Reverse Koebner Phenomenon in a Vitiligo Patient Treated With Radiotherapy.

Radiation-induced hypopigmentation resulting in a skin condition similar to vitiligo is evident in limited studies. In contrast to the typical Koebner phenomenon where new lesions develop at the site of injury, the trauma-induced disappearance of a specific rash in a patient with an already-developed skin disease is seen very rarely. This phenomenon is called "reverse Koebnerization" or "Koebner non-reaction." Herein, we submit a case of a 51-year-old female with already-developed vitiligo who came for treatment for carcinoma of the tongue with radiation therapy. Later, after the treatment, the patient developed a re-pigmentation of her skin.

Fingolimod-Associated Macular Edema in the Treatment of Multiple Sclerosis.

Multiple sclerosis is a neurological disorder categorized by inflammatory processes with a high prevalence worldwide. It affects both motor and sensory pathways and is also associated with the visual pathway. Fingolimod is a commonly used drug for relapsing-remitting multiple sclerosis. It is a sphingosine 1-phosphate modulator acting on its receptors for immune cell accumulation, neuronal function, embryological development, vascular permeability, smooth muscle cell function, and endothelial barrier maintenance. This review aims to understand the processes, mechanisms, risks, and management of fingolimod-associated macular edema. Due to the anti-inflammatory properties of fingolimod, it decreases various cytokines, including interleukin (IL)-1B and IL-6, spike wave, and spike amplitude, in electrophysiological activities and decreases insoluble receptors for advanced glycation end product ligand. A daily dosage of 0.5 mg of fingolimod has an increased association with macular edema. The serious adverse events of fingolimod are lymphopenia, cardiovascular events, ocular events, and carcinoma. Fingolimod decreases brain volume and increases vascular permeability, resulting in increased macular volume and damage to the blood-retinal barrier, which causes an increased risk for macular edema. Cystoid macular edema is more common in older individuals suffering from comorbidities affecting the retina, such as diabetes, or those undergoing ophthalmological surgeries. This review also highlights the importance of regular ophthalmology examinations on patients consuming fingolimod both in the initial stages and chronic use. The treatment options for macular edema include nonsteroidal anti-inflammatory drugs, acetazolamide, triamcinolone, ketorolac, corticosteroids, and intravitreal procedures.

Anxiety and depression amongst youth as adverse effects of using social media : A Review.

Social media use has become widely popularized in modern society and because of that, human interactions have drastically changed. In parallel, depression and anxiety have reached unprecedented levels among the youth, and concerns have emerged on social media use compromising mental health. The objectives of our review are to explore if there is a relation between social media and the development of those two disorders among youth, to highlight the patterns that could lead to them, and to give recommendations for future research. Methods: Based on the Scale for the Assessment of Narrative Review Articles (SANRA) Criteria, the authors performed a search of all-time articles published in the Medline database using terms such as social media, social media use, problematic social media use, depression, anxiety, suicidality, self-harm, fear of missing out, cyberchondria, cyberbullying, sexting, and online shopping. The initial search yielded 184 924 articles. After review, 77 articles were included for discussion. Results: Social media use is often associated with depression and anxiety. Different patterns are thought to predict poorer mental health outcomes like multitasking, emotional investment, appearance-based activities, passive media use, problematic social media use, cyberbullying, sexting, and disaster awareness. Conclusion: Specific patterns of engagement with social media appear to be associated with poor mental health outcomes in youth. It is important for physicians to address social networks exposure in well-visits and for parents to communicate about it openly. However, more in-depth research needs to be done to determine a relation of causality.

The Role of Glucosamine and Chondroitin Sulfate in the Prevention of Colorectal Cancer: A Systematic Review.

Currently, colorectal cancer is the third most common cancer in the world. Recently, glucosamine and chondroitin have gained popularity for their beneficial effects on cancer. They have already been recognized for their therapeutic role in osteoarthritis. This systematic review aims to analyze the relationship between the combined consumption of glucosamine and chondroitin and the prevention of colorectal cancer. Three databases: PubMed, Google Scholar, and Science Direct, were searched to collect relevant articles. After screening full-text articles, seven studies were included in the systematic review. The review found a supportive association between glucosamine and chondroitin and the decreased incidence of colorectal cancer. Through an anti-inflammatory effect on the cell signaling pathway, the supplementation caused a reduction in colorectal cancer occurrence. The dose, frequency of usage of the supplement, and weight of individuals, along with the use of non-steroidal anti-inflammatory drugs, also affected the efficacy. To further assess this relationship, it is necessary to conduct double-blind, randomized controls trials for the supplements in cancer prevention and further explore their safety and efficacy with different ethnicities, drugs, doses, and weight individuals.

Assessment of Informed Consent and the Impact of Simulation on Anesthesia Trainees.

Introduction Over the years, the process of obtaining informed consent has evolved and now places an emphasis on the concept that patients should play a major role in medical decision making. Failure to adequately involve patients in making decisions regarding their health can lead to medicolegal consequences. Therefore, taking informed consent is a fundamental component of anaesthesia training. Simulation, for training, is an excellent tool that is being utilised widely in the training of medical professionals. The use of simulated training for teaching the process of informed consent is an innovative initiative that can provide improved results. Material and methods After approval from the institutional review board, a prospective clinical study was conducted at Shaukat Khanum Memorial Cancer Hospital and Research Centre, Lahore, from August 2019 to September 2020. Sixteen anaesthesia trainees were randomly selected for the study. The study was divided into pre-interventional, interventional and post interventional phases. For data collection, a predesigned checklist was used. Data collected was analysed using SPSS version 23 (IBM Inc., Armonk, New York). The McNemar test was deployed to assess the difference between the baseline assessment and post-simulated training assessment; p-value < 0.05 was taken to be significant. Results Of the 16 participants, the majority were males (n= 13). A positive impact was observed in terms of improvement of the outcome of the following study components i.e., description of benefits of the procedure (p=0.01), disclosure of associated minor risks (p=0.005), disclosure of major risks (p=0.01), discussion of alternatives (p=0.001), teach back (p=0.001), documentation of patients' verbal agreement (p=0.01), and communication skills involving utilising the process of connecting, introduction, communication, permission, response, and exit (p = 0.01). Conclusion Simulated training had a positive impact in improving outcomes in the following study components: description of benefits of the procedure, disclosure of associated risks, discussion of alternatives, teach back, documentation of patients' verbal agreement, and utilisation of the process of connecting, introduction, communication, permission, responding, and exiting.

Osteoporosis, an Inevitable Circumstance of Chronic Kidney Disease: A Systematic Review.

Nowadays, chronic kidney disease (CKD) and osteoporosis have become crucial health-related issues globally. CKD-induced osteoporosis is a systemic disease characterized by the disruption of mineral, hormone, and vitamin homeostasis that elevates the likelihood of fracture. Here, we review recent studies on the association of CKD and osteoporosis. In particular, we focus on the pathogenesis of CKD-associated osteoporosis, including the homeostasis and pathways of several components such as parathyroid hormone, calcium, phosphate, vitamin D, fibroblast growth factor, and klotho, as well as abnormal bone mineralization, remodeling, and turnover. In addition, we explore the diagnostic tools and possible therapeutic approaches for the management and prevention of CKD-associated osteoporosis. Patients with CKD show higher osteoporosis prevalence, greater fracture rate, increased morbidity and mortality, and an elevated occurrence of hip fracture. We also rule out that increased severity of CKD is related to a more severe condition of osteoporosis. Furthermore, supplements such as calcium and vitamin D as well as lifestyle modifications such as exercise and cessation of smoking and alcohol help in fracture prevention. However, new approaches and advancements in treatment are needed to reduce the fracture risk in patients with CKD. Therefore, further collaborative multidisciplinary research is needed in this regard.

Depression Impairs Level of Functioning in Chronic Kidney Disease Inpatients: A Case-Control Study.

Objectives To evaluate the difference in demographics and clinical correlates during hospitalization for chronic kidney disease (CKD) between patients with depression and those without depression, and its impact on the severity of illness and in-hospital mortality. Methods We conducted a case-control study and included 2,296 adult inpatients (age ≥18 years) with a primary discharge diagnosis of CKD using the nationwide inpatient sample (NIS). We used propensity score matching to extract the cases i.e., CKD inpatients with depression (N = 1,264) and the controls i.e. CKD inpatients without depression (N = 1,032). The matching was done based on demographic characteristics of age at admission, sex, race, and median household income. Our outcomes of interest are the severity of illness and all-cause in-hospital mortality. All patient refined drg (APR-DRG) are allocated using health information systems software by the NIS and the severity of illness within each base APR-DRG was classified into minor, moderate, or major loss of body functions. Binomial logistic regression analysis was conducted to find the odds ratio (OR) of association for major loss of function in CKD inpatients with depression, and this model was adjusted for potential confounders of congestive heart failure (CHF), coronary artery disease (CAD), diabetes, hypertension, obesity, and tobacco abuse, and utilization of hemodialysis. Results A higher proportion of CKD inpatients with depression had a statistically significant higher prevalence of major loss of function (49.8% vs. 40.3% in non-depressed). There was a statistically significant difference with higher utilization of hemodialysis in CKD inpatients with depression (76.2% vs. 70.7% in non-depressed). The all-cause in-hospital mortality rate was lower in CKD inpatients with depression (2.1% vs. 3.5% in non-depressed). After controlling the logistic regression model for potential comorbidities and utilization of hemodialysis, depression was associated with increased odds (OR 1.46; 95% CI 1.227 - 1.734) for major loss of function versus in non-depressed CKD inpatients Conclusion Comorbid depression increases the likelihood of major loss of functioning in CKD inpatients by 46%. Treating depression can allow patients to better cope emotionally and physically with CKD and other comorbidities and significantly improve the patient's quality of life (QoL) and health outcome.

Improved heart transplant survival for children with congenital heart disease and heterotaxy syndrome in the current era: An analysis from the pediatric heart transplant society.

BACKGROUND: Challenges exist with heterotaxy due to the complexity of heart disease, abnormal venous connections, and infection risks. This study aims to understand heart transplant outcomes for children with heterotaxy. METHODS: All children with congenital heart disease listed for transplant from 1993 to 2018 were included. Those with and without heterotaxy were compared. Waitlist outcomes and survival post-listing and transplant were analyzed. Post-transplant risk factors were identified using multiphase parametric hazard modeling. RESULTS: There were 4814 children listed, of whom 196 (4%) had heterotaxy. Heterotaxy candidates were older (5.8 ± 5.7 vs 4.2 ± 5.5 years, p < 0.01), listed at a lower urgency status (29.8% vs 18.4%, p < 0.01), more commonly single ventricle physiology (71.3% vs 59.2%, p < 0.01), and less often supported by mechanical ventilation (22% vs 29.1%, p < 0.05) or extracorporeal membrane oxygenation (3.6% vs 7.5%, p < 0.05). There were no differences in waitlist outcomes of transplant, death, or removal. Overall, post-transplant survival was worse for children with heterotaxy: one-year survival 77.2% vs 85.1%, with and without heterotaxy, respectively. Heterotaxy was an independent predictor for early mortality in the earliest era (1993-2004), HR 2.09, CI 1.16-3.75, p = 0.014. When stratified by era, survival improved with time. Heterotaxy patients had a lower freedom from infection and from severe rejection, but no difference in vasculopathy or malignancy. CONCLUSIONS: Mortality risk associated with heterotaxy is mitigated in the recent transplant era. Early referral may improve waitlist outcomes for heterotaxy patients who otherwise have a lower status at listing. Lower freedom from both infection and severe rejection after transplant in heterotaxy highlights the challenges of balancing immune suppression.

"Tocilizumab-an option for patients with COVID-19 associated cytokine release syndrome: A single center experience", a retrospective study-original article.

BACKGROUND: The first case of Infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was diagnosed in Wuhan, China in 2019. In the first half of 2020, this disease has already converted into a global pandemic. This study aimed to find that treatment of patients with COVID-19 pneumonia with Tocilizumab or steroids was associated with better outcomes. Objectives: To analyze the effectiveness of Tocilizumab in moderate to severe Covid-19 patients based on predefined assessment criteria . Study Settings: Single-center, Fatima Memorial Hospital, Lahore. STUDY DESIGN: Quasi-experimental. DURATION OF STUDY: From May 12, 2020 to June 12, 2020. PATIENTS & METHODS SAMPLE SIZE AND TECHNIQUE: Sample size was 93; 33 patients were kept in the experimental group, given Tocilizumab, 8 mg/kg intravenously or 162 mg subcutaneously, and the rest of the 60 patients were given corticosteroids, methylprednisolone 80 mg/day. Consecutive sampling. Failure of therapy was labeled when patients were intubated or died, and the endpoints were failure-free survival which was the primary endpoint, and overall survival secondary at the time of discharge. RESULTS: A total of 93 patients were enrolled, the Tocilizumab (TCZ) group (case) and Corticosteroid (CS) group (Control). The median age was 58 years (IQR-21), 37 (39.8%) patients with diabetes mellitus, 11 (11.8%) in the TCZ group, and 26 (28%) in the CS group. On the whole, the total median hospital stay in days was 7 with IQR (4), a total of 83 (89.2%) patients recovered successfully and discharged, 27 (29%) in the TCZ group and 56 (60.2%) in the CS group. Total 10 (10.8%) patients died, out of which 6 (6.5%) belonged to the TCZ group and 4 (4.3%) belonged to the CS group The median Oxygen requirement with IQR was 8 (9) in both the groups and in total as well, p-value (0.714). CONCLUSIONS: Tocilizumab is a quite effective treatment option for critically sick patients of Covid-19 by reducing their oxygen requirement drastically and so the ICU stay, median hospital stay and so the mortality as well. CLINICALS TRIALS REGISTRATION: UIN # NCT04730323.

Effect of paroxetine on intestinal motility in the presence of ondansetron.

Chemotherapy, radiotherapy, surgery and depression are the conditions that run in parallel fashions. All these conditions cause the release of an increased amount of serotonin in the body. Serotonin acts on these 5HT3 receptors and causes nausea and vomiting. Ondansetron acts by blocking serotonin from acting on the receptors and thus is useful in decreasing episodes of nausea and vomiting but when used concomitantly with SSRIs (selective serotonin reuptake inhibitors) as cancer patient also suffered from depression. This combination tends to decrease the efficacy of ondansetron. The present study was carried out to observe the modulatory role of ondansetron on ileal smooth muscle motility in vitro. Experiments were performed in four groups (n=6) and ileal smooth muscle activity was recorded on the power lab (USA). The effects of increasing concentrations of serotonin, ondansetron and paroxetine alone were observed. In the fourth group effects of paroxetine in the presence of fixed concentration (1ml) of ondansetron (10-6M) was observed. The maximum response obtained by serotonin served as a control for our study (100%). Paroxetine response on intestinal motility was completely blocked in the presence of ondansetron. Our findings hence, reinforce the hypothesis that paroxetine decreases the antiemetic activity of serotonin antagonist ondansetron, by super sensitization of serotonergic receptors resulting in an increased incidence of nausea and vomiting in cancer patient despite adequate antiemetic prophylaxis.

Pyridine Derivative of the Natural Alkaloid Berberine as Human Telomeric G4-DNA Binder: A Solution and Solid-State Study.

Telomerase is an enzyme deputed to the maintenance of eukaryotic chromosomes; however, its overexpression is a recognized hallmark of many cancer forms. A viable route for the inhibition of telomerase in malignant cells is the stabilization of G-quadruplex structures (G4) at the 3' overhang of telomeres. Berberine has shown in this regard valuable G4 binding properties together with a significant anticancer activity and telomerase inhibition effects. Here, we focused on a berberine derivative featuring a pyridine containing side group at the 13th position. Such modification actually improves the binding toward telomeric G-quadruplexes and establishes a degree of selectivity in the interaction with different sequences. Moreover, the X-ray crystal structure obtained for the complex formed by the ligand and a bimolecular human telomeric quadruplex affords a better understanding of the 13-berberine derivatives behavior with telomeric G4 and allows to draw useful insights for the future design of derivatives with remarkable anticancer properties.

Pain Perception and Rate of Canine Retraction Through Self-Ligating Brackets and Conventional Elastomeric Ligation System: A Split Mouth Study

Abstract Objective: To evaluate the rate of tooth movement and the pain perception via self-ligating (SL) and conventional elastomeric ligation brackets (CB) system. Material and Methods: This study has been conducted at the Orthodontic Department of Baqai Dental College, Baqai Medical University. The sample size of this study comprised 40 patients, falling between the age of 12-30 years without any sex discrimination. Shapiro-Wilk was used to check the distribution of data. Non-parametric Mann Whitney U test was applied to evaluate the pain associated with SL and CB brackets system. To analysis the canine retraction Wilcoxon test was applied for the comparison of CB and SL brackets system. For all statistical analyses, the p-value of <0.05 was considered significant. Results: Pain level associated with retraction via CB and SL shows significant differences. However, the rate of canine retraction via CB and SL shows no significant differences at stages T0-T1 and T1-T2. However, stage T2-T3 shows a significant difference. Conclusion: As pain during orthodontic treatment is mostly associated with the level of compression of the periodontal ligament, it may be hypothesized that lower frictional forces generate less compression of the periodontal ligament and blood vessels, and so alter the type of pain experienced.

Enzyme inhibition and antibacterial potential of 4-Hydroxycoumarin derivatives

The 4-Hydroxycoumarin derivatives are known to show a broad spectrum of pharmacological applications. In this paper we are reporting the synthesis of a new series of 4-Hydroxycoumarin derivatives synthesized through Knovenegal condensation; they were characterized by using UV-Vis, FT-IR, NMR spectroscopies. The synthesized compounds were evaluated for antibacterial activity against Staphylococcus aureus and Salmonella typhimurium strains. The compounds (2), (3) and (8) showed favorable antibacterial activity with zone of inhibitions 26.5± 0.84, 26.0 ± 0.56 and 26.0 ± 0.26 against Staphylococcus aureus (Gram-positive) respectively. However, the compounds (5) and (9) were found more active with 19.5 ± 0.59 and 19.5 ± 0.32 zone of inhibitions against Salmonella typhimurium (Gram-negative). Whereas, in urease inhibition assay, none of the synthesized derivatives showed significant anti-urease activity; although, in carbonic anhydrase-II inhibition assay, the compound (2) and (6) showed enzyme inhibition activity with IC50 values 263±0.3 and 456±0.1, respectively.

Efficacy of zinc sulfate on concurrent chemoradiotherapy induced taste alterations in oral cancer patients: A double blind randomized controlled trial.

OBJECTIVES: To observe the efficacy of zinc sulfate on taste alterations in oral cancer patients receiving concurrent chemotherapy with radiotherapy. METHODS: Seventy patients were randomly assigned to both intervention and control group at Oncology Section of Atomic Energy Medical Centre Karachi from September 2017 to March 2018. One group received zinc sulfate capsules (50 mg TDS daily after meals) and the other group received placebo (thrice after meals). Patients were advised to start taking capsules on the first day of their chemoradiation. Both the groups continued the capsules a month after their CCRT ended. RESULTS: Sweet taste was most effected by cancer and its treatment followed by bitter and salty taste. Sour taste was least effected. When both the groups were compared for four tastes for detection threshold, the differences in observation at 3 stages of median IQR were not significant. For recognition threshold between zinc sulfate and placebo, no significant difference was observed in median IQR for salty taste and bitter taste. However, sweet taste (baseline p-value 0.245, end p-value 0.010, follow-up p-value 0.038) was statistically significant at end of CCRT and follow-up stage and sour taste (baseline p-value 0.24, end p-value 0.006, follow-up p-value 0.898) at end of CCRT only. CONCLUSION: Zinc sulfate was not found to be beneficial in preventing chemoradiation induced taste alterations. Taste and smell alterations are common in patients with cancer and do not receive sufficient support to manage taste alterations. This area requires more research to develop a comprehensive understanding of the nature and its management.

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies.

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV-vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5'-(GGGTTAGGGTTAGGGTTAGGG)-3' was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M-1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M-1, and that of BER was (0.98 ± 0.03) × 105 M-1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex-berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.

Exploring the binding interaction of potent anticancer drug topotecan with human serum albumin: spectroscopic, calorimetric and fibrillation study.

This manuscript describes the interaction of the topoisomerase I inhibitor anticancer drug topotecan with human serum albumin using microcalorimetry, circular dichroism, and atomic force microscopy imaging techniques. Conformational change in albumin was ascertained from circular dichroism and synchronous fluorescence study that revealed a small but definitive partial unfolding of the protein structure upon drug binding. Isothermal titration calorimetry study indicated a favorable exothermic interaction with a binding affinity of the order of ~105 M-1 at 293.15 K. A 1:1 binding stoichiometry was established. The binding reaction was largely enthalpy dominated with negative standard molar Gibbs energy change. Ionic strength variation study revealed that non-polyelectrolytic forces played dominant role in the interaction and remained almost invariant at all salt concentrations. Upon complex formation, the stabilization of the protein structure against thermal denaturation occurred. Atomic force microscopy study enabled imaging of fibrils of the protein and its complex with topotecan.

Effect of different ripening stages on walnut kernel quality: antioxidant activities, lipid characterization and antibacterial properties.

Packing tissue between and around the kernel halves just turning brown (PTB) is a phenological indicator of kernel ripening at harvest in walnuts. The effect of three ripening stages (Pre-PTB, PTB and Post-PTB) on kernel quality characteristics, mineral composition, lipid characterization, sensory analysis, antioxidant and antibacterial activity were investigated in fresh kernels of indigenous numbered walnut selection of Kashmir valley "SKAU-02". Proximate composition, physical properties and sensory analysis of walnut kernels showed better results for Pre-PTB and PTB while higher mineral content was seen for kernels at Post-PTB stage in comparison to other stages of ripening. Kernels showed significantly higher levels of Omega-3 PUFA (C18:3n3) and low n6/n3 ratio when harvested at Pre-PTB and PTB stages. The highest phenolic content and antioxidant activity was observed at the first stage of ripening and a steady decrease was observed at later stages. TBARS values increased as ripening advanced but did not show any significant difference in malonaldehyde formation during early ripening stages whereas it showed marked increase in walnut kernels at post-PTB stage. Walnut extracts inhibited growth of Gram-positive bacteria (B. cereus, B. subtilis, and S. aureus) with respective MICs of 1, 1 and 5 mg/mL and gram negative bacteria (E. coli, P. and K. pneumonia) with MIC of 100 mg/mL. Zone of inhibition obtained against all the bacterial strains from walnut kernel extracts increased with increase in the stage of ripening. It is concluded that Pre-PTB harvest stage with higher antioxidant activities, better fatty acid profile and consumer acceptability could be preferred harvesting stage for obtaining functionally superior walnut kernels.

A Randomized Clinical Trial Comparing 2 Ibuprofen Formulations in Patients with Acute Odontogenic Pain.

INTRODUCTION: Ibuprofen sodium dihydrate, a new formulation of ibuprofen, was introduced with the claim of faster onset of analgesia. Most of the data on this new ibuprofen formulation are drawn from studies using the oral surgery model. Because this model differs significantly from the endodontic pain model, we conducted a study comparing ibuprofen sodium dihydrate with conventional ibuprofen acid in endodontic pain patients. METHODS: This randomized, double-masked study recruited subjects experiencing moderate to severe pain from a tooth diagnosed with symptomatic irreversible pulpitis and symptomatic apical periodontitis (n = 41). Subjects were randomized to receive 400 mg ibuprofen acid (Advil; Pfizer, Madison, NJ) or an equivalent dose of 512 mg ibuprofen sodium dihydrate (Advil Sodium, Pfizer). The outcome measures were time to onset of 50% pain relief recorded using a stopwatch, reduction in spontaneous pain experienced on a 100-mm visual analog scale, and change in mechanical allodynia measured using a bite force transducer. The last 2 measures were obtained before and 60 minutes after administration of the drug. RESULTS: The median time to onset of 50% pain relief after administration of ibuprofen sodium dihydrate was significantly faster compared with ibuprofen acid (26.5 vs 44 minutes, P = .08). Ibuprofen sodium dihydrate provided a greater reduction in spontaneous pain (50.8% vs 33.3%, P < .05) and mechanical allodynia (15% vs 9%, P > .05). CONCLUSIONS: In endodontic pain patients, a single dose of ibuprofen sodium dihydrate provides faster onset of pain relief and a greater reduction in spontaneous and evoked pain compared with ibuprofen acid.

Probing the binding of anticancer drug topotecan with human hemoglobin: Structural and thermodynamic studies.

Protein - ligand interactions play pivotal role in almost all the biological processes occurring in living organisms, and therefore such studies hold immense importance from the standpoint of rational drug design and development. In this study the binding of the topoisomerase I inhibitor drug, topotecan to hemoglobin was probed using various biophysical and microcalorimetry techniques. Spectrofluorimetric data confirmed the static nature of the quenching mechanism of the protein induced by the drug. Significant conformational changes in the protein were ascertained from circular dichroism and three dimensional fluorescence results. Synchronous fluorescence study revealed an increase in the polarity around the Trp residues of the protein while atomic force microscopy study enabled to obtain images of the bound molecules. Isothermal titration calorimetry studies indicated an exothermic binding with a negative Gibbs energy change; ionic strength variation suggested a greater contribution from non-polyelectrolytic forces in the binding process. Differential scanning calorimetry studies indicated an increased thermal stabilization of the protein upon topotecan binding which is also in close agreement with the results obtained from absorbance and circular dichroism melting studies. Overall this manuscript presents results on the molecular interaction from structural and energetic perspectives providing an in depth insight into drug-protein interaction.

Ultrasound treatment: effect on physicochemical, microbial and antioxidant properties of cherry (Prunus avium).

The cherry was treated with ultrasonic waves (33 kHz, 60 W) at different time intervals (10, 20, 30, 40, 60 min) and study was carried out to analyze the change in physico-chemical properties (TSS, pH, color, acidity and firmness), antioxidant potential and microbial load of the fruit during the storage period of 15 days at 4 °C. It was observed that ultrasound treatment (US) between 30 and 40 min showed better retention of color of the fruit during the storage period. The antioxidant assays (DPPH, ABTS and TPC) also increased significantly (P ≤ 0.05) up to 40 min, however the firmness of the fruit was affected and it showed a significant decrease beyond 20 min of US treatment. The sample with 40 min US treatment showed significantly less microbial load than other samples. The 20-40 min US treatment time (33 kHz, 60 W) was suggested for preservation of cherry during the storage at 4 °C.