Metastatic effects of hydroxy-polycyclic aromatic hydrocarbons on liver cancer cells mediated by estrogen receptor α.

Hydroxy-polycyclic aromatic hydrocarbons (OH-PAHs) are a growing worldwide concern because of their persistence, ubiquity, and toxicity. Nonetheless, research on the toxicological mechanisms of OH-PAHs remains sparse, particularly concerning the risk of liver cancer. This study evaluated the effects of OH-PAHs on disrupting estrogen receptor α (ERα) and subsequently facilitating hepatocellular invasion and metastasis. Results revealed that all six OH-PAHs exhibited ERα agonistic activities at noncytotoxic levels, which were partially validated using molecular docking (MD) and molecular dynamics simulations (MDS). Furthermore, OH-PAHs with ERα agonistic properties stimulated a concentration-dependent increase in the migration and invasion of HepG2 cells. In addition, they disturbed the expression of target genes associated with epithelial-mesenchymal transition (EMT) and extracellular matrix (ECM), and the invasion effects were significantly reversed by adding an ERα antagonist. Our results suggest an essential role of ERα in the metastasis of liver cancer cells induced by OH-PAHs and emphasize their potential ecological and health hazards.

[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR­1301­3p/KIF23 axis.

Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR­545­3p (5'­TGGCTCAGTTCAGCAGGAAC­3') was actually for miR­24­3p (5'­UGGCUCAGUUCAGCAGGAACAG­3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR­670­5p also appeared to have potentially been written incorrectly. After having drawn these matters to the attention of the authors, they realized that these sequences had indeed been written incorrectly in Table I.  The corrected version of Table I, featuring the correct forward and reverse primer sequences for both miR­670­5p and miR­545­3p, is shown opposite. The authors wish to thank the interested reader for drawing this error to their attention, and are grateful to the Editor of Molecular Medicine Reports for allowing them this opportunity to publish a Corrigendum. They also apologize to the readership for any inconvenience caused. [Molecular Medicine Reports 25: 202, 2022; DOI: 10.3892/mmr.2022.12718].

YTHDC2 mediated RNA m6A modification contributes to PM2.5-induced hepatic steatosis.

Exposure to fine particulate matter (PM2.5) is a significant risk factor for hepatic steatosis. The N6-methyladenosine (m6A) is implicated in metabolic disturbances triggered by exogenous environmental factors. However, the role of m6A in mediating PM2.5-induced hepatic steatosis remains unclear. Herein, male C57BL/6J mice were subjected to PM2.5 exposure throughout the entire heating season utilizing a real-ambient PM2.5 whole-body inhalation exposure system. Concurrently, HepG2 cell models exposed to PM2.5 were developed to delve the role of m6A methylation modification. Following PM2.5 exposure, significant hepatic lipid accumulation and elevated global m6A level were observed both in vitro and in vivo. The downregulation of YTHDC2, an m6A-binding protein, might contribute to this alteration. In vitro studies revealed that lipid-related genes CEPT1 and YWHAH might be targeted by m6A modification. YTHDC2 could bind to CDS region of them and increase their stability. Exposure to PM2.5 shortened mRNA lifespan and suppressed the expression of CEPT1 and YWHAH, which were reversed to baseline or higher level upon the enforced expression of YTHDC2. Consequently, our findings indicate that PM2.5 induces elevated m6A methylation modification of CEPT1 and YWHAH by downregulating YTHDC2, which in turn mediates the decrease in the mRNA stabilization and expression of these genes, ultimately resulting in hepatic steatosis.

Endocrine disrupting effects of parabens in zebrafish (Danio rerio): New insights from transcriptomics, metabolomics, and molecular dynamics simulation.

Parabens (PBs), a group of widely used synthetic preservatives with potential endocrine disrupting activity, have been detected with increasing frequency in organisms and environmental matrices. This study assessed the hormone interference effects of four typical PBs, namely methylparaben (MeP), ethylparaben (EtP), propylparaben (PrP), and butylparaben (BuP), in zebrafish and elucidated the probable underlying mechanisms. Transcriptomic and metabolomic analyses showed that the differentially expressed genes and metabolites were associated with the tyrosine metabolism, arachidonate metabolism, and glycerophospholipid metabolism, indicating they were essential precursors of steroid hormone biosynthesis and metabolism. Histopathological analysis revealed impaired gonad development in the zebrafish exposed to PBs, as evidenced by the significantly increased vitellogenin (VTG) and estradiol (E2) levels. Furthermore, molecular dynamics simulation suggested that the four PBs could preferentially activate the zebrafish estrogen receptor, zfERß2, to regulate the downstream pathways. Disruption of the amino acid metabolism and lipid metabolism, and activation of zfERß2 signaling pathway were found to be the key mechanisms for the endocrine disrupting effects of PBs. The hormone interference effects of PBs were apparently dependent on the shared oxybenzene on their structures, with the degree of interference determined largely by the length of their alkyl chains. These findings provide new insights into the endocrine disrupting effects of PBs and could help better assess their risk to human health.

Nontargeted Identification of Organic Components in Fine Particulate Matter Related to Lung Tumor Metastasis Based on an Adverse Outcome Pathway Strategy.

Emerging studies implicate fine particulate matter (PM2.5) and its organic components (OCs) as urgent hazard factors for lung cancer progression in nonsmokers. Establishing the adverse outcome pathway (AOP)-directed nontargeted identification method, this study aimed to explore whether PM2.5 exposure in coal-burning areas promoted lung tumor metastasis and how we identify its effective OCs to support traceability and control of regional PM2.5 pollution. First, we used a nude mouse model of lung cancer for PM2.5 exposure and found that the exposure significantly promoted the hematogenous metastases of A549-Luc cells in lung tissues and the adverse outcomes (AOs), with key events (KEs) including the changed expression of epithelial-mesenchymal transition (EMT) markers, such as suppression of E-cad and increased expression of Fib. Subsequently, using AOs and KEs as adverse outcome directors, we identified a total of 35 candidate chemicals based on the in vitro model and nontargeted analysis. Among them, tributyl phosphate (C12H27O4P), 2-bromotetradecane (C14H29Br), and methyl decanoate (C11H22O2) made greater contributions to the AOs. Finally, we clarified the interactions between these OCs and EMT-activating transcription factors (EMT-ATFs) as the molecular initiation event (MIE) to support the feasibility of the above identification strategy. The present study updates a new framework for identifying tumor metastasis-promoting OCs in PM2.5 and provides solid data for screening out chemicals that need priority control in polluted areas posing higher lung cancer risk.

Lung injuries induced by ozone exposure in female mice: Potential roles of the gut and lung microbes.

Ozone (O3) is one of the most harmful pollutants affecting health. However, the potential effects of O3 exposure on microbes in the gut-lung axis related to lung injuries remain elusive. In this study, female mice were exposed to 0-, 0.5- and 1-ppm O3 for 28 days, followed by routine blood tests, lung function tests and histopathological examination of the colon, nasal cavity and lung. Mouse faeces and lungs were collected for 16s rRNA sequencing to assess the overall microbiological profile and screen for key differential enriched microbes (DEMs). The key DEMs in faecal samples were Butyricimonas, Rikenellaceae RC9 and Escherichia-Shigella, whereas those in lung samples were DNF00809, Fluviicola, Bryobacter, Family XII AD3011 group, Sharpea, MND1 and unclassified Phycisphaeraceae. After a search in microbe-disease databases, these key DEMs were found to be associated with lung diseases such as lung neoplasms, cystic fibrosis, pneumonia, chronic obstructive pulmonary disease, respiratory distress syndrome and bronchiectasis. Subsequently, we used transcriptomic data from Gene Expression Omnibus (GEO) with exposure conditions similar to those in this study to cross-reference with Comparative Toxicogenomic Database (CTD). Il-6 and Ccl2 were identified as the key causative genes and were validated. The findings of this study suggest that exposure to O3 leads to significant changes in the microbial composition of the gut and lungs. These changes are associated with increased levels of inflammatory factors in the lungs and impaired lung function, resulting in an increased risk of lung disease. Altogether, this study provides novel insights into the role of microbes present in the gut-lung axis in O3 exposure-induced lung injury.

Invisible Hand behind Female Reproductive Disorders: Bisphenols, Recent Evidence and Future Perspectives.

Reproductive disorders are considered a global health problem influenced by physiological, genetic, environmental, and lifestyle factors. The increased exposure to bisphenols, a chemical used in large quantities for the production of polycarbonate plastics, has raised concerns regarding health risks in humans, particularly their endocrine-disrupting effects on female reproductive health. To provide a basis for future research on environmental interference and reproductive health, we reviewed relevant studies on the exposure patterns and levels of bisphenols in environmental matrices and humans (including susceptible populations such as pregnant women and children). In addition, we focused on in vivo, in vitro, and epidemiological studies evaluating the effects of bisphenols on the female reproductive system (the uterus, ovaries, fallopian tubes, and vagina). The results indicate that bisphenols cause structural and functional damage to the female reproductive system by interfering with hormones; activating receptors; inducing oxidative stress, DNA damage, and carcinogenesis; and triggering epigenetic changes, with the damaging effects being intergenerational. Epidemiological studies support the association between bisphenols and diseases such as cancer of the female reproductive system, reproductive dysfunction, and miscarriage, which may negatively affect the establishment and maintenance of pregnancy. Altogether, this review provides a reference for assessing the adverse effects of bisphenols on female reproductive health.

New insights into triazole fungicide-caused hematopoietic abnormality in zebrafish based on GRα screening developmental toxicity.

Triazole fungicides (TFs) are known to be common environmental contaminants that can be toxic to aquatic animals, but their developmental toxicity is not fully understood. To address this gap, we first used a glucocorticoid receptor α (GRα)-mediated dual luciferase reporter gene system to explore the possible development toxicity of ten TFs and found that flusilazole (FLU) exhibited stronger agonistic activity against GRα. Subsequent transcriptome sequencing showed that FLU exposure affected GRα activation and hematopoiesis associated with a variety of biological processes, including responses to corticosteroid release, embryonic hematopoiesis, erythroid differentiation, and the development of hematopoietic or lymphoid organs. Furthermore, based on in situ hybridization and staining techniques, we clarified that FLU decreased the expression of the primitive hematopoietic marker genes gata1 and pu.1. and caused the defects in the posterior blood island (PBI), thereby impacting intermediate hematopoietic processes. Also, FLU significantly reduced the expression of the crucial hematopoietic gene cmyb and disrupted the production of erythrocytes and bone marrow cells during definitive hematopoiesis. Consistently, we found that FLU induced lesions in the kidney, a hematopoietic organ, including the infiltration of inflammatory cells, tubular collapse, reduced tubular filtration area, and interstitial hydronephrosis. We also found that FLU increased aberrant red blood cells in the peripheral blood of zebrafish. These findings provide new insights into the developmental toxicity and ecotoxicological risk of TFs.

Bisphenol B and bisphenol AF exposure enhances uterine diseases risks in mouse.

Bisphenol A (BPA) analogs, bisphenol B (BPB) and bisphenol AF (BPAF) have been widely detected in the environment and human products with increasing frequency. However, uterine health risks caused by BPB and BPAF exposure need to be further elucidated. The study aimed to explore whether BPB or BPAF exposure will induce adverse outcomes in uterus. Female CD-1 mice were continuously exposed to BPB or BPAF for 14 and 28 days. Morphological examination showed that BPB or BPAF exposure caused endometrial contraction, decreased epithelial height, and increased number of glands. Bioinformatics analysis indicated that both BPB and BPAF disturbed the immune comprehensive landscape of the uterus. In addition, survival and prognosis analysis of hub genes and tumor immune infiltration evaluation were performed. Finally, the expression of hub genes was verified by quantitative real-time PCR (qPCR). Disease prediction found that eight of the BPB and BPAF co-response genes, which participated in the immune invasion of the tumor microenvironment, were associated with uterine corpus endometrial carcinoma (UCEC). Importantly, the gene expression levels of Srd5a1 after 28-day BPB and BPAF exposure were 7.28- and 25.24-fold higher than those of the corresponding control group, respectively, which was consistent with the expression trend of UCEC patients, and its high expression was significantly related to the poor prognosis of patients (p = 0.003). This indicated that Srd5a1 could be a valuable signal of uterus abnormalities caused by BPA analogs exposure. Our study revealed the key molecular targets and mechanisms of BPB or BPAF exposure induced uterine injury at the transcriptional level, providing a perspective for evaluating the safety of BPA substitutes.

Overview of PM2.5 and health outcomes: Focusing on components, sources, and pollutant mixture co-exposure.

PM2.5 varies in source and composition over time and space as a complicated mixture. Consequently, the health effects caused by PM2.5 varies significantly over time and generally exhibit significant regional variations. According to numerous studies, a notable relationship exists between PM2.5 and the occurrence of many diseases, such as respiratory, cardiovascular, and nervous system diseases, as well as cancer. Therefore, a comprehensive understanding of the effect of PM2.5 on human health is critical. The toxic effects of various PM2.5 components, as well as the overall toxicity of PM2.5 are discussed in this review to provide a foundation for precise PM2.5 emission control. Furthermore, this review summarizes the synergistic effect of PM2.5 and other pollutants, which can be used to draft effective policies.

Exploration of the damage and mechanisms of BPS exposure on the uterus and ovary of adult female mice.

Bisphenol S (BPS) has been followed with interest for its endocrine disrupting effects, but exploration on the reproductive system of adult females is lack of deep investigation. In the present study, adult female CD-1 mice were treated with BPS for 28 days at 300 µg/kg/day. After that, uteruses and ovaries were harvested for histopathological examination, RNA-seq analysis, and diseases risk prediction. Hematoxylin-eosin (H&E) staining results showed significant histological alterations in the uterus and ovary of the BPS-exposed mice. Bioinformatics analysis of the RNA-seq screened a certain number of differentially expressed genes (DEGs) in both uterus and ovary between BPS group and their corresponding vehicle control groups (Veh), respectively. Functional enrichment analysis of DEGs found that hormone metabolism and immunoinflammatory related pathways were enriched. Disease risk evaluation of the hub genes was performed and the results indicated that diseases associated with uterus and ovary were mainly related to tumors and cancers. Further pan cancer and ovarian cancer survival analysis based on human diseases database pointed out, Foxa1, Gata3, S100a8 and Shh for uterus, Itgam, Dhcr7, Fdps, Hmgcr, Hsd11b1, Hsd3b1, Ptges, F3, Fn1, Ptger4 and Srd5a1 for ovary were significant correlation with cancer. The findings suggest that BPS causes some histopathological changes, alters the expressions of hub genes, enhances uterine and ovarian tumors or even cancer risks.

Comprehensive assessment of estrogenic activities of parabens by in silico approach and in vitro assays.

Parabens are ubiquitous pollutants in the environment and humans due to their wide applications in food, pharmaceuticals, and personal care products. Although the estrogenic activity of some parabens has been confirmed, the underlying mechanisms and the structure-estrogenic activity relationship are still largely unclear. Here, we systematically used in silico and in vitro approaches to investigate the estrogenic potency of typical parabens, including methyl-, ethyl-, propyl-, iso-propyl-, butyl-, iso-butyl- and benzyl-paraben. Molecular dynamics simulations and binding free energy calculations were combined to investigate the atomic-level mechanism of paraben binding to estrogen receptors (ERs). Computational analysis showed that ER were the targets of tested parabens and kept a stable agonist conformation. The calculated total binding free energies suggested that van der Waals interactions were the major driving forces for paraben-ER interaction and correlated with the structure of paraben side chains. In in vitro assays, paraben with an aromatic side chain, benzyl-paraben, showed the strongest estrogenic activity at 0.01 µM and the EC50 at 0.796 ± 0.307 µM, on par with levels commonly detected in human organs. Among tested parabens with an alkyl side chain, the estrogenicity increased as the side chain length increased from 1 to 4, but no significant difference appeared between parabens with isomeric alkyl side chains (propyl- vs isopropyl and butyl- vs iso-butylparaben). The estrogenic activity of parabens was significantly related to the calculated binding energies (R2 = 0.94, p = 0.0012), depending on the side chains of parabens. Our findings provide a significant mechanism for parabens to disrupt estrogenic function and considerations for structural optimization from the perspective of environmental protection.

New Insights into Prenatal NO2 Exposure and Behavioral Abnormalities in Male Offspring: Disturbed Serotonin Metabolism and Delayed Oligodendrocyte Development.

Epidemiological studies show that prenatal exposure to nitrogen dioxide (NO2) might cause behavioral abnormalities in childhood. However, toxicological mechanisms for such effects remain unclear, and it is still difficult to define adverse outcome pathways linking exposures to behavioral phenotypes. In this study, by exposing pregnant mice to NO2 (2.5 ppm, 5 h/day) throughout gestation, we provided the first experimental evidence that prenatal NO2 exposure did cause anxiety- and depression-like behaviors in weaning male offspring but not females. Specifically, the behavioral abnormalities were associated with abnormal myelination and the alterations attributed to the delayed oligodendrocyte (OL) development in the fetus and the early stage after birth. The expression of platelet-derived growth factor receptor α (Pdgfr-α) and Olig2 significantly decreased in the NO2 group at E13.5 and E15.5, and the expression of Olig2, adenomatous polyposis coli colon (Cc1), and myelin basic protein (Mbp) was reduced in offspring at PNDs 1, 7, and 21. We performed the targeted metabolomic analysis of neurotransmitters in the placenta and found that prenatal exposure to NO2 disturbed the metabolism of placental neurotransmitters. Serotonin (5-HT) was transferred from the placenta to the fetus at E10.5, and its accumulation in the fetal forebrain might affect oligodendrocyte progenitor cell (OPC) differentiation and OL maturation and eventually be involved in behavioral abnormalities. Our findings provide new insights into the association between prenatal NO2 exposure with anxiety- and depression-like behaviors in male offspring.

Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR­1301­3p/KIF23 axis.

In recent years, circular RNAs (circRNAs/circs) have attracted significant attention due to their potentially important functions in a variety of human cancer types. circ_0067934 is a newly identified circRNA, the role of which in gastric cancer (GC) has yet to be reported, to the best of our knowledge. In the present study, the expression levels of circ_0067934, microRNA (miR)­1301­3p and kinesin family member 23 (KIF23) in GC cells were detected via reverse transcription­quantitative PCR. Cell proliferation was measured using Cell Counting Kit­8 assays and EdU staining. Wound healing and Transwell assays were performed to assess cell migration and invasion, respectively. Western blotting was performed to measure the protein expression levels of Ki67, proliferating cell nuclear antigen, MMP2, MMP9 and KIF23. The starBase database and luciferase reporter assays were used to predict and verify the binding between circ_0067934 and miR­1301­3p, as well as KIF23, in GC cells. The results demonstrated that circ_0067934 expression was upregulated in GC cells, and circ_0067934 silencing significantly inhibited GC cell proliferation, migration and invasion. In addition, miR­1301­3p was regulated by circ_0067934, and miR­1301­3p overexpression suppressed GC cell migration, invasion and proliferation. miR­1301­3p was found to target KIF23, and KIF23 overexpression reversed the effects of circ_0067934 silencing and miR­1301­3p overexpression on cell proliferation, migration and invasion. In conclusion, circ_0067934 may regulate the proliferation, invasion and migration of GC cells via the miR­1301­3p/KIF23 signaling axis, which may represent a novel therapeutic target for GC metastasis.

Risk factors and correlation of colorectal polyps with type 2 diabetes mellitus.

BACKGROUND: Colorectal polyp is a common disease of the gastrointestinal tract, which is closely related to colorectal cancer. Diabetes mellitus (DM) is a major public health disease that seriously threatens human health. This study aimed to investigate the risk factors of colorectal polyps and its relationship with type 2 DM (T2DM). METHODS: A total of 352 patients with colorectal polyps (diagnosed by colonoscopy) in our hospital from June 2018 to June 2020 were enrolled as the observation group, and 201 healthy people with normal colonoscopy results were selected as the control group. The levels of blood lipids, blood glucose, liver function, serum uric acid (UA), and glycosylated hemoglobin (HbA1c) were compared between the two groups. Univariate and multiple logistic regression analyses were performed to analyze the risk factors related to colorectal polyps. RESULTS: Compared to the control group, the levels of HbA1c, fasting plasma glucose (FPG), 2-hour post-meal blood glucose (2hPG), total cholesterol (TC), and serum UA in the observation group were significantly higher (P<0.05). Univariate analysis showed that the incidence of colorectal polyps was significantly correlated with gender, smoking, age, non-alcoholic fatty liver disease (NAFLD), and type 2 diabetes mellitus (T2DM) (P<0.05). Multiple Logistic regression analysis showed that gender (male), age (≥60 years), and T2DM were independent risk factors for colorectal polyps (P<0.05). CONCLUSIONS: Abnormal metabolic indices may be closely related to the development of colorectal polyps. Gender (male), age (≥60 years), smoking, NAFLD, T2DM, as well as increased blood glucose, UA, and TC were identified as the risk factors for colorectal polyps.

New insights into potential estrogen agonistic activity of triazole fungicides and coupled metabolic disturbance.

Triazole fungicides are highly effective pesticides widely used in plant protection, which has caused potential hazards to human health and ecological safety. To fully understand their potential hepatotoxicity, we first analyzed the transcriptome profiles in HepG2 cells treated with five triazole fungicides (hexiconazole (HEX), tebuconazole (TEB), propiconazole (PRO), cyproconazole (CYP), and difenoconazole (DIF)), and found that these pesticides remarkably affected estrogen signaling pathways, especially estrogen synthesis. Furthermore, we found that TEB, CYP, PRO and DIF had agonistic activity towards estrogen receptor alpha (ERα) and elucidated the binding mode of triazole ligands with ERα using the reporter gene assay and molecular docking. Four triazole fungicides regulated eight major genes involved in estrogen synthesis (StAR, CYP11A1, 3ßHSD2, CYP17, CYP19, CYP3A4, CYP1A2 and SCP2) and stimulated the secretion of 17ß-estradiol (E2). Finally, we assessed possible metabolic outcomes caused by abnormal estrogen synthesis, and found that triazole fungicides affected the metabolism of various macromolecules (such as lipid, amino acid, and carbohydrate) and signal transduction. These findings will provide new insights into endocrine-disrupting effects of triazole fungicides and highlight their potential ecological and health risks.

Sulfur dioxide-induced exacerbation of airway inflammation via reactive oxygen species production and the toll-like receptor 4/nuclear factor-κB pathway in asthmatic mice.

Sulfur dioxide (SO2) is a common air pollutant that can exacerbate asthmatic airway inflammation. The mechanisms underlying these effects are not yet fully understood. In this study, we investigated the effects of SO2 exposure (10 mg/m3) on asthmatic airway inflammation in ovalbumin-induced asthmatic mice. Our results showed that SO2 exposure alone induced slight airway injury, decreased superoxide dismutase activity, and increased nuclear factor-κB (NF-κB) expression in the lungs of mice. Moreover, SO2 exposure in asthmatic mice induced marked pathological damage, significantly increased the counts of inflammatory cells (e.g., macrophages, lymphocytes, and eosinophils) in bronchoalveolar lavage fluid, and significantly enhanced malondialdehyde and glutathione levels in the lungs. Moreover, the expression of toll-like receptor 4 (TLR4), NF-κB, pro-inflammatory cytokines (e.g., tumor necrosis factor α and interleukin-6), and type II T-helper cell (Th2) cytokines was found to be elevated in the mice exposed to SO2 and ovalbumin compared to those exposed to ovalbumin alone. These results suggest that SO2 amplifies Th2-mediated inflammatory responses, which involve reactive oxygen species and TLR4/NF-κB pathway activation; these can further enhance Th2 cytokine expression and eosinophilic inflammation. Thus, our findings provide important evidence to understand a potential mechanism through which SO2 may exacerbate airway asthmatic inflammation.

Photo-degradation behavior of seven benzoylurea pesticides with C3N4 nanofilm and its aquatic impacts on Scendesmus obliquus.

Present concerns on the residual benzoylurea pesticides (BUPs) are rapidly climbing as their market shares increase and now seven typical compounds were picked to study their photo-degradation behavior and ecological impacts. Carbon nitride (C3N4) nanofilm at a thickness of 50-80 nm was built on the glass slides and utilized to evaluate the photostability of pesticides under visible light. The results showed that the nano-C3N4 can promote the degradation efficiency of BUPs and it follows the first-order dynamic mechanism. They could be divided into three categories with the substituents and their degradations were discriminated in order of chlorofluoro-, chlorofluoroalkoxy- and chlorofluorophenoxy- substituted ones. Analyzing the intermediates by UHPLC-MS, it can be speculated that the similar pathways came to BUPs such as cleavage of urea-bridge, hydroxylation and dehalogenation. It is attractive that they all passed into a same molecule, 2-fluorobenzamide (m/z, 301.14). Moreover Scendesmus obliquus was applied to indicate the ecological impacts of originals and their photoproducts. Exposed to pesticides, the levels of chlorophyll a demonstrated much more inhibition than chlorophyll b. Lufenuron and chlorfuazuron among seven showed the higher toxicity for algal cells and finally the photodegradation products showed the lowest toxicity. The activities of antioxidant enzymes happened to a significant remedy after photodegradation. It can be concluded that the residual BUPs under visible-light irradiation may degrade through similar pathways and reduce the aquatic toxicity with the presence of C3N4 nanofilm.