant tumour globally, and its precise diagnosis is vital for enhancing patient survival rates and their quality of life. Exosomes, which are small extracellular vesicles containing proteins and nucleic acid molecules, have emerged as ideal cancer markers for liquid biopsy-based diagnostics. Nevertheless, the current methods for isolating exosomes present challenges for clinical implementation. Although immunoaffinity-based microfluidics hold potential for exosome-based cancer diagnostics, existing microfluidic chips struggle to capture and release intact, high-purity, and highly specific exosomes effectively. To surmount these obstacles, we developed the HBEXO-Chip, an innovative immunoaffinity microfluidic device that employs cleavable linker chemistry technology. This chip enables rapid isolation and detection of breast cancer-derived exosomes in peripheral blood. The fishbone-like microfluidic chip design of the HBEXO-Chip heightens the binding likelihood between specific exosomes and antibodies, significantly augmenting capture efficiency. Furthermore, the gentle reaction conditions of the cleavable linker chemistry retain the exosomes' membrane structure's integrity during the release process, which is advantageous for downstream experimental analysis. Our study demonstrated the effectiveness of the HBEXO-Chip in distinguishing breast cancer patients, patients with benign breast tumours, and healthy controls. By quantitatively analysing Epcam+ exosomes in clinical plasma samples, this technology platform provides a quick, user-friendly, highly sensitive, and specific assay for detecting tumour exosomes in peripheral blood, making it a valuable liquid biopsy tool for clinicians to diagnose breast cancer.

Construction of 11 metabolic-related lncRNAs to predict the prognosis in lung adenocarcinoma.

OBJECTIVE: To explore the metabolism-related lncRNAs in the tumorigenesis of lung adenocarcinoma. METHODS: The transcriptome data and clinical information about lung adenocarcinoma patients were acquired in TCGA (The Cancer Genome Atlas). Metabolism-related genes were from the GSEA (Gene Set Enrichment Analysis) database. Through differential expression analysis and Pearson correlation analysis, lncRNAs about lung adenocarcinoma metabolism were identified. The samples were separated into the training and validation sets in the proportion of 2:1. The prognostic lncRNAs were determined by univariate Cox regression analysis and LASSO (Least absolute shrinkage and selection operator) regression. A risk model was built using Multivariate Cox regression analysis, evaluated by the internal validation data. The model prediction ability was assessed by subgroup analysis. The Nomogram was constructed by combining clinical indicators with independent prognostic significance and risk scores. C-index, calibration curve, DCA (Decision Curve Analysis) clinical decision and ROC (Receiver Operating Characteristic Curve) curves were obtained to assess the prediction ability of the model. Based on the CIBERSORT analysis, the correlation between lncRNAs and tumor infiltrating lymphocytes was obtained. RESULTS: From 497 lung adenocarcinoma and 54 paracancerous samples, 233 metabolic-related and 11 prognostic-related lncRNAs were further screened. According to the findings of the survival study, the low-risk group had a greater OS (Overall survival) than the high-risk group. ROC analysis indicated AUC (Area Under Curve) value was 0.726. Then, a nomogram with T, N stage and risk ratings was developed according to COX regression analysis. The C-index was 0.743, and the AUC values of 3- and 5-year survival were 0.741 and 0.775, respectively. The above results suggested the nomogram had a good prediction ability. The results based on the CIBERSORT algorithm demonstrated the lncRNAs used to construct the model had a strong correlation with the polarization of immune cells. CONCLUSIONS: The study identified 11 metabolic-related lncRNAs for lung adenocarcinoma prognosis, on which basis a prognostic risk scoring model was created. This model may have a good predictive potential for lung adenocarcinoma.

TAGAP expression influences CD4+ T cell differentiation, immune infiltration, and cytotoxicity in LUAD through the STAT pathway: implications for immunotherapy.

Background: T-cell Activation GTPase Activating Protein (TAGAP) plays a role in immune cell regulation. This study aimed to investigate TAGAP's expression and its potential impact on CD4+ T cell function and prognosis in lung adenocarcinoma (LUAD). Methods: We analyzed TAGAP expression and its correlation with immune infiltration and clinical data in LUAD patients using multiple datasets, including The Cancer Genome Atlas (TCGA-LUAD), Gene Expression Omnibus (GEO), and scRNA-seq datasets. In vitro and in vivo experiments were conducted to explore the role of TAGAP in CD4+ T cell function, chemotaxis, and cytotoxicity. Results: TAGAP expression was significantly lower in LUAD tissues compared to normal tissues, and high TAGAP expression correlated with better prognosis in LUAD patients. TAGAP was positively correlated with immune/stromal/ESTIMATE scores and immune cell infiltration in LUAD. Single-cell RNA sequencing revealed that TAGAP was primarily distributed in CD4+/CD8+ T cells. In vitro experiments showed that TAGAP overexpression enhanced CD4+ T cell cytotoxicity, proliferation, and chemotaxis. Gene Set Enrichment Analysis (GSEA) indicated that TAGAP was enriched in the JAK-STAT signaling pathway. In vivo experiments in a xenograft tumor model demonstrated that TAGAP overexpression suppressed tumor growth and promoted CD4+ T cell cytotoxicity. Conclusions: TAGAP influences CD4+ T cell differentiation and function in LUAD through the STAT pathway, promoting immune infiltration and cytotoxicity. This study provides a scientific basis for developing novel LUAD immunotherapy strategies and exploring new therapeutic targets.

Identification and validation of a novel prognostic model for gastric cancer based on m7G-related genes.

Background: The role of N7-methyladenosine (m7G)-related genes in the progression and prognosis of gastric cancer (GC) remains unclear. This study aimed to explore prognostic biomarkers for GC based on m7G methylation regulators and to construct a prognostic risk model. Methods: RNA sequencing profiles with corresponding clinicopathological information associated with GC of which the histological type was stomach adenocarcinoma (STAD) were obtained from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO), respectively. A total of 29 m7G regulators were extracted from previous studies. According to the expression similarity of m7G regulators, the GC samples obtained from TCGA were further classified into 2 clusters demonstrating different overall survival (OS) rates and genetic heterogeneity, and the differentially expressed genes (DEGs) between these 2 clusters were defined as m7G-related genes. Univariate regression analysis and regression analysis were then used to obtain the prognostic m7G-related genes. The samples in TCGA and Genotype-Tissue Expression (GTEx) were used to verify the differential expression and prognostic value of these m7G-related genes contained in the prognostic model. Subsequently, the risk score was combined with other prognostic factors to develop a nomogram. The predictive ability of the nomogram was evaluated by the standard receiver operating characteristic (ROC) curve. Gene set enrichment analysis (GSEA) was used to identify activation pathways in both groups. Finally, the association between the prognostic model and the immune characteristics of GC were appraised. Results: A prognostic model consisting of 11 m7G-related genes was constructed. GC patients in the high-risk group were shown to have a poor prognosis and this result was further demonstrated in each group. The risk model can be applied for patients with different clinical features. The results of GSEA showed that cell adhesion, cell junction, and focal adhesion were highly enriched in the high-risk group. In addition, we found that the expression of programmed cell death ligand 1 (PD-L1) was significantly elevated in the low-risk group, whereas programmed cell death ligand 2 (PD-L2) and tumor necrosis factor receptor superfamily member 4 (TNFRSF4) were overexpressed in the high-risk group. Conclusions: We successfully built and verified a m7G relevant prognostic model for predicting prognosis and providing a new train of thought for improving the treatment of GC.

Membrane-bound transcription factor LRRC4 inhibits glioblastoma cell motility.

Membrane-bound transcription factors (MTFs) have been observed in many types of organisms, such as plants, animals and microorganisms. However, the routes of MTF nuclear translocation are not well understood. Here, we reported that LRRC4 is a novel MTF that translocates to the nucleus as a full-length protein via endoplasmic reticulum-Golgi transport, which is different from the previously described nuclear entry mechanism. A ChIP-seq assay showed that LRRC4 target genes were mainly involved in cell motility. We confirmed that LRRC4 bound to the enhancer element of the RAP1GAP gene to activate its transcription and inhibited glioblastoma cell movement by affecting cell contraction and polarization. Furthermore, atomic force microscopy (AFM) confirmed that LRRC4 or RAP1GAP altered cellular biophysical properties, such as the surface morphology, adhesion force and cell stiffness. Thus, we propose that LRRC4 is an MTF with a novel route of nuclear translocation. Our observations demonstrate that LRRC4-null glioblastoma led to disordered RAP1GAP gene expression, which increased cellular movement. Re-expression of LRRC4 enabled it to suppress tumors, and this is a potential for targeted treatment in glioblastoma.

A new prediction model of hepatocellular carcinoma based on N7-methylguanosine modification.

PURPOSE: Hepatocellular carcinoma (HCC) is a kind of primary liver cancer. It is a common malignant tumor of digestive system that is difficult to predict the prognosis of patients. As an important epigenetic modification, N7 methyl guanosine (m7G) is indispensable in gene regulation. This regulation may affect the development and occurrence of cancer. However, the prognosis of long non coding RNAs (lncRNAs) in HCC is limited, especially how m7G-related lncRNAs regulate the development of HCC has not been reported. METHODS: The Cancer Genome Atlas (TCGA) provides us with the expression data and corresponding clinical information of HCC patients we need. We used a series of statistical methods to screen four kinds of m7G-related lncRNAs related to HCC prognosis and through a series of verifications, the results were in line with our expectations. Finally, we also explored the IC50 difference and correlation analysis of various common chemotherapy drugs. RESULT: Our study identified four differentially expressed m7g-related lncRNAs associated with HCC prognosis. Survival curve analysis showed that high risk lncRNAs would lead to poor prognosis of HCC patients. M7G signature's AUC was 0.789, which shows that the prognosis model we studied has certain significance in predicting the prognosis of HCC patients. Moreover, our study found that different risk groups have different immune and tumor related pathways through gene set enrichment analysis. In addition, many immune cell functions are significantly different among different risk groups, such as T cell functions, including coordination of type I INF response and coordination of type II INF response. The expression of PDCD1, HHLA2, CTLA-4 and many other immune checkpoints in different risk groups is also different. Additionally, we analyzed the differences of IC50 and risk correlation of 15 chemotherapeutic drugs among different risk groups. CONCLUSION: A novel lncRNAs associated with m7G predicts the prognosis of HCC.

Leucine-rich repeats containing 4 protein (LRRC4) in memory, psychoneurosis, and glioblastoma.

ABSTRACT: Leucine-rich repeats containing 4 ( LRRC4 , also named netrin-G ligand 2 [NGL-2]) is a member of the NetrinGs ligands (NGLs) family. As a gene with relatively high and specific expression in brain, it is a member of the leucine-rich repeat superfamily and has been proven to be a suppressor gene for gliomas, thus being involved in gliomagenesis. LRRC4 is the core of microRNA-dependent multi-phase regulatory loops that inhibit the proliferation and invasion of glioblastoma (GB) cells, including LRRC4/NGL2-activator protein 2 (AP2)-microRNA (miR) 182-LRRC4 and LRRC4-miR185-DNA methyltransferase 1 (DNMT1)-LRRC4/specific protein 1 (SP1)-DNMT1-LRRC4. In this review, we demonstrated LRRC4 as a new member of the partitioning-defective protein (PAR) polarity complex that promotes axon differentiation, mediates the formation and plasticity of synapses, and assists information input to the hippocampus and storage of memory. As an important synapse regulator, aberrant expression of LRRC4 has been detected in autism, spinal injury and GBs. LRRC4 is a candidate susceptibility gene for autism and a neuro-protective factor in spinal nerve damage. In GBs, LRRC4 is a novel inhibitor of autophagy, and an inhibitor of protein-protein interactions involving in temozolomide resistance, tumor immune microenvironment, and formation of circular RNA.

A novel gene signature derived from the CXC subfamily of chemokine receptors predicts the prognosis and immune infiltration of patients with lung adenocarcinoma.

The highly malignant nature of lung adenocarcinoma (LUAD) makes its early diagnosis and prognostic assessment particularly important. However, whether the CXC subfamily of chemokine receptors (CXCR) is involved in the development and prognosis of LUAD remains unclear. Here, differentially expressed genes (DEGs) associated with overall survival (OS) were selected from the cancer genome atlas (TCGA) dataset using univariate Cox analysis and least absolute shrinkage and selection operator (LASSO) regression analysis. Then, a prognostic gene signature was constructed, which was evaluated using Kaplan-Meier curves, receiver operating characteristics curves, nomogram curves, and an external gene expression omnibus (GEO) dataset. Finally, we verified the functions of the genes comprising the signature using the gene expression profiling interactive analysis (GEPIA) and the immune system interaction database (TISIDB) web portals. We constructed a 7-gene signature (SHC1, PRKCD, VEGFC, RPS6KA1, CAT, CDC25C, and GPI) that stratified patients into high- and low-risk categories. Notably, the risk score of the signature was a separate and effective predictor for OS (P < .001). Patients in the low-risk category had a better prognosis than those in the high-risk category. The receiver operating characteristics and nomogram curves verified the predictive power of the signature. Moreover, in both categories, biological processes and pathways associated with cell migration were enriched. Immune infiltration statuses differed between the 2 risk categories. Critically, the results from the GEPIA and TISIDB web portals indicated that the expression of the 7-gene signature was associated with survival, clinical stage, and immune subtypes of LUAD patients. We identified a CXCR-related gene signature that could assess prognosis and provide a reference for the diagnosis and treatment of LUAD.

Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing.

Background: The precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA. Methods: Genomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA. Results: In 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup). Conclusions: These pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Characterizing the landscape of cervical squamous cell carcinoma immune microenvironment by integrating the single-cell transcriptomics and RNA-Seq.

BACKGROUND: Cervical squamous cell carcinoma (CSCC), caused by the infection of high-risk human papillomavirus, is one of the most common malignancies in women worldwide. METHODS: RNA expression data, including those from the Cancer Genome Atlas, Gene Expression Omnibus, and Genotype-Tissue Expression databases, were used to identify the expression of RNAs in normal and tumor tissue. Correlation analysis was performed to identify the immune-related long noncoding RNAs (IRLs) and hypoxia-related genes (IRHs) that can influence the activity of the immune system. Prognosis models of immune-related RNAs (IRRs) were used to construct a coexpression network of the immune system. We identified the role of IRRs in immunotherapy by correlation analysis with immune checkpoint genes (ICGs). We then validated the expression data by integrating two single-cell sequencing data sets of CSCC to identify the key immune features. RESULTS: In total, six immune-related gene (IRG), four IRL, and five IRH signatures that can significantly influence the characteristics of the tumor immune microenvironment (TIME) were selected using machine learning methods. The expression level of ICGs was significantly upregulated in GZMB+ CD8+ T-cells and tumor-associated macrophages (TAMs) in tumor tissues. TGFBI+ TAMs are a kind of blood-derived monocyte-derived M0-like TAM linked to hypoxia and a poor prognosis. IFI30+ M1-like TAMs participate in the process of immune-regulation and showed a role in the promotion of CD8+ T-cells and Type 1 T helper (Th1)/Th2 cells in the coexpression network, together with several IRLs, IRGs, and ICGs. CONCLUSIONS: CD16+ monocyte-derived IFI30+ TAMs participated in our coexpression network to regulate the TIME, showing the potential to be a novel immunotherapy target. The enrichment of M0-like TAMs was associated with a worse prognosis in the high-risk score group with IRH signatures. Remarkably, M0-like TAMs in tumor tissues overexpressed TGFBI and were associated with several well-known tumor-proliferation pathways.

ALDH1B1 predicts poor survival for locally advanced nasopharyngeal carcinoma patients.

Background: Distant metastasis and local recurrence remain the major reasons of treatment failure in locally advanced nasopharyngeal carcinoma (NPC). Therefore, exploring novel biomarkers for prognosis and sensitivity of radiotherapy in locally advanced NPC is crucial. This retrospective study evaluates the expression and prognostic value of aldehyde dehydrogenase 1B1 (ALDH1B1) for locally advanced NPC patients. Methods: Sixty-seven locally advanced NPC patients and 22 chronic nasopharyngitis patients between September 2012 to November 2016 at The First Affiliated Hospital of University of South China were enrolled in this study. The expression of ALDH1B1 in tumor tissues were detected by using immunohistochemistry (IHC). Results: Significant difference was observed between NPC groups and Pharyngitis tissues groups, and NPC groups has a higher ratio of high ALDH1B1 expression. ALDH1B1 expression were significantly associated with age and radiotherapy response. The Kaplan-Meier analysis indicated that patients with high ALDH1B1 expression had a poor prognosis both in overall survival (OS) and progression-free survival (PFS). Univariate analysis found that age, radiotherapy response and ALDH1B1 expression were correlated with OS. Besides, factors affecting PFS are radiotherapy response and ALDH1B1 expression. Multivariate analysis revealed that radiotherapy response and ALDH1B1 expression were the independent prognostic factors for OS, whereas radiotherapy response was for PFS. Conclusions: The expression of ALDH1B1 was correlated with age and radiotherapy response. Patients with high ALDH1B1 expression show a poor prognosis both in OS and DFS. ALDH1B1 expression were the independent prognostic factors for OS.

Pathological images for personal medicine in Hepatocellular carcinoma: Cross-talk of gene sequencing and pathological images.

Background: Considering the great heterogeneity of Hepatocellular carcinoma (HCC), more accurate prognostic models are urgently needed. This paper combined the advantages of genomics and pathomics to construct a prognostic model. Methods: First, we collected data from hepatocellular carcinoma patients with complete mRNA expression profiles and clinical annotations from the TCGA database. Then, based on immune-related genes, we used random forest plots to screen prognosis-related genes and build prognostic models. Bioinformatics was used to identify biological pathways, evaluate the tumor microenvironment, and perform drug susceptibility testing. Finally, we divided the patients into different subgroups according to the gene model algorithm. Pathological models were constructed by obtaining HE-stained sections from TCGA in corresponding subgroups of patients. Results: In this study, we constructed a stable prognostic model that could predict overall survival in HCC patients. The signature consisted of six immune-related genes (BX537318.1, TMEM147, CSPG4P12, AC015908.3, CEBPZOS, and SRD5A3). We found increased levels of infiltration of immune cells in the tumor microenvironment in patients with low risk scores, indicating significant antitumor immunity and corresponding to better clinical outcomes. We then screened nine drugs that were more sensitive in the low-risk group than in the high-risk group. Finally, we addressed the complex cellular changes and phenotypic heterogeneity in the HCC microenvironment by combining genomics and pathomics analysis methods. Conclusion: Our study showed that the prognostic evaluation model of HCC based on the immune signaling pathway is feasible and provided a reference value for potential immunotherapy for HCC.