RESUMEN
OBJECTIVE: This study aims to clarify the mechanical action of cyclin-dependent protein kinase 1 (CDK1) in the development of endometrial carcinoma (EMCA), which may be associated with the phosphorylation of kinesin family member C1 (KIFC1) and further activate the PI3K/AKT pathway. METHODS: The protein and gene expression of CDK1 in EMCA tissues and tumor cell lines were evaluated by western blot, quantitative polymerase chain reaction, and immunohistochemistry staining. Next, Cell Counting Kit-8 and colony formation assay detected cell survival and proliferation. Cell migration and invasion were measured by Transwell assay. Cell apoptosis and cell cycle were tested by flow cytometry. Immunofluorescence staining of γH2AX was used to evaluate DNA damage, respectively. Subsequently, a co-immunoprecipitation assay was used to detect the interaction between CDK1 and KIFC1. The phosphorylated protein of KIFC1 and PI3K/AKT was detected by western blot. Finally, the effect of CDK1 on the tumor formation of EMCA was evaluated in a nude mouse xenograft model. RESULTS: CDK1 was highly expressed in EMCA tumor cell lines and tissues, which contributed to cell survival, proliferation, invasion, and migration, inhibited cell apoptosis, and induced DNA damage of EMCA cells dependent on the phosphorylation of KIFC1. Moreover, the CDK1-KIFC1 axis further activated PI3K/AKT pathway. Finally, CDK1 knockdown repressed tumor formation of EMCA in vivo. CONCLUSION: We report that increased CDK1 promotes tumor progression and identified it as a potential prognostic marker and therapeutic target of EMCA.
RESUMEN
B cell-targeted cancer vaccines are receiving increasing attention in immunotherapy due to the combined antibody-secreting and antigen-presenting functions. In this study, we propose a natural IgM-hitchhiking delivery strategy to co-deliver tumor antigens and adjuvants to splenic marginal zone B (MZB) cells. We constructed nanovaccines (FA-sLip/OVA/MPLA) consisting of classical folic acid (FA)-conjugated liposomes co-loaded with ovalbumin (OVA) and toll-like receptor 4 agonists, MPLA. We found that natural IgM absorption could be manipulated at the bio-nano interface on FA-sLip/OVA/MPLA, enabling targeted delivery to splenic MZB cells. Systemic administration of FA-sLip/OVA/MPLA effectively activated splenic MZB cells via IgM-mediated multiplex pathways, eliciting antigen-specific humoral and cytotoxic T lymphocyte responses, and ultimately retarding E.G7-OVA tumor growth. In addition, combining FA-sLip/OVA/MPLA immunization with anti-PD-1 treatments showed improved antitumor efficiency. Overall, this natural IgM-hitchhiking delivery strategy holds great promise for efficient, splenic MZB cell-targeted delivery of cancer vaccines in future applications.
Asunto(s)
Vacunas contra el Cáncer , Neoplasias , Humanos , Animales , Ratones , Nanovacunas , Neoplasias/terapia , Antígenos de Neoplasias , Ovalbúmina , Inmunoglobulina M , Ratones Endogámicos C57BLRESUMEN
PURPOSE: To evaluate the feasibility of single-site laparoscopic orchiopexy for palpable undescended testes in children. METHODS: We prospectively studied patients with undescended testes between July 2021 and June 2022. In total, 223 patients were included in our study: 105 underwent single-site laparoscopic orchiopexy and 118 underwent conventional laparoscopic orchiopexy. During single-site laparoscopic orchiopexy, 3 ports were inserted within the umbilicus. RESULTS: No differences were observed between the groups in terms of age and laterality. For unilateral undescended testes, the operating time was longer in the single site group than in the conventional group at the early stages (55.31 ± 12.04 min vs. 48.14 ± 14.39 min, P = 0.007), but it was similar to the conventional group at the later stages (48.82 ± 13.49 min vs. 48.14 ± 14.39 min, P = 0.78). Testicular ascent occurred in one patient from each group. There was no significant difference in the success rate between the single-site group and the conventional group (99.0% vs. 99.2%, P = 0.93). In the single-site group, no visible abdominal scarring was observed, while in the conventional group, there were two noticeable scars on the abdomen. CONCLUSION: Single-site laparoscopic orchiopexy offers superior cosmetic results and comparable success rates compared to conventional laparoscopic orchiopexy for palpable undescended testes.
Asunto(s)
Cavidad Abdominal , Criptorquidismo , Laparoscopía , Niño , Masculino , Humanos , Lactante , Criptorquidismo/cirugía , Orquidopexia/métodos , Testículo/cirugía , Estudios Prospectivos , Laparoscopía/métodos , Resultado del TratamientoRESUMEN
Chemotherapy combining with surgical treatment has been the main strategy for osteosarcoma treatment in clinical. Due to unclear pathogenesis and unidentified drug targets, significant progress has not been made in the development of targeted drugs for osteosarcoma during the past 50 years. Our previous discovery reported compound R-8i with a high potency for the treatment of osteosarcoma by phenotypic screening. However, both the metabolic stability and bioavailability of R-8i are poor (T1/2 = 5.36 min, mouse liver microsome; and bioavailability in vivo F = 52.1 %, intraperitoneal administration) which limits it use for further drug development. Here, we described an extensive structure-activity relationship study of thiazolidine-4-one sulfone inhibitors from R-8i, which led to the discovery of compound 68. Compound 68 had a potent cellular activity with an IC50 value of 0.217 µM, much higher half-life (T1/2 = 73.8 min, mouse liver microsome) and an excellent pharmacokinetic profile (in vivo bioavailability F = 115 %, intraperitoneal administration). Compound 68 also showed good antitumor effects and low toxicity in a xenograft model (44.6 % inhibition osteosarcoma growth in BALB/c mice). These results suggest that compound 68 is a potential drug candidate for the treatment of osteosarcoma.
Asunto(s)
Antineoplásicos , Neoplasias Óseas , Osteosarcoma , Humanos , Ratones , Animales , Preparaciones Farmacéuticas , Relación Estructura-Actividad , Osteosarcoma/tratamiento farmacológico , Osteosarcoma/patología , Neoplasias Óseas/tratamiento farmacológico , Proliferación Celular , Antineoplásicos/farmacología , Antineoplásicos/uso terapéutico , Ensayos Antitumor por Modelo de Xenoinjerto , Línea Celular TumoralRESUMEN
Ovarian cancer is the leading cause of death from gynecologic illnesses worldwide. High-grade serous ovarian cancer (HGSOC) is a gynecological tumor that accounts for roughly 70% of ovarian cancer deaths in women. Runt-related transcription factor 1(RUNX1) proteins were identified with overexpression in the HGSOC. However, the roles of RUNX1 in the development of HGSOC are poorly understood. In this study, combined with whole-transcriptome analysis and multiple research methods, RUNX1 was identified as vital in developing HGSOC. RUNX1 knockdown inhibits the physiological function of ovarian cancer cells and regulates apoptosis through the FOXO1-Bcl2 axis. Down-regulated RUNX1 impairs EMT function through the EGFR-AKT-STAT3 axis signaling. In addition, RUNX1 knockdown can significantly increase the sensitivity to clinical drug therapy for ovarian cancer. It is strongly suggested that RUNX1 work as a potential diagnostic and therapeutic target for HGSOC patients with better prognoses and treatment options. It is possible to generate novel potential targeted therapy strategies and translational applications for serous ovarian carcinoma patients with better clinical outcomes.
Asunto(s)
Subunidad alfa 2 del Factor de Unión al Sitio Principal , Neoplasias Ováricas , Humanos , Femenino , Subunidad alfa 2 del Factor de Unión al Sitio Principal/genética , Subunidad alfa 2 del Factor de Unión al Sitio Principal/uso terapéutico , Línea Celular Tumoral , Neoplasias Ováricas/tratamiento farmacológico , Pronóstico , Apoptosis/genéticaRESUMEN
PURPOSE: The expression of MUC5AC, a highly prevalent airway mucin, is regulated by stimulatory factors such as oxidative stress. Ganoderic acid D (GAD) activates mitochondrial deacetylase SIRT3. SIRT3 regulates mitochondrial function through deacetylation of mitochondrial proteins, thereby playing a significant role in alleviating oxidative stress-related diseases. Therefore, this study aimed to investigate the mechanisms and rationale underlying the regulation of MUC5AC expression by GAD. METHODS: Human airway epithelial cells (NCI-H292) were exposed to pyocyanin (PCN) to establish an in vitro cell model of airway mucus hypersecretion. The expression of SIRT3, MUC5AC, and NRF2 pathway proteins in cells was assessed. Cellular mitochondrial morphology and oxidative stress markers were analyzed. C57BL/6 mice were induced with Pseudomonas aeruginosa (PA) to establish an in vivo mouse model of airway mucus hypersecretion. The expression of SIRT3 and MUC5AC in the airways was examined. In addition, the differential expression of target genes in the airway epithelial tissues of patients with chronic obstructive pulmonary disease (COPD) was analyzed using publicly available databases. RESULTS: The results revealed a significant upregulation of MUC5AC expression and a significant downregulation of SIRT3 expression in relation to airway mucus hypersecretion. GAD inhibited the overexpression of MUC5AC in PCN-induced NCI-H292 cells and PA-induced mouse airways by upregulating SIRT3. GAD activated the NRF2/GPX4 pathway and inhibited PCN-induced oxidative stress and mitochondrial morphological changes in NCI-H292 cells. However, ML385 inhibited the regulatory effects of GAD on MUC5AC expression. CONCLUSION: The SIRT3 activator GAD downregulated MUC5AC expression, potentially through activation of the NRF2/GPX4 pathway. Accordingly, GAD may be a potential treatment approach for airway mucus hypersecretions.
Asunto(s)
Mucinas , Sirtuina 3 , Humanos , Ratones , Animales , Mucinas/genética , Mucinas/metabolismo , Sirtuina 3/metabolismo , Factor 2 Relacionado con NF-E2/metabolismo , Ratones Endogámicos C57BL , Moco/metabolismo , Mucina 5AC/genética , Mucina 5AC/metabolismoRESUMEN
Although it is well recognized that mycosporine-like amino acids (MAAs) are ultraviolet (UV) protective agents that can reduce UV damage, the specific biological mechanism of its role in the skin remains unclear. In this study, we investigated the effect of MAAs extracted from Antarctic diatom Phaeodactylum tricornutum ICE-H on UVB-induced skin damage using a mice model. The MAAs components identified by liquid chromatography-tandem mass spectrometry included 4-deoxygadusol, shinorine, and porphyra-334, which were purified using a Supledean Carboxen1000 solid phase extraction column. The antioxidant activities of these MAA compounds were tested in vitro. For UVB-induced skin photodamage in mice, MAAs alleviated skin swelling and epidermal thickening in this study. We detected the content of reactive oxygen species (ROS), malondialdehyde, and collagen in skin tissue. In addition, quantitative real-time polymerase chain reaction was used to detect nuclear factor-κB (NF-κB), tumor necrosis factor α, interleukin-1ß, cyclooxygenase-2, mitogen activated protein kinase (MAPK) family (extracellular signal-regulated kinase, c-Jun amino-terminal kinase, and p38 kinase), and matrix metalloproteinases. The expression of these cytokines and enzymes is related to inflammatory responses and collagen degradation. In comparison to the model group without MAA treatment, the MAA component decreased the concentration of ROS, the degree of oxidative stress in the skin tissue, and the expression of genes involved in the NF-κB and MAPK pathways. In summary, these MAA components extracted from Phaeodactylum tricornutum ICE-H protected against UVB-induced skin damage by inhibiting ROS generation, relieving skin inflammation, and slowing down collagen degradation, suggesting that these MAA components are effective cosmetic candidate molecules for the protection and therapy of UVB damage.
Asunto(s)
Aminoácidos , Diatomeas , Animales , Ratones , Aminoácidos/química , Diatomeas/metabolismo , Especies Reactivas de Oxígeno/metabolismo , FN-kappa B/metabolismo , Regiones Antárticas , Piel/metabolismo , Proteínas Quinasas Activadas por Mitógenos/metabolismo , Colágeno/farmacología , Rayos Ultravioleta/efectos adversosRESUMEN
Background: FAS-associated death structural domain (FADD) proteins are important proteins that regulate apoptosis and are also involved in many nonapoptotic pathways in tumors. However, how dysregulated FADD affects the development of lung adenocarcinoma (LUAD) remains unknown. Method: Transcriptome profiles and corresponding clinical information of LUAD patients were convened from different databases, and the results were validated by qRT-PCR and cell counting kit-8 using LUAD cell lines. Potential associations between FADD and tumor malignancy, the immune microenvironment, genomic stability, and treatment sensitivity in LUAD patients were revealed by systematic bioinformatics analysis. Results: FADD was significantly overexpressed in LUAD, and patients with higher expression levels of FADD had a worse prognosis and more advanced tumor stage. Functional analysis revealed that elevated expression of FADD was associated with cell cycle dysregulation, angiogenesis, and metabolic disturbances. In addition, overexpression of FADD was associated with a higher infiltration of suppressive immune cells. From a single-cell perspective, cells with lower FADD expression are more active in immune-related pathways. FADD was associated with more genomic mutations, especially TP53. Patients with high FADD expression are more likely to benefit from conventional chemotherapy, while those with low FADD expression are more suitable for immunotherapy. Conclusions: Upregulated FADD is associated with worse prognosis, immune exhaustion, and tumor malignancy in LUAD patients. In addition, FADD can be an efficient indicator for assessing sensitivity to chemotherapy and immunotherapy. Therefore, FADD has the potential to serve as a new target for precision medicine and targeted therapy for LUAD.
RESUMEN
Ovarian cancer is the leading cause of gynecological death worldwide, and its poor prognosis and high mortality seriously affect the life of ovarian cancer patients. Runt-related transcription factor 1 (RUNX1) has been widely studied in hematological diseases and plays an important role in the occurrence and development of hematological diseases. In recent years, studies have reported the roles of RUNX1 in solid tumors, including the significantly increased expression of RUNX1 in ovarian cancer. In ovarian cancer, the dysregulation of the RUNX1 signaling pathway has been implicated in tumor progression, metastasis, and response to therapy. At the same time, the decreased expression of RUNX1 in ovarian cancer can significantly improve the sensitivity of clinical chemotherapy and provide theoretical support for the subsequent diagnosis and treatment target of ovarian cancer, providing prognosis and treatment options to patients with ovarian cancer. However, the role of RUNX1 in ovarian cancer remains unclear. Therefore, this article reviews the relationship between RUNX1 and the occurrence and development of ovarian cancer, as well as the closely regulated signaling pathways, to provide some inspiration and theoretical support for future research on RUNX1 in ovarian cancer and other diseases.
RESUMEN
BACKGROUND: High-grade squamous intraepithelial lesion (HSIL) is a disease that is closely related to the development of cervical cancer. In clinical work, cold knife conization and a loop electrosurgical excision procedure (LEEP) are often selected for diagnosis and treatment. OBJECTIVE: In this paper, we aimed to discuss additional cuts, a common practice in cervical conization, and determine whether the doctor's choice to use additional cuts in conization can reduce the occurrence of a positive cone margin. METHODS: From January 2018 to October 2019, 965 patients underwent cervical conization at the First Affiliated Hospital of Dalian Medical University (Dalian, China). Of these, 174 were in the positive cone margin group, and 791 were in the negative cone margin group. Age, preoperative pathology, pathological results of conization, additional cuts, cone depth, and cone volume were studied. Additionally, the additional cut rate and the efficiency of doctors with a habit of additional cuts were analyzed. RESULTS: Of the 965 patients included in the study, the median age was 41 years (range 35-50). Multivariable logistic regression analysis suggested that additional cuts (OR, 2.480; 95% CI 1.608 to 3.826; p = 0.01) and smaller cone depth (OR, 0.591; 95% CI, 0.362 to 0.965, p = 0.036) were independent risk factors for positive margins. Six of the 64 doctors who performed conizations had a habit of making additional cuts, and there was no positive correlation between their additional cut rate and their effective additional cut rate. CONCLUSION: This study showed that a certain proportion of additional cuts can be effectively excised from the positive margin that cannot be removed in the initial conization. The practice of additional cuts in conization tends to be the personal habit of a small number of doctors.
Asunto(s)
Carcinoma in Situ , Carcinoma de Células Escamosas , Humanos , Adulto , Persona de Mediana Edad , Conización , China , HospitalesRESUMEN
Introduction: Hepatocellular carcinoma (HCC) is a common malignant cancer with a poor prognosis. Cuproptosis and associated lncRNAs are connected with cancer progression. However, the information on the prognostic value of cuproptosis-related lncRNAs is still limited in HCC. Methods: We isolated the transcriptome and clinical information of HCC from TCGA and ICGC databases. Ten cuproptosis-related genes were obtained and related lncRNAs were correlated by Pearson's correlation. By performing lasso regression, we created a cuproptosis-related lncRNA prognostic model based on the cuproptosis-related lncRNA score (CLS). Comprehensive analyses were performed, including the fields of function, immunity, mutation and clinical application, by various R packages. Results: Ten cuproptosis-related genes were selected, and 13 correlated prognostic lncRNAs were collected for model construction. CLS was positively or negatively correlated with cancer-related pathways. In addition, cell cycle and immune related pathways were enriched. By performing tumor microenvironment (TME) analysis, we determined that T-cells were activated. High CLS had more tumor characteristics and may lead to higher invasiveness and treatment resistance. Three genes (TP53, CSMD1 and RB1) were found in high CLS samples with more mutational frequency. More amplification and deletion were detected in high CLS samples. In clinical application, a CLS-based nomogram was constructed. 5-Fluorouracil, gemcitabine and doxorubicin had better sensitivity in patients with high CLS. However, patients with low CLS had better immunotherapeutic sensitivity. Conclusion: We created a prognostic CLS signature by machine learning, and we comprehensively analyzed the signature in the fields of function, immunity, mutation and clinical application.
Asunto(s)
Apoptosis , Carcinoma Hepatocelular , Neoplasias Hepáticas , ARN Largo no Codificante , Humanos , Carcinoma Hepatocelular/genética , Carcinoma Hepatocelular/terapia , Inmunoterapia , Neoplasias Hepáticas/genética , Neoplasias Hepáticas/terapia , Aprendizaje Automático , ARN Largo no Codificante/genética , Microambiente Tumoral/genética , CobreRESUMEN
Small molecules that interfere with DNA replication can trigger genomic instability, which makes these molecules valuable in the search for anticancer drugs. Thus, interactions between DNA and its ligands at the molecular level are of great significance. In the present study, a new method based on surface-enhanced Raman spectroscopy (SERS) combined with molecular dynamics simulations has been proposed for analyzing the interactions between DNA and its ligands. The SERS signals of DNA hairpins (ST: d(CGACCAACGTGTCGCCTGGTCG), AP1: d(CGCACAACGTGTCGCCTGTGCG)), pure argininamide, and their complexes, were obtained, and the characteristic peak sites of the DNA secondary structure and argininamide ligand-binding region were analyzed. Molecular dynamics calculations predicted that argininamide binds to the 8C and 9G bases of AP1 via hydrogen bonding. Our method successfully detected the changes of SERS fingerprint peaks of hydrogen bonds and bases between argininamide and DNA hairpin bases, and their binding sites and action modes were consistent with the predicted results of the molecular dynamics simulations. This SERS technology combined with the molecular dynamics simulation detection platform provides a general analysis tool, with the advantage of effective, rapid, and sensitive detection. This platform can obtain sufficient molecular level conformational information to provide avenues for rapid drug screening and promote progress in several fields, including targeted drug design.
Asunto(s)
Simulación de Dinámica Molecular , Espectrometría Raman , Ligandos , Espectrometría Raman/métodos , ADN/química , Conformación de Ácido NucleicoRESUMEN
PPFIA4 has been reported to be associated with cancer glycolysis, but its role in esophageal cancer (EC) is unclear. OBJECTIVE: To investigate the role of PPFIA4 in EC. METHODS: qRT-PCR and WB were used to detect the expression of PPFIA4 in EC cells and normal cells. PPFIA4 was inhibited to detect changes in the invasion and migration ability of EC cells. WB detected the expression of cell invasion and migration marker proteins MMP-2 and MMP-9, and the kit detected changes in ATP and lactate levels in EC cells. RESULTS: PPFIA4 was highly expressed in EC cells. Inhibition of PPFIA4 inhibited the invasion and migration ability as well as the expression of MMP-2 and MMP-9 in EC cells, and decreased the levels of ATP and lactate in EC cells. CONCLUSION: Inhibition of PPFIA4 inhibited invasion, migration ability and glycolysis of EC cells.
Asunto(s)
Neoplasias Esofágicas , Proteínas Tirosina Fosfatasas Similares a Receptores , Humanos , Adenosina Trifosfato , Proliferación Celular , Neoplasias Esofágicas/genética , Glucólisis , Ácido Láctico , Metaloproteinasa 2 de la Matriz , Metaloproteinasa 9 de la Matriz , Proteínas Tirosina Fosfatasas Similares a Receptores/metabolismoRESUMEN
Background: LINC02535 has gained much attention for its oncogenicity across several cancers, but the systematic pan-cancer analysis of LINC02535 has not been carried out before. Methods: Herein, we explored the expression level, prognostic value, and hallmark pathways of LINC02535 across multiple cancers using the Cancer Genome Atlas (TCGA) and Cancer Cell Line Encyclopedia (CCLE) databases. Moreover, the expression and biological features of LINC02535 in lung adenocarcinoma (LUAD) were confirmed by qRT-PCR, in vitro and in vivo experiments. Results: LINC02535 is differentially expressed in 10 of 17 human cancers and serves as a favorable or unfavorable biomarker in distinct cancer types. Gene set enrichment analysis (GSEA) indicated that key oncogenic pathways/phenotypes were remarkably activated in most cancers with intratumoral increased LINC02535, whereas these pathways/phenotypes were suppressed in other cancer types (colon adenocarcinoma, kidney renal clear cell carcinoma, rectal adenocarcinoma) with intratumoral decreased LINC02535. Of note, the epithelial-mesenchymal transition (EMT) phenotype was greatly enriched in LUAD patients with elevated LINC02535. Based on the TCGA and CCLE datasets, LINC02535 was positively correlated with the EMT-related gene CD73 (also named as NT5E, an immunosuppressive gene) in almost all cancer types (Spearman R > 0.5, P < 0.001) including LUAD. Most importantly, qRT-PCR confirmed that LINC02535 was upregulated in lung cancer cells or tissues as opposed to human bronchial epithelial cells or paratumor tissues. Knockdown of LINC02535 inhibited proliferation, migration of LUAD cells and retarded xenografted tumor growth. Moreover, silencing of LINC02535 induced apoptosis and cell cycle arrest at G1 phase. Conclusions: The findings from our pan-cancer analysis provide a relatively comprehensive understanding of the potential value of LINC02535 across multiple cancers, and the oncogenic role of LINC02535 in LUAD has been confirmed.
RESUMEN
Background: Adenomyosis is a common gynecological disease in women. A relevant literature search found that approximately 82% of patients with adenomyosis chose to undergo hysterectomy. However, women of childbearing age are more likely to undergo surgery to preserve the uterus. Because it is difficult to determine the extent of adenomyosis, it is almost impossible to resect adenomyotic tissue and retain the uterus at the same time. Materials and methods: Following ethics approval and patient consent, tissue samples were resected and prepared to create frozen slices for analysis. One slice was subjected to H&E staining while the remaining slices were photographed with Coherent Anti-Stokes Raman Scattering (CARS), Second-Harmonic Generation (SHG) microscopy, and Raman spectroscopy. Comparative observations and analyses at the same positions were carried out to explore the diagnostic ability of CARS, SHG, and Raman spectroscopy for adenomyosis. Results: In adenomyotic tissue, we found two characteristic peaks at 1,155 and 1,519 cm-1 in the Raman spectrum, which were significantly different from normal tissue. The substances shown in the CARS spectrum were represented by peaks of 1,519 cm-1. SHG microscopy showed a distribution of collagen at the focus of the adenomyosis. Conclusion: This study represents a novel analysis of Raman microscopy, CARS, and SHG in the analysis of adenomyotic lesions. We found the diffraction spectrum useful in determining the focal boundary and the diagnosis of adenomyosis in the tested samples.
RESUMEN
BACKGROUND: Colon cancer is the second leading cause of death worldwide. Exploring key regulators in colon cancer metastatic progression could lead to better outcomes for patients. METHODS: Initially, the transcriptional profiles of 681 colonrectal cancer (CRC) cases were used to discover signature genes that were significantly correlated with colon cancer metastasis. These signature genes were then validated using another independent 210 CRC cases' transcriptomics and proteomics profiles, and Kaplan-Meier regression analyses were used to screen the key regulators with patients' survival. Immunohistochemical staining was used to confirm the biomarkers, and transit knockdown was used to explore their implications on colon cancer cells migration and invasion abilities. The impact on the key signalling molecules in epithelial-mesenchymal transition (EMT) process that drive tumour metastasis was tested using Western blot. The response to clinical standard therapeutic drugs was compared to clinical prognosis of key regulators using an ROC plotter. RESULTS: Five genes (BGN, THBS2, SPARC, CDH11 and SPP1) were initially identified as potential biomarkers and therapeutic targets of colon cancer metastasis. The most significant signatures associated with colon cancer metastasis were determined to be BGN and THBS2. Furthermore, highly expression of BGN and THBS2 in tumours was linked to a worse survival rate. BGN and THBS2 knockdown significantly reduced colon cancer cells migration and invasion, as well as down-regulating three EMT-related proteins (Snail, Vimentin and N-cadherin), and increasing the proliferation inhibitory effect of 5-fluorouracil, irinotecan and oxaliplatin treatment. CONCLUSIONS: CRC metastatic progression, EMT phenotypic transition and poor survival time have been linked to BGN and THBS2. They could be utilized as potential diagnostic and therapeutic targets for colon cancer metastatic patients with a better prognosis.
Asunto(s)
Neoplasias del Colon , Humanos , Biglicano/metabolismo , Biglicano/farmacología , Biomarcadores , Movimiento Celular/genética , Neoplasias del Colon/diagnóstico , Neoplasias del Colon/genética , Neoplasias del Colon/patología , Transición Epitelial-Mesenquimal/genética , PronósticoRESUMEN
The incidence and mortality of colorectal cancer have shown an upward trend in the past decade. Therefore, the prevention, diagnosis, and treatment of colorectal cancer still need our continuous attention. Finding compounds with strong anticancer activity and low toxicity is a good strategy for colorectal cancer (CRC) therapy. Trametes versicolor is a traditional Chinese medicinal mushroom with a long history of being used to regulate immunity and prevent cancer. Its extractions were demonstrated with strong cell growth inhibitory activity on human colorectal tumor cells, while the anticancer activity of them is not acted through a direct cytotoxic effect. However, the intricacy and high molecular weight make mechanistic research difficult, which restricts their further application as a medication in clinical cancer treatment. Recent research has discovered a small molecule polysaccharide peptide derived from Trametes versicolor that has a distinct structure after decades of Trametes versicolor investigation. Uncertain molecular weight and a complex composition are problems that have been solved through studies on its structure, and it was demonstrated to have strong anti-proliferation activity on colorectal cancer in vitro and in vivo via interaction with EGFR signaling pathway. It opens up new horizons for research in this field, and these low molecular weight polysaccharide peptides provide a new insight of regulation of colorectal cancer proliferation and have great potential as drugs in the treatment of colorectal cancer.
RESUMEN
Background: Cervical cancer has become a worldwide concern owing to its high incidence and mortality rates. To date, high-altitude areas of Tibet have not benefited from any large-scale cervical cancer screening programs. Therefore, we initiated a screening program to investigate the prevalence of human papilloma virus (HPV) and HPV genotype distribution to reveal cervical cancer and its precursor which lead to morbidity among women in the city of Nagqu in northern Tib3et. Methods: A total of 25,173 women were recruited to undergo HPV genotype tests between June and December 2019. Women infected with HPV 16 and/or 18 underwent colposcopy and histological examination. Women with other high-risk HPV type (hr-HPV) underwent cytological tests to determine whether to conduct further colposcopy and histological examination for diagnosis. HPV prevalence was calculated in the total population and further stratified according to various parameters, such as age group, area location (altitude level), and single or mixed infection status. The HPV genotype distribution was also investigated accordingly. Cervical lesions revealed by further colposcopic findings were also analyzed; high-grade and malignant lesion morbidities were calculated in total and in each county. Most data were collected and analyzed using descriptive and consistency check statistical methods, and a risk factor investigation for HPV infection was performed using logistic regression models. Results: The total HPV infection rate among women in Nagqu was 13.42%. Of the 25,173 women in the study, 999 (3.97%) were HPV 16/18 positive, 2,379 (9.45%) were other hr-HPV-positive, and 21,795 (86.58%) were HPV-negative. The five most common HPV genotypes, accounting for more than 60% of all HPV infections in Nagqu people, were HPV 16, 58, 31, 18, and 52. Tibetan women younger than 20 years and older than 60 years were the two age groups with the highest rates of HPV infection, 26.7% and 19.8%, respectively. Among the HPV-positive women, 2,656 (78.33%) were infected with a single strain and 732 (21.67%) were infected with multiple strains (more than two genotypes). HPV prevalence increased in high-altitude areas (positive rate highest in Nyima with an altitude of 5,000 m, 23.9%) and decreased in relatively low-altitude areas (positive rate lowest in Lhari with an altitude of 4,000 m, 6.6%). Multiple analyses showed that age, parity, age at first delivery, and altitude of residence were independent factors facilitating HPV infection in Tibetan women. High-grade and malignant cervical lesions revealed by histological findings were different among living locations, with the highest rates in Xainza, Baingoin, and Nyainrong, these being 2.019%, 1.820%, and 1.116%, respectively, among women in these areas. Conclusion: Our survey provides an overall perspective on HPV genotype infection and cervical lesions in women in northern Tibet. The data not only provide useful information for the treatment of cervical lesions but also has great value in terms of the primary and secondary prevention measures that can be taken for women living in these regions. Clinical Trial Registration: www.chictr.org.cn, indentifier ChiCTR2000035061.
RESUMEN
CONTEXT: Paeoniflorin (PF) and calycosin-7-glucoside (CG, Paeonia lactiflora Pall. extract) have demonstrated protective effects in ischaemic stroke. OBJECTIVE: To investigate the synergistic effects of PF + CG on ischaemia/reperfusion injury in vivo and in vitro. MATERIALS AND METHODS: Male Sprague-Dawley rats were subjected to the middle cerebral artery occlusion/reperfusion (MCAO/R). After MCAO/R for 24 h, rats were randomly subdivided into 5 groups: sham, model (MCAO/R), study treatment (PF + CG, 40 + 20 mg/kg), LY294002 (20 mg/kg), and study treatment + LY294002. Males were given via intragastric administration; the duration of the in vivo experiment was 8 days. Neurologic deficits, cerebral infarction, brain edoema, and protein levels were assessed in vivo. Hippocampal neurons (HT22) were refreshed with glucose-free DMEM and placed in an anaerobic chamber for 8 h. Subsequently, HT22 cells were reoxygenated in a 37 °C incubator with 5% CO2 for 6 h. SOD, MDA, ROS, LDH and protein levels were measured in vitro. RESULTS: PF + CG significantly reduced neurobehavioral outcomes (21%), cerebral infarct volume (44%), brain edoema (1.6%) compared with the MCAO/R group. Moreover, PF + CG increased p-PI3K/PI3K (4.69%, 7.4%), p-AKT/AKT (6.25%, 60.6%) and Bcl-2/BAX (33%, 49%) expression in vivo and in vitro, and reduced GSK-3ß (10.5%, 9.6%) expression. In vitro, PF + CG suppressed apoptosis in HT22 cells and decreased ROS and MDA levels (20%, 50%, respectively). CONCLUSIONS: PF + CG showed a synergistic protective effect against ischaemic brain injury, potentially being a future treatment for ischaemic stroke.
Asunto(s)
Isquemia Encefálica , Accidente Cerebrovascular Isquémico , Fármacos Neuroprotectores , Daño por Reperfusión , Accidente Cerebrovascular , Animales , Isquemia Encefálica/tratamiento farmacológico , Glucósidos/farmacología , Glucógeno Sintasa Quinasa 3 beta , Infarto de la Arteria Cerebral Media/tratamiento farmacológico , Isoflavonas , Masculino , Monoterpenos , Fármacos Neuroprotectores/farmacología , Fosfatidilinositol 3-Quinasas , Proteínas Proto-Oncogénicas c-akt/metabolismo , Ratas , Ratas Sprague-Dawley , Especies Reactivas de Oxígeno , Daño por Reperfusión/tratamiento farmacológico , Daño por Reperfusión/metabolismo , Daño por Reperfusión/prevención & control , Accidente Cerebrovascular/tratamiento farmacológicoRESUMEN
In this study, the effects of multifunctional microbial inoculation on food waste composting based on the synergistic property between organic matter degradation and nitrogen fixation were investigated. The results showed that inoculation simultaneously strengthened organic matter degradation by 9.9% and improved the nitrogen content by 20.6% compared with that of the control group. Additionally, spectral analysis demonstrated that inoculation was conducive to the enhanced humification, which was supported by the improvement in polyphenol oxidase activity. Microbial analysis showed that most of the introduced microorganisms (Bacillus, Streptomyces, Saccharomonospora) successfully colonized, and stimulated the growth of other indigenous microorganisms (Enterobacter, Paenibacillus). Meanwhile, the change in microbial community structure was accompanied by the enhanced tricarboxylic acid cycle and amino acid metabolism. Furthermore, network analysis and structural equation model revealed that the enhanced cooperation of microorganisms, in which more carbon sources could be provided by cellulose decomposition for nitrogen fixation.