Mechanisms of and variables affecting UVR photoadaptation in human skin.

Humans have been exposed to solar UV radiation since their appearance on Earth and evolution has enabled most individuals to adapt to this exposure, to some degree. UV radiation produces several deleterious effects in human skin and light-skinned individuals are at greatest risk for both acute and long-term negative effects such as DNA damage, sunburn, immune suppression and skin cancer. The benefits of photoadaptation, which leads to a decreased response after acclimatization, are that humans who have skin that is capable of photoadaptation can work and play in the sun with reduced fear of painful sunburn. However, the effects of photoadaptation on DNA damage and development of skin cancer are quite complex and less well-understood. In this article, we have reviewed the current state of knowledge of UVR photoadaptation in human skin. However, more studies are needed to explore the use of UVR photoadaptation to protect against critical endpoints, such as skin cancer.

Neurokinin-1 receptor expression and antagonism by the NK-1R antagonist maropitant in canine melanoma cell lines and primary tumour tissues.

We interrogated the neurokinin-1 receptor (NK-1R)/substance P (SP) pathway in canine melanoma tumour tissues and cell lines. NK-1R messenger RNA (mRNA) and protein expression were observed in the majority of tumour tissues. Immunohistochemical assessment of archived tissue sections revealed NK-1R immunoreactivity in 11 of 15 tumours, which may have diagnostic, prognostic and therapeutic utility. However, we were unable to identify a preclinical in vitro cell line or in vivo xenograft model that recapitulates NK-1R mRNA and protein expression documented in primary tumours. While maropitant inhibited proliferation and enhanced apoptosis in cell lines, in the absence of documented NK-1R expression, this may represent off-target effects. Furthermore, maropitant failed to suppress tumour growth in a canine mouse xenograft model derived from a cell line expressing mRNA but not protein. While NK-1R represents a novel target, in the absence of preclinical models, in-species clinical trials will be necessary to investigate the therapeutic potential for antagonists such as maropitant.

First Report of Tomato chlorotic spot virus Infecting Tomatoes in Ohio.

Virus-like symptoms including deformation, discoloration, and necrotic ringspots on green and red fruits of tomato (Solanum lycopersicum L. cv. Big Dena) were observed in a 400 m2 commercial high tunnel in Wayne Co., Ohio, in July and August 2013. No symptoms were observed on leaves. Incidence of symptomatic fruits was approximately 15%. Tomato seedlings transplanted into the high tunnel were produced in a greenhouse containing ornamental plants. The grower observed high levels of thrips infestation in the tomato seedlings prior to transplanting. A tospovirus was suspected as a possible causal agent. Four symptomatic fruits were tested using immunostrip tests for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (Agdia, Inc., Elkhart, IN), a double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) for Groundnut ringspot virus (GRSV)/Tomato chlorotic spot virus (TCSV) (Agdia, Inc., Elkhart, IN), and DAS-ELISA for TCSV (AC Diagnostics Inc., Fayetteville, AR). All of the symptomatic fruits tested negative with Agdia immunostrips and positive with the Agdia and AC Diagnostics DAS-ELISAs. Total RNA was extracted from one ELISA-positive sample using TRIZOL Reagent (Life Technologies, Carlsbad, CA) and tested in RT-PCR using GRSV- or TCSV-specific primers (2). An expected RT-PCR product was generated using primers derived from TCSV S-RNA (JAP885, 5'-CTCGGTTTTCTGCTTTTC-3' and JAP886, 5'CGGACAGGCTGGAGAAATCG3') (~290 bp) but not when using primers specific to GRSV S-RNA (JAP887, 5'-CGTATCTGAGGATGTTGAGT-3' and JAP888, 5'-GCTAACTCCTTGTTCTTTTG-3'). The 290-bp RT-PCR product was cloned using a TOPO TA cloning kit (Life Technologies, Grand Island, NY), and six clones were sequenced. Sequences from three clones were identical to a consensus sequence of a 292-bp fragment covering part of the TCSV nucleocapsid gene (GenBank Accession No. KJ744213). Sequences of the remaining three clones contained one, two, or three nucleotide mutations. To confirm the presence of TCSV in this sample, two newly designed primers flanking the entire nucleocapsid protein gene (TCSV-F1, 5'-AGTATTATGCATCTATAGATTAGCACA-3' and TCSV-R1, 5'-ACAAATCATCACATTGCCAGGA-') were used in RT-PCR to generate an expected 948-bp product. Upon cloning and sequencing, this fragment was shown to contain a full nucleocapsid protein gene of TCSV (GenBank Accession No. KM610235). The fragment contained a sequence identical to the first 292-bp RT-PCR product. BLASTn analysis (National Center for Biotechnology Information database) showed that the large fragment sequence had 98% nucleotide sequence identity to the TCSV Florida isolate (GenBank Accession No. JX244196) and 94% to the TCSV Physalis isolate (GenBank Accession No. JQ034525). Tobacco plants were inoculated mechanically with sap from symptomatic tomato fruits. Necrotic local lesions developed, and the presence of TCSV was confirmed using AC Diagnostics' DAS-ELISA. TCSV has been reported in Brazil (1), Puerto Rico (3), and Florida (2). To our knowledge, this is the first report of TCSV infecting tomatoes in Ohio. Because TCSV is transmitted by thrips and has a broad host range, this emerging virus could pose a significant threat to the U.S. vegetable industry. References: (1) A. Colariccio et al. Fitopatol. Bras. 20:347, 1995. (2) A. Londoño et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Plant Health Progress doi:10.1094/PHP-2013-0812-01-BR, 2013.

Syntaxin 6-mediated Golgi translocation plays an important role in nuclear functions of EGFR through microtubule-dependent trafficking.

Receptor tyrosine kinases (RTKs) are cell surface receptors that initiate signal cascades in response to ligand stimulation. Abnormal expression and dysregulated intracellular trafficking of RTKs have been shown to be involved in tumorigenesis. Recent evidence shows that these cell surface receptors translocate from cell surface to different cellular compartments, including the Golgi, mitochondria, endoplasmic reticulum (ER) and the nucleus, to regulate physiological and pathological functions. Although some trafficking mechanisms have been resolved, the mechanism of intracellular trafficking from cell surface to the Golgi is not yet completely understood. Here we report a mechanism of Golgi translocation of epidermal growth factor receptor (EGFR) in which EGF-induced EGFR travels to the Golgi via microtubule-dependent movement by interacting with dynein and fuses with the Golgi through syntaxin 6-mediated membrane fusion. We also demonstrate that the microtubule- and syntaxin 6-mediated Golgi translocation of EGFR is necessary for its consequent nuclear translocation and nuclear functions. Thus, together with previous studies, the microtubule- and syntaxin 6-mediated trafficking pathway from cell surface to the Golgi, ER and the nucleus defines a comprehensive trafficking route for EGFR to travel from cell surface to the Golgi and the nucleus.

First Report of Bacterial Wilt Caused by Ralstonia solanacearum in Ghana, West Africa.

Tomato and pepper plants exhibiting wilt symptoms were collected from fields in seven villages in Northern (Vea, Tono, Pwalugu), Ashanti (Agogo, Akumadan), and Brong Ahafo (Tanoso, Tuobodom) regions of western Ghana in November 2012. The plants were wilted without leaf yellowing or necrosis. Disease incidence was generally low, with less than 20% symptomatic plants observed. Most of the plants collected produced visible bacterial ooze in water in the field. Ooze was plated on 2,3,5-triphenyltetrazolium chloride-amended (TZC) medium. Isolated colonies were fluidal, irregularly round, white with pink centers, gram-negative, and oxidase positive. One strain from each of seven fields was selected for further study. All strains induced a hypersensitive reaction on tobacco. Randomly selected strains SM855-12 and SM857-12 tested positive in R. solanacearum ImmunoStrip assays (Agdia Inc., IN). An end-point PCR assay with primer set 759/760 (3) generated an R. solanacearum-specific 280-bp amplicon for all seven strains. Two of these strains were biovar I and the remaining five were biovar III based on utilization of cellobiose, lactose, maltose, dulcitol, mannitol, and sorbitol. A phylotype-specific multiplex PCR assay that recognizes four geographically linked monophyletic groups within R. solanacearum (1) indicated that one strain (SM855-12) was phylotype III (African origin), whereas the other six were phylotype I (Asian origin). All strains were subjected to repetitive sequence-based PCR (Rep-PCR) with BOXA1R and REP1R/REP2 primers (4). Strain SM855-12 was grouped with the phylotype III reference strain UW 368 and the remaining six strains were grouped with the phylotype I reference strain GMI 1000. A pathogenicity test was performed with bacterial wilt-susceptible tomato line OH7814. Inoculum was prepared from 48-h cultures of strains SM855-12, SM856-12, and SM858-12 grown on casamino acid peptone glucose (CPG) medium at 30°C. Roots of ten 4-week-old tomato plants per strain were drench-inoculated with 5 ml of a 108 CFU/ml bacterial suspension after wounding with a sterile scalpel. Non-inoculated control plants were drenched with 5 ml distilled water after root wounding. Plants were kept in a greenhouse at 25 to 30°C. By 12 days after inoculation, 80 to 100% of inoculated plants were wilted, whereas no symptoms appeared in non-inoculated plants. Bacteria re-isolated from wilted plants were confirmed to be R. solanacearum using techniques mentioned above. Although an association of bacterial wilt with tomato/pepper was mentioned previously (2), to our knowledge, this is the first documented report of bacterial wilt caused by R. solanacearum in Ghana. The presence of Asian strains (phylotype I) may be the result of one or more accidental introductions. Awareness of this disease in Ghana will lead to deployment of management strategies including use of resistant varieties and grafting desirable varieties onto disease-resistant rootstocks. References: (1) M. Fegan and P. Prior. Page 449 in Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. C. Allen et al., eds. American Phytopathological Society, St. Paul, MN, 2005. (2) K. A. Oduro. Plant Protection and Regulatory Services Directorate of MOFA, Accra, Ghana, 2000. (3) N. Opina et al. Asia Pac. J. Mol. Biol. Biotechnol. 5:19, 1977. (4) J. Versalovic et al. Methods Mol. Cell Biol. 5:25, 1994.

First Report of Leek yellow stripe virus in Garlic in Ohio.

Leek yellow stripe virus (LYSV), genus Potyvirus, family Potyviridae, infects a wide range of Allium species worldwide. LYSV is one of several viruses that chronically infect garlic, Allium sativum L. The garlic virus complex, which includes LYSV, Onion yellow dwarf virus, and Garlic common latent virus, is perpetuated by asexual propagation (4) and is transmitted to clean planting material by aphids (3). This virus complex can reduce garlic bulb weight by nearly three quarters (2), and LYSV-only infections can result in approximately a one-quarter reduction in bulb weight (2). Garlic is grown as a small-scale, specialty crop in Ohio. During late May and early June 2013, garlic plants with virus-like symptoms were collected from Medina, Holmes, and Wayne counties, Ohio. Plants exhibited chlorotic streaking, foliar dieback, dwarfing, small bulbs, and cylindrical bulbs that failed to differentiate into cloves. Incidence of affected plants in the fields was up to 5% and all fields had early season aphid infestations. Flexuous rods were observed in TEM micrographs of plant sap from symptomatic leaves. Five symptomatic plants and six asymptomatic plants (from fields with symptomatic plants) were evaluated for LYSV by DAS-ELISA (Agdia, Inc., Elkhart, IN). Reverse transcriptase (RT)-PCR with LYSV-specific primers LYSV-WA and LYSV-WAR (3) was performed with cDNA generated by the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). Both foliar and bulb tissues were tested using both detection methods. Forty percent of symptomatic plants and 67% of asymptomatic plants tested positive for LYSV with both ELISA and RT-PCR. LYSV was detected in both foliar and bulb tissues, including both tissues from asymptomatic plants. Five PCR amplicons generated from both foliar and bulb tissue were sequenced and shown to share 96 to 98% maximum identity with an LYSV polyprotein gene accession in GenBank (AY842136). This provided additional support that the detected virus was LYSV. LYSV was initially difficult to detect in Ohio fields due to low disease incidence and subtle symptom development. Use of virus-tested garlic bulbs can improve yield for several years, even following viral reinfection by aphids, compared to growing garlic from chronically infected bulbs (1). However, many growers routinely save bulbs from year to year and lack access to or knowledge of virus-tested sources of garlic bulbs. Conducive conditions, chronic infections, or co-infections with other viruses enhance the severity of symptoms and yield loss (2). LYSV has previously been reported in garlic producing regions of the northwestern United States (3), and to our knowledge, this is the first report of LYSV in garlic in Ohio. References: (1) V. Conci et al. Plant Dis. 87:1411, 2003. (2) P. Lunello et al. Plant Dis. 91:153, 2008. (3) H. Pappu et al. Plant Health Progress 10, 2008. (4) L. Parrano et al. Phytopathol. Mediterr. 51:549, 2012.

First Report of Bacterial Leaf Spot of Parsley Caused by Pseudomonas syringae pv. coriandricola in Ohio.

A severe leaf spot of parsley (Petroselinum crispum L. cvs. Dark Green Italian and Gigante) was observed on ∼1.5 ha in 2007 and 8 ha in 2012 on three vegetable farms in northern Ohio. Tiny, water-soaked spots that enlarged to necrotic lesions (∼5 mm wide) were first observed in June of each year. Lesions often coalesced and leaf marginal necrosis was common. Disease incidence initially ranged from 20 to 50%, and a 1.5-ha field was completely lost in 2012 as a result of the disease. Bacterial streaming was observed microscopically from leaf lesions. Diseased leaf tissue was dipped briefly in 70% ethanol, rinsed in sterile water, and blotted dry. Bacteria were isolated by plating 10-fold serial dilutions of diseased tissue extracts onto yeast dextrose carbonate and Pseudomonas F (PF) agar media. Whitish, opaque, circular colonies were isolated consistently from all samples. One isolate was purified from each of four fields. They were all gram-negative, non-fluorescent on PF medium, levan positive, oxidase negative, arginine dihydrolase negative, potato rot negative, and tobacco hypersensitive reaction positive. Repetitive extragenic palindromic sequence (Rep)-PCR fingerprint profiles using the BOXA1R primer (4) were identical for the four isolates. A pathogenicity test was conducted with strain SM69-07 isolated in 2007. A bacterial culture was suspended in sterile potassium phosphate buffer (0.01M, pH 7.4) and adjusted to 108 CFU/ml. Four 4-week-old plants each of parsley and cilantro (Ferry-Morse Seed Co.) were inoculated by spraying the bacterial suspension on the leaves until runoff. Potassium phosphate buffer was applied as a negative control treatment for each plant species. Plants were kept in a mist room with 100% humidity for 4 h, then transferred to a greenhouse with average maximum and minimum temperatures of 30 and 25°C. Leaf symptoms similar to those on the original plants were observed on the inoculated parsley and cilantro plants within 14 days of inoculation, whereas no symptoms developed on the negative control plants. One bacterial isolate obtained from each inoculated host using the isolation method described above was confirmed to be identical to the original isolates using the LOPAT tests and Rep-PCR DNA fingerprint profiles; no target bacteria were isolated from the negative control plants. Multilocus sequence typing (MLST) of the housekeeping genes gap1, gltA, gyrB, and rpoD was conducted for strain Sm69-07 (2,3). Sequence data were subjected to BLASTn searches in the Plant-Associated Microbes Database (PAMDB, http://genome.ppws.vt.edu/cgi-bin/MLST/home.pl ) (1). The sequences aligned with those of Pseudomonas syringae pv. coriandricola with 100% identity to alleles 101 (gyrB), 123 (rpoD), 7 (gap1), and 64 (gltA). Strain information and sequence alignment results for SM69-07 were submitted to PAMDB and assigned as isolate ID 1138. Based on bacterial culture morphology, LOPAT profile, pathogenicity test results, and MLST, the pathogen was confirmed as P. syringae pv. coriandricola. To our knowledge, this is the first report of bacterial spot of parsley caused by P. syringae pv. coriandricola in Ohio. Due to stringent quality requirements for fresh market parsley, this disease may pose a threat to the economic sustainability of parsley production in Ohio. References: (1) N. F. Almeida et al. Phytopathology 100:208, 2010. (2) C. T. Bull et al. Phytopathology 101:847, 2011. (3) M. S. Hwang et al. Appl. Environ. Microbiol. 71:5182, 2002. (4) J. Versalovic et al. Methods Mol. Cell Biol. 5:25, 1994.

First Report of Tomato Pith Necrosis Caused by Pseudomonas mediterranea in the United States and P. corrugata in Ohio.

Tomato (Solanum lycopersicum, cvs. Mountain Fresh, Big Dena, and Trust) plants with symptoms of pith necrosis were received from six commercial high tunnels in Ohio during May and July 2012. Disease incidence ranged from 1 to 5%. Symptoms included wilting of shoots, dry, dark brown coalescent lesions on stems, brown discolored pith with a ladder-like appearance, and in some cases, adventitious root formation. Bacterial streaming was observed microscopically from necrotic stem tissue. Bacteria were isolated from surface-sterilized diseased stem tissue by plating 10-fold serial dilutions onto yeast dextrose carbonate (YDC) and Pseudomonas F (PF) agar media. The majority of the colonies recovered were similar in morphology on YDC: round and mucoid, with a greenish center that later became dry and winkled with a curly margin, and producing a yellow-green diffusible pigment. Colonies were creamy, yellow-brown in color and non-florescent on PF medium. Nine isolates from six plant samples were purified. All isolates were gram-negative, levan negative, oxidase positive, and potato rot negative. Three isolates were positive and six were negative for arginine dihydrolase activity. None induced a hypersensitive reaction in tobacco. All isolates grew at 37°C. The isolates were further identified by PCR assays using species-specific primers PC5/1-PC5/2 for Pseudomonas corrugata and PC1/1-PC1/2 for P. mediterranea (1,2). DNA of a reference P. mediterranea strain from Turkey was used as a positive control. A 600-bp band was amplified using P. mediterranea primers from the six arginine dihydrolase negative isolates recovered from four of six samples. An 1,100-bp band was amplified from the three arginine dihydrolase positive isolates from two other samples using P. corrugata primers. The 600-bp PCR products amplified from the P. mediterranea reference strain and isolate SM664-12 were purified and sequenced. The DNA sequence of SM664-12 was 99% aligned with that of the reference strain from Turkey and a BLAST search in NCBI indicated only one match with P. mediterranea strain G-229-21 (Accession No. EU117098.1), with an E-value 1e-145 and 84% identity. P. mediterranea (SM664-12) and P. corrugata (SM658-12) were each inoculated onto four 4-week-old tomato plants (cv. Mountain Fresh) by injecting a 50 µl bacterial suspension (108 CFU/ml) into the stem at the axil of the first true leaf (2). Negative control plants were injected with sterile water. Plants were kept in a mist chamber for 72 h at 25°C, then moved into a growth chamber maintained at 25/20°C day/night, 12-h light/dark, and 80% relative humidity. Plants exhibited dark brown lesions at the inoculation site after 4 weeks and brown discoloration of the pith developed, whereas no lesions were observed in control plants. The reisolated bacteria were tested by PCR and identified as P. corrugata and P. mediterranea. Therefore, we have confirmed that tomato pith necrosis in Ohio involves at least two bacteria, P. corrugata and P. mediterranea. Although tomato pith necrosis has been observed in Ohio since the 1990s, to our knowledge, this is the first confirmation of a causal agent as P. corrugata in Ohio and the first report of P. mediterranea causing tomato pith necrosis in the United States. References: (1) V. Catara et al. Eur. J. Plant Pathol. 106:753, 2000. (2) V. Catara et al. Int. J. Syst. Evol. Microbiol. 52:1749, 2002.

First Report of Xanthomonas gardneri Causing Bacterial Spot of Tomato in Ohio and Michigan.

In 2009 and 2010, outbreaks of bacterial spot characterized by significant fruit spotting occurred in at least 2,000 ha of commercial processing tomatoes in northwest Ohio and southeast Michigan. Losses were estimated at $7.8 million. Diseased fruit and foliage were collected from 32 Ohio and Michigan fields in 2010. Excised lesions from fruit and leaves were dipped briefly in 70% ethanol, air dried, and chopped into pieces in 10 mM potassium phosphate buffer (KPB), pH 7.4. Ten-fold serial dilutions in KPB were plated on yeast dextrose carbonate agar medium and 83 yellow mucoid colonies were purified. All isolates were gram negative and induced a hypersensitive response in tobacco (Nicotiana tabacum) plants 24 h after inoculation with a 108 CFU/ml bacterial suspension in water. All 83 isolates were identified as Xanthomonas spp. using genus-specific primers RST65/69 (2). Of these, 11 were identified as X. euvesicatoria and 8 as X. perforans using the species-specific primers RST27/28 (1) and JJ19/22 (5'-AACCCAACTAATTTCCCTC-3' and 5'-AACGAGATTTGTTACGAACC-3'; J. B. Jones, personal communication), respectively. DNA fingerprint profiles of 62 of the 64 remaining strains generated using BOX-PCR assays (4) were identical to the profile of X. gardneri type strain XCGA2. The DNA profiles of 2 of the 64 Xanthomonas strains did not resemble those of any reference strains. The 16S rDNA and ITS1 genes from two representative strains (SM174-10 and SM230-10) were PCR amplified, direct sequenced, and aligned using nBLAST with the same gene region from XCGA2 (GenBank Accession No. AF123093). Strains SM174-10 and SM230-10 differed from XCGA2 by 2 bp (99% nucleotide similarity). Pathogenicity tests were performed twice on 6-week-old tomato seedlings (cv. Peto 696). Three tomato seedlings were sprayed until runoff with strain SM174-10 (~108 CFU/ml), three seedlings were sprayed similarly with water (control treatment), and all six plants were grown under high relative humidity (24 s of mist per 12 min) at day/night temperatures of 29/23°C for 15 days. Seedlings inoculated with SM174-10 exhibited water-soaked lesions and chlorosis on the foliage, similar to field symptoms, within 14 days. Seedlings sprayed with water did not develop symptoms. Isolates cultured as described above from all three pathogen-inoculated seedlings were similar in morphology to strain SM174-10; no cultures were recovered from water-inoculated plants. The BOX-PCR fingerprint profile of a representative reisolated colony was identical to that of SM174-10. Although bacterial spot of tomato is a common disease in Ohio and Michigan, to our knowledge this is the first report of X. gardneri infecting tomatoes in these states and provides evidence that there may have been a shift in the primary causal agent of bacterial spot from X. euvesicatoria (3) to X. gardneri. References: (1) H. Bouzar et al. Phytopathology 84:39, 1994. (2) A. Obradovic et al. Eur. J. Plant Pathol. 11:285, 2004. (3) F. Sahin. Ph.D. Diss. The Ohio State University, Columbus, 1997. (4) D. J. Versalovic et al. Methods Mol. Cell. Biol. 5:25, 1994.

Chronic high Epstein-Barr viral load state and risk for late-onset posttransplant lymphoproliferative disease/lymphoma in children.

Increased use of serial EBV-PCR monitoring after pediatric transplantation has led to the identification of asymptomatic patients who carry very high viral loads over prolonged periods. The significance of this high-load state is unknown. We speculated that this state may identify patients at high risk for development of late PTLD/lymphoma. We reviewed data on 71 pediatric heart recipients who had serial viral load monitoring since 1997. Chronic high-load state was defined as the presence of >16,000 genome copies/mL whole blood on > or =50% of samples over at least 6 months. Among 20 high-load carriers (eight following prior PTLD, seven with prior symptomatic EBV infection, five without previous EBV disease), 9 (45%) developed late-onset PTLD 2.5-8.4 years posttransplant (including with four Burkitt's lymphoma). Among 51 controls with low (n = 39) or absent (n = 12) loads, only 2 (4%; p < 0.001 absent/low vs. high load) developed late PTLD/lymphoma. By multivariable analysis, high-load carrier state (OR = 12.4, 95% CI 2.1-74.4) and prior history of PTLD (OR = 10.7, 95% CI 1.9-60.6) independently predicted late PTLD. A chronic high EBV-load state is not benign and is a predictor of de novo or recurrent PTLD.

Development of recombinant adeno-associated virus vectors carrying small interfering RNA (shHec1)-mediated depletion of kinetochore Hec1 protein in tumor cells.

Transcript depletion using small interfering RNA (siRNA) technology represents a potentially valuable technique for the treatment of cancer. However, delivering therapeutic quantities of siRNA into solid tumors by chemical transfection is not feasible, whereas viral vectors efficiently transduce many human tumor cell lines. Yet producing sufficient quantities of viral vectors that elicit acute and selective cytotoxicity remains a major obstacle for preclinical and clinical trials. Using the invertebrate Spodoptera frugiperda (Sf9) cell line, we were able to produce high titer stocks of cytotoxic recombinant adeno-associated virus (rAAV) that express short hairpin RNA (shRNA) and that efficiently deplete Hec1 (highly expressed in cancer 1), or Kntc2 (kinetochore-associated protein 2), a kinetochore protein directly involved in kinetochore microtubule interactions, chromosome congression and spindle checkpoint signaling. Depletion of Hec1 protein results in persistent spindle checkpoint activation followed by cell death. Because Hec1 expression and activity are only present in mitotic cells, non-dividing cells were not affected by rAAV treatment. On the basis of the results of screening 56 human tumor cell lines with three different serotype vectors, we used a tumor xenograft model to test the effects in vivo. The effects of the shHec1 vector were evident in sectioned and stained tumors. The experiments with rAAV-shRNA vectors demonstrate the utility of producing vectors in invertebrate cells to obtain sufficient concentrations and quantities for solid tumor therapy. This addresses an important requirement for cancer gene therapy, to produce cytotoxic vectors in sufficient quantities and concentrations to enable quantitative transduction and selective killing of solid tumor cells.

The effect of gel lubrication on cuff leakage of double lumen tubes during thoracic surgery.

High-volume, low-pressure tracheal cuffs of disposable double lumen tubes may offer limited protection to the dependent lung if fluid leaks through folds in the inflated cuffs. This study was undertaken to determine the incidence of fluid leakage past the tracheal cuff and whether gel lubrication reduces the incidence. Fifty-five patients were randomly assigned to receive a double lumen tube with or without gel lubrication. The dependent lung was intubated. With the patient in the lateral position, methylthionium chloride was administered above the tracheal cuff via a pre-attached catheter. Fibreoptic bronchoscopy was performed to determine if dye had passed the tracheal cuff. Three patients were excluded. Dye leakage was seen in 12/27 and 3/25 patients in the unlubricated and lubricated group, respectively (p = 0.014). Gel lubrication significantly reduces fluid leakage past the tracheal cuff of a double lumen tube and should be considered for all thoracic surgical patients requiring one-lung ventilation.

The mechanisms and managements of hormone-therapy resistance in breast and prostate cancers.

Breast and prostate cancer are the most well-characterized cancers of the type that have their development and growth controlled by the endocrine system. These cancers are the leading causes of cancer death in women and men, respectively, in the United States. Being hormone-dependent tumors, antihormone therapies usually are effective in prevention and treatment. However, the emergence of resistance is common, especially for locally advanced tumors and metastatic tumors, in which case resistance is predictable. The phenotypes of these resistant tumors include receptor-positive, ligand-dependent; receptor-positive, ligand-independent; and receptor-negative, ligand-independent. The underlying mechanisms of these phenotypes are complicated, involving not only sex hormones and sex hormone receptors, but also several growth factors and growth factor receptors, with different signaling pathways existing alone or together, and with each pathway possibly linking to one another. In this review, we will discuss the potential mechanisms of antihormone-therapy resistance in breast and prostate cancers, especially focusing on the similarities and differences of these two cancers. We will also discuss novel agents that have been applied in clinical practice or with clinical potential in the future.

Report of Bacterial Leaf Spot on Collards and Turnip Leaves in Ohio.

In 2000, circular water-soaked lesions typical of bacterial leaf spot were observed on leaves of collards (Brassica oleracea L. var. viridis) throughout commercial fields in northwest Ohio. Light brown, rectangular, water-soaked lesions were observed on turnip leaves (Brassica rapa L.). Bacterial streaming from lesions on both crops was observed microscopically. Cream colored, fluorescent colonies were isolated from diseased tissues on Pseudomonas F medium, and eight representative colonies (four from collards and four from turnip) were selected and purified. Fatty acid methyl ester analysis was performed on all of the isolates. Two from collards and two from turnip were identified as Pseudomonas syringae pv. maculicola (mean similarity index = 0.82 [MIDI Inc., Newark, DE]). DNA extracts from pure cultures of the P. syringae pv. maculicola strains were used as template in a polymerase chain reaction (PCR) assay with primers derived from the region of the coronatine gene cluster controlling synthesis of the coronafacic acid moiety found in P. syringae pv. tomato and P. syringae pv. maculicola (CorR and CorF2) (D. Cuppels, personal communication). DNA from P. syringae pv. tomato strain DC3000 and P. syringae pv. maculicola strain 88-10 (2) served as positive controls, while water and DNA from Xanthomonas campestris pv. vesicatoria strain Xcv 767 were used as negative controls. The expected 0.65-kb PCR product was amplified from three of four strains (two from turnip and one from collards) and the positive control DNA, but not from the negative controls. Pathogenicity tests were performed twice on 6-week-old turnip ('Forage Star', 'Turnip Topper', 'Turnip Alamo', 'Turnip 7'), collard ('Champion') and mustard (Brassica juncea L. 'Southern Giant Curl') seedlings using the three PCR-positive strains. Premisted seedlings were spray-inoculated separately with each of the three strains (2 × 108 CFU/ml, 5 ml per plant) and a water control. Greenhouse temperatures were maintained at 20 ± 1°C. For both tests, all strains caused characteristic lesions on all of the crucifer cultivars within 5 days after inoculation; the control plants did not develop symptoms. To satisfy Koch's postulates, one of the turnip strains was reisolated from 'Turnip Topper' plants, and the collard strain was reisolated from 'Champion' plants. The three original and two reisolated strains induced a hypersensitive response in Mirabilis jalapa L. and Nicotiana tabacum L. var. xanthia plants 24 h after inoculation with a bacterial suspension (1 × 108 CFU/ml). The original and reisolated strains were compared using rep-PCR with the primer BOXA1R (1). The DNA fingerprints of the reisolated strains were identical to those of the original strains. To our knowledge, this is the first report of bacterial leaf spot on commercially grown collards and turnip greens in Ohio. References: (1) B. Martin et al. Nucleic Acids Res. 20:3479, 1992. (2) R. A. Moore et al. Can. J. Microbiol. 35:910, 1989.

Estrogen (E2) and glucocorticoid (Gc) effects on microglia and A beta clearance in vitro and in vivo.

The accumulation of fibrillar aggregates of beta Amyloid (A beta) in Alzheimer's Disease (AD) brain is associated with chronic brain inflammation. Although activated microglia (mu glia) can potentially clear toxic amyloid, chronic activation may lead to excessive production of neurotoxins. Recent epidemiological and clinical data have raised questions about the use of anti-inflammatory steroids (glucocorticoids, Gcs) and estrogens for treatment or prevention of AD. Since very little is known about steroid effects on mu glial interactions with amyloid, we investigated the effects of the synthetic Gc dexamethasone (DXM) and 17-beta estradiol (E2) in vitro in a murine mu glial-like N9 cell line on toxin production and intracellular A beta accumulation. To determine whether the steroid alterations of A beta uptake in vitro had relevance in vivo, we examined the effects of these steroids on A beta accumulation and mu glial responses to A beta infused into rat brain. Our in vitro data demonstrate for the first time that Gc dose-dependently enhanced mu glial A beta accumulation and support previous work showing that E2 enhances A beta uptake. Despite both steroids enhancing uptake, degradation was impeded, particularly with Gcs. Distinct differences between the two steroids were observed in their effect on toxin production and cell viability. Gc dose-dependently increased toxicity and potentiated A beta induction of nitric oxide, while E2 promoted cell viability and inhibited A beta induction of nitric oxide. The steroid enhancement of mu glial uptake and impedence of degradation observed in vitro were consistent with observations from in vivo studies. In the brains of A beta-infused rats, the mu glial staining in entorhinal cortex layer 3, not associated with A beta deposits was increased in response to A beta infusion and this effect was blocked by feeding rats prednisolone. In contrast, E2 enhanced mu glial staining in A beta-infused rats. A beta-immunoreactive (ir) deposits were quantitatively smaller, appeared denser, and were associated with robust mu glial responses. Despite the fact that steroid produced a smaller more focal deposit, total extracted A beta in cortical homogenate was elevated. Together, the in vivo and in vitro data support a role for steroids in plaque compaction. Our data are also consistent with the hypothesis that although E2 is less potent than Gc in impeding A beta degradation, long term exposure to both steroids could reduce A beta clearance and clinical utility. These data showing Gc potentiation of A beta-induced mu glial toxins may help explain the lack of epidemiological correlation for AD. The failure of both steroids to accelerate A beta degradation may explain their lack of efficacy for treatment of AD.

Pain management at the end of life.

Pain is a common finding in dying patients. Most patients who experience pain at the end of their lives can have their pain effectively treated by their primary care physicians. The key to pain management is good pain assessment and a working familiarity with pain medications. Opioids are particularly important, and primary care physicians should be comfortable in prescribing these medications and should be familiar with appropriate dosing regimens. Clinical and ethical concerns regarding the use of opioids are overestimated, and opioids can be used safely in most pain management situations.

The effect of cytokine gene polymorphisms on pediatric heart allograft outcome.

BACKGROUND: Cytokines play a major role in the inflammatory and immune responses that mediate allograft outcome. Several studies have shown that the production of cytokines varies among individuals and these variations are determined by genetic polymorphisms, most commonly within the regulatory region of the cytokine gene. The aim of this study was to assess the effect of these allelic variations on acute rejection after pediatric heart transplantation. METHODS: We performed cytokine genotyping using polymerase chain reaction-sequence specific primers in 93 pediatric heart transplant recipients and 29 heart donors for the following functional polymorphisms: tumor necrosis factor-alpha (TNF-alpha) (-308), interleukin (IL)-10 (-1082, -819, and -592), TGF-beta1 (codon 10 and 25), IL-6 (-174), and interferon-gamma (INF-gamma) (+874). The distribution of polymorphisms in this population did not differ from published controls. The patients were classified as either non-rejecters (0 or 1 episode) or rejecters (> 1 episode) based on the number of biopsy proven rejection episodes in the first year after transplantation. RESULTS: Forty-two of the 69 TNF-alpha patients (61%) in the low producer group were non-rejecters, while 9 of the 24 (37.5%) with high TNF-alpha were non-rejecters (p = 0.047). In contrast, IL-10 genotype showed the opposite finding. Forty-two of the 66 patients (64%) in the high and intermediate IL-10 group were non-rejecters, while 9 of the 26 (35%) in the low IL-10 group were non-rejecters (p = 0.011). The combination of low TNF-alpha with a high or intermediate IL-10 genotype was associated with the lowest risk of rejection (34/49 or 69% non-rejecters). Neither the distribution of the IL-6, INF-gamma, and TGF-beta1 genotype in recipients nor the donor genotype showed any association with acute rejection. CONCLUSION: Genetic polymorphisms that have been associated with low TNF-alpha and high IL-10 production are associated with a lower number of acute rejection episodes after pediatric heart transplantation.

Therapeutic implications of inflammation in atherosclerotic cardiovascular disease.

Atherosclerosis represents a spectrum of pathologic lesions with diverse clinical sequelae. In this review, we build upon the paradigm that arteriosclerosis represents an inflammatory disease. By examining mechanisms involved in the response to vascular injury, we can more effectively implement targeted therapy aimed at halting or regressing arteriosclerosis.

Equal opportunities, equal risks? Overuse injuries in female military recruits.

BACKGROUND: The rate of female personnel medically discharged from service in the British Army has been rising steadily since 1992 from around 3 per 1,000 per year to over 35 per 1,000 in 1996, although there has been only a minor increase in medical discharges for males over the same period. This paper examines the increasing rate of medical discharge in young female members of the British Army from an aetiological perspective and reviews the literature to identify risk factors that may be relevant. METHODS: Data from published military medical statistical reports were reviewed and the clinical records of a 10 per cent sample of females medically discharged for relevant conditions were examined. RESULTS: The majority of the excess medical discharges had occurred in females under the age of 22 and were due to musculoskeletal disorders and injuries caused by military training. Data from the clinical records showed that 75.5 per cent (37/49) of those medically discharged for these conditions were recruits. Stress fractures and other overuse syndromes accounted for 70.2 per cent of medical discharges among the recruits in the sample. CONCLUSION: Females undertaking strenuous exercise alongside males are at increased risk of injury. Risk factors include smoking, short stature, restricted dietary intake and menstrual disturbance. Equal opportunities legislation has been interpreted to require identical training for males and females, but some segregation of training may be acceptable provided the outcome of training is no less favourable to either gender, and this may reduce the excess risk of injury to females.

The case for beta-adrenergic blockade as prophylaxis against perioperative cardiovascular morbidity and mortality.

Perioperative morbidity and mortality are frequently cardiac in origin. Many studies have prospectively attempted to define risk factors for cardiac ischemic events. Although we can now identify high-risk patients, optimal cardioprotective management strategies remain unclear. Treatment with beta-adrenergic antagonists decreases myocardial oxygen consumption and is generally well tolerated. This article reviews the physiologic and clinical basis for using these agents as prophylaxis against cardiovascular events in high-risk surgical patients.