RESUMEN
Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.
RESUMEN
The average content of casein in yak milk is 40.2 g/L. Casein can be degraded by enzymatic digestion or food processing to produce abundant degradation peptides. International researchers have studied the degradation peptides of yak milk casein by using multiple techniques and methods, such as in vitro activity tests, cellular experiments, proteomics, bioinformatics, etc., and found that the degradation peptides have a wide range of functional activities that are beneficial to the human body, such as angiotensin-converting enzyme (ACE) inhibitory, antioxidant, anti-inflammatory, antidiabetic, antimicrobial, anticancer, and immunomodulatory activities, etc., and it has been proved that the types and strengths of functional activities are closely related to the structural characteristics of the peptides. This paper describes the characteristics of yak milk proteins, the functional activities, and mechanism of action of degraded peptides. Based on the types of functional activities of yak milk casein degradation peptides, we classified and elucidated the effects of structural factors, such as peptide molecular weight, peptide length, amino acid sequence, physicochemical properties, electrical charge, hydrophobicity, spatial conformation, chain length, and the type of enzyme on these activities. It reveals the great potential of yak milk casein degradation peptides as functional active peptide resources and as auxiliary treatments for diseases. It also provides important insights for analyzing yak casein degradation peptide activity and exploring high-value utilization.
Asunto(s)
Caseínas , Leche , Péptidos , Caseínas/química , Caseínas/metabolismo , Animales , Leche/química , Bovinos , Péptidos/química , Péptidos/farmacología , Péptidos/metabolismo , Humanos , Antioxidantes/química , Antioxidantes/farmacología , Secuencia de Aminoácidos , Inhibidores de la Enzima Convertidora de Angiotensina/química , Inhibidores de la Enzima Convertidora de Angiotensina/farmacología , Inhibidores de la Enzima Convertidora de Angiotensina/metabolismo , ProteolisisRESUMEN
The objective of this study was to explore the effects and mechanisms of the combination of isobavachalcone (IBC) and doxorubicin (DOX) on the progression of anaplastic thyroid cancer (ATC). Cell viability of 8505C and CAL62 cells was observed by CCK-8 assay. Kits were used to detect the presence of reactive oxygen species (ROS), glutathione (GSH), malondialdehyde (MDA), and cellular iron. Protein expression of solute carrier family 7 member 11 (SLC7A11) and glutathione peroxidase 4 (GPX4) was detected using western blot, and CD31 was detected through immunofluorescence. Tumor xenograft models of 8505C cells were constructed to observe the effect of IBC and DOX on ATC growth in vivo. The co-administration of IBC and DOX exhibited a synergistic effect of suppressing the growth of 8505C and CAL62 cells. The concurrent use of IBC and DOX resulted in elevated iron, ROS, and MDA levels, while reducing GSH levels and protein expression of SLC7A11 and GPX4. However, the Fer-1 ferroptosis inhibitor effectively counteracted this effect. In vitro and in vivo, the inhibitory effect on ATC cell proliferation and tumor growth was significantly enhanced by the combination of IBC and DOX. The combination of IBC and DOX can inhibit the growth of ATC by activating ferroptosis, and might prove to be a potent chemotherapy protocol for addressing ATC.
Asunto(s)
Chalconas , Doxorrubicina , Sinergismo Farmacológico , Ferroptosis , Especies Reactivas de Oxígeno , Carcinoma Anaplásico de Tiroides , Neoplasias de la Tiroides , Ferroptosis/efectos de los fármacos , Doxorrubicina/farmacología , Carcinoma Anaplásico de Tiroides/tratamiento farmacológico , Carcinoma Anaplásico de Tiroides/patología , Carcinoma Anaplásico de Tiroides/metabolismo , Animales , Humanos , Chalconas/farmacología , Neoplasias de la Tiroides/tratamiento farmacológico , Neoplasias de la Tiroides/patología , Neoplasias de la Tiroides/metabolismo , Línea Celular Tumoral , Especies Reactivas de Oxígeno/metabolismo , Progresión de la Enfermedad , Ratones , Ensayos Antitumor por Modelo de Xenoinjerto , Proliferación Celular/efectos de los fármacos , Ratones Desnudos , Supervivencia Celular/efectos de los fármacos , Glutatión/metabolismo , Glutatión/efectos de los fármacos , Antibióticos Antineoplásicos/farmacología , Fosfolípido Hidroperóxido Glutatión Peroxidasa/metabolismoRESUMEN
Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae, was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato (Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana, and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.
RESUMEN
Gene therapy has shown significant potential in treating various diseases, particularly inherited blood disorders such as hemophilia, sickle cell disease, and thalassemia. Advances in understanding the regulatory network of disease-associated genes have led to the identification of additional therapeutic targets for treatment, especially for ß-hemoglobinopathies. Erythroid regulatory factor BCL11A offers the most promising therapeutic target for ß-hemoglobinopathies and reduction of its expression using the commercialized gene therapy product Casgevy was approved for use in the UK and USA in 2023. Notably, the emergence of innovative gene editing technologies has further broadened the gene therapy landscape, presenting new possibilities for treatment. Intensive studies indicate that base editing and prime editing, built upon CRISPR technology, enable precise single-base modification in hematopoietic stem cells for addressing inherited blood disorders ex vivo and in vivo. In this review, we present an overview of the current landscape of gene therapies, focusing on clinical research and gene therapy products for inherited blood disorders, evaluation of potential gene targets, and the gene editing tools employed in current gene therapy practices, which provides an insight for the establishment of safer and more effective gene therapy methods for a wider range of diseases in the future.
RESUMEN
BACKGROUND: Although high ultraprocessed food (UPF) consumption has been linked with increased mortality risk in the general population, whether UPFs harm participants with a history of cancer remains unclear. OBJECTIVES: This study aimed to evaluate the association of UPF consumption with mortality among participants with a history of cancer. METHODS: Prospective cohort analysis was conducted on 13,640 participants with a history of cancer from the UK Biobank. UPFs were defined by the Nova classification. UPF consumption was calculated as the weight proportion of UPFs in the total food consumption. Cox proportional hazard models were used to assess the association between UPF consumption and mortality among participants with a history of cancer. RESULTS: The median UPF consumption was 29.25% (interquartile range [IQR]: 19.46%-40.62%) for males and 25.81% (IQR: 16.61%-36.35%) for females in the total diet among participants with a history of cancer. During a median follow-up of 10.77 years, 1611 deaths were documented. Multivariable-adjusted hazard ratios (95% confidence intervals) among participants in the highest quartile of UPF consumption relative to the lowest were 1.17 (1.02, 1.35) for all-cause mortality and 1.22 (1.03, 1.44) for cancer-related mortality. CONCLUSIONS: Higher UPF consumption after the diagnosis among participants with a history of cancer is associated with higher risk of mortality.
Asunto(s)
Manipulación de Alimentos , Neoplasias , Humanos , Masculino , Femenino , Neoplasias/mortalidad , Estudios Prospectivos , Persona de Mediana Edad , Anciano , Dieta , Adulto , Modelos de Riesgos Proporcionales , Factores de Riesgo , Reino Unido/epidemiología , Estudios de CohortesRESUMEN
OBJECTIVE: Lifestyle factors after cancer diagnosis could influence cancer survival. This study aimed to investigate the joint effects of smoking, physical activity, alcohol consumption, diet and sleep duration on all-cause, cancer and non-cancer mortality of cancer survivors in UK biobank. METHODS: The follow-up period concluded in December 2021, with post-diagnostic lifestyle factors assessed at baseline. A lifestyle score ranging from 0 to 5 was assigned based on adherence to the selected lifestyle factors. The study employed Cox regression models for hazard ratios (HRs) and Kaplan-Meier for survival rates, with stratified and sensitivity analyses to assess the robustness of our findings under various assumptions. RESULTS: During a median follow-up of 12.7 years, 5652 deaths were documented from 34,184 cancer survivors. Compared to scoring 0-1, the HRs (95% CIs) for all-cause mortality with lifestyle scores of 2, 3, 4, and 5 were 0.70 (95% CI: 0.64, 0.76), 0.57 (0.52, 0.62), 0.50 (0.45, 0.54) and 0.43 (0.38, 0.48), respectively. Specific cancer types, particularly digestive, breast, female reproductive, non-solid, and skin cancers, showed notable benefits from adherence to healthy lifestyle, with the HRs of 0.55 (0.39, 0.79), 0.54 (0.42, 0.70), 0.32 (0.19, 0.53), 0.58 (0.39, 0.86), and 0.36 (0.28, 0.46) for lifestyle score of 5, respectively. Stratified analyses indicated the association was particularly significant among those with normal/lower BMI and higher Townsend Deprivation Index (Pinteraction = 0.001 and < 0.001, respectively). CONCLUSIONS: Healthier lifestyles were significantly linked with reduced mortality among cancer survivors. These findings highlight the need for adherence to healthy lifestyle habits to improve survival.
Asunto(s)
Consumo de Bebidas Alcohólicas , Supervivientes de Cáncer , Ejercicio Físico , Estilo de Vida , Neoplasias , Humanos , Femenino , Masculino , Estudios Prospectivos , Persona de Mediana Edad , Supervivientes de Cáncer/estadística & datos numéricos , Neoplasias/mortalidad , Reino Unido/epidemiología , Consumo de Bebidas Alcohólicas/epidemiología , Anciano , Fumar/epidemiología , Dieta , Adulto , Modelos de Riesgos ProporcionalesRESUMEN
IMPORTANCE: Mixed data exist in the literature regarding the impact of obesity on midurethral sling (MUS) failure rates. OBJECTIVE: The aim of this study was to evaluate the impact of obesity and Hispanic ethnicity on MUS failure. STUDY DESIGN: This was a retrospective cohort study of females who underwent MUS surgery, alone or with concomitant prolapse repair, with at least 1 year of follow-up. Body mass index (BMI) classes were categorized as normal (<25 kg/m2), overweight (25-29.9 kg/m2), obese (30-39.9 kg/m2), and severe obesity (≥40 kg/m2). The primary outcome was MUS failure, defined as a composite of subjectively unchanged or worsened symptoms or need for additional procedures. Secondary outcomes included risk factors related to MUS failure and the effect of ethnicity on MUS failure rates. RESULTS: A total of 322 women were included for analysis. The mean age was 52.3 years. Increasing BMI was associated with higher MUS failure, with multivariate logistic regression showing a 5% increased risk for each 1 kg/m2 BMI increase. Failure rates were significantly different between normal BMI and severe obesity (16.7% vs 36.4%, P = 0.04). After adjusting for other variables, transobturator slings had a higher risk of failure compared with retropubic slings, whereas surgeon training and patient ethnicity did not affect failure rates. CONCLUSIONS: We found that increasing BMI was associated with higher MUS failures, with significantly higher failure rates in the severely obese population. Although MUS remains the standard of care for treatment of SUI, based on our findings, counseling should be individualized to the patient, taking into account each patient's unique characteristics.
RESUMEN
Yak whey protein concentrates (YWPCs) have good functional properties, but there is still a gap in the study of their peptides. In this study, peptides were obtained by enzymatic hydrolysis, and the bioactivity of each ultrafiltration fraction was evaluated using an optimal process. YWPCs were isolated and purified from yak milk as the raw material. Alkaline protease, trypsin, and papain were used to hydrolyze YWPCs. The protease with the highest degree of hydrolysis (DH) and peptide concentration was selected as the most suitable enzyme. The effects of pH, temperature, time, and the enzyme-to-substrate ratio (E/S) on the DH and peptide concentration were investigated, and response surface methodology was utilized to optimize the hydrolysis process. The hydrolysate was separated using ultrafiltration membranes with molecular weight cut-offs of 10 kDa, 5 kDa, 3 kDa, and 1 kDa. The bioactivity of each ultrafiltration component was analyzed, including the inhibition rates of α-amylase and xanthine oxidase (XOD) activities and the scavenging rates of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) cation radicals. The results indicated that alkaline protease was the best enzyme for hydrolyzing YWPCs. The peptide concentration in the YWPC hydrolysate was the highest (17.21 mg/mL) at a pH of 8 and a concentration of 7500 U/g, after 2.5 h at 62 °C. The enzymatic hydrolysate was ultrafiltered to yield four peptide fractions, of which the <1 kDa peptides exhibited the highest α-amylase inhibitory activity (22.06%), XOD inhibitory activity (17.15%), and ABTS cationic free radical scavenging rate (69.55%). This demonstrates the potential of YWPC hydrolyzed peptides for hypoglycemic, uric acid-lowering, and antioxidant applications, providing a theoretical basis for the high-value utilization of YWPCs.
Asunto(s)
Antioxidantes , Benzotiazoles , Depuradores de Radicales Libres , Ácidos Sulfónicos , Animales , Bovinos , Hidrólisis , Depuradores de Radicales Libres/química , Proteína de Suero de Leche , Antioxidantes/química , Péptidos/química , Papaína/metabolismo , alfa-Amilasas , Hidrolisados de Proteína/químicaRESUMEN
The objective of this study was to explore the effects and mechanisms of the combination of isobavachalcone (IBC) and doxorubicin (DOX) on the progression of anaplastic thyroid cancer (ATC). Cell viability of 8505C and CAL62 cells was observed by CCK-8 assay. Kits were used to detect the presence of reactive oxygen species (ROS), glutathione (GSH), malondialdehyde (MDA), and cellular iron. Protein expression of solute carrier family 7 member 11 (SLC7A11) and glutathione peroxidase 4 (GPX4) was detected using western blot, and CD31 was detected through immunofluorescence. Tumor xenograft models of 8505C cells were constructed to observe the effect of IBC and DOX on ATC growth in vivo. The co-administration of IBC and DOX exhibited a synergistic effect of suppressing the growth of 8505C and CAL62 cells. The concurrent use of IBC and DOX resulted in elevated iron, ROS, and MDA levels, while reducing GSH levels and protein expression of SLC7A11 and GPX4. However, the Fer-1 ferroptosis inhibitor effectively counteracted this effect. In vitro and in vivo, the inhibitory effect on ATC cell proliferation and tumor growth was significantly enhanced by the combination of IBC and DOX. The combination of IBC and DOX can inhibit the growth of ATC by activating ferroptosis, and might prove to be a potent chemotherapy protocol for addressing ATC.
RESUMEN
OBJECTIVES: To investigate the effects of electroacupuncture (EA) on the miR-381, leucine-rich repeat C4 protein (LRRC4), and downstream stromal cell-derived factor-1 (SDF-1)/CXC chemokine receptor 4 (CXCR4) signaling pathway in rat model of ischemic stroke, and to explore the mechanism by which EA improves neurological damage following ischemic stroke. METHODS: Among 50 SPF male SD rats, 10 rats were randomly selected into a sham surgery group, and the remaining rats were used to establish the middle cerebral artery occlusion (MCAO) model. The 30 successfully modeled rats were randomly divided into a model group, an EA group, and an agonist group, with 10 rats in each group. The rats in the EA group received EA at "Baihui" (GV 20) and "Dazhui" (GV 14), with disperse-dense wave, a frequency of 2 Hz/10 Hz, and a current intensity of 1 mA, 30 min per session, once daily for a total of 14 days. The rats in the agonist group received miR-381 agonist injections into the lateral ventricle, with 10 µL per injection, every 7 days for a total of 2 injections. After intervention, ZeaLonga neurobehavioral deficit score was observed in each group. HE staining was performed to observe the morphological changes in the ischemic brain tissue of rats in each group. ELISA was used to measure the levels of tumor necrosis factor alpha (TNF-α), interleukin-6 (IL-6), and nerve growth factor (NGF) in serum. Western blot was employed to detect the protein expression of LRRC4, SDF-1, CXCR4, and extracellular regulated protein kinase 1 (ERK1) in the ischemic brain tissue. Real-time PCR was utilized to assess the expression of miR-381 and LRRC4, SDF-1, CXCR4, ERK1 mRNA in the ischemic brain tissue. RESULTS: After intervention, the brain tissue showed disordered cell arrangement, reduced quantity, and significant interstitial edema, with numerous vacuoles in the model group. The pathological changes mentioned above were alleviated in the brain tissue of rats in the EA group and the agonist group. Compared with the sham surgery group, the rats in the model group exhibited increased ZeaLonga neurobehavioral deficit scores, elevated levels of serum TNF-α and IL-6 (P<0.01), and decreased serum NGF level (P<0.01)ï¼the protein expression of SDF-1, CXCR4 and ERK1 in ischemic brain tissue was reduced (P<0.01), while LRRC4 protein expression was increased (P<0.01)ï¼the expression of miR-381, as well as SDF-1, CXCR4 and ERK1 mRNA in ischemic brain tissue was decreased (P<0.01), while LRRC4 mRNA expression was increased (P<0.01). Compared with the model group, the rats in the EA group and the agonist group showed decreased ZeaLonga neurobehavioral deficit scores and reduced levels of serum TNF-α and IL-6 (P<0.05, P<0.01), and increased serum NGF levels (P<0.05, P<0.01); the protein expression of SDF-1, CXCR4 and ERK1 in ischemic brain tissue was increased (P<0.01), while LRRC4 protein expression was decreased (P<0.01)ï¼the expression of miR-381, as well as SDF-1, CXCR4 and ERK1 mRNA in ischemic brain tissue was increased (P<0.05, P<0.01), while LRRC4 mRNA expression was decreased (P<0.01). CONCLUSIONS: EA at "Baihui" (GV 20) and "Dazhui" (GV 14) may promote the repair of neurological damage following ischemic stroke by up-regulating miR-381 to selectively inhibit LRRC4 expression, thereby activating the SDF-1/CXCR4 signaling pathway.
Asunto(s)
Isquemia Encefálica , Electroacupuntura , Accidente Cerebrovascular Isquémico , MicroARNs , Ratas , Masculino , Animales , Isquemia Encefálica/genética , Isquemia Encefálica/terapia , Isquemia Encefálica/metabolismo , Ratas Sprague-Dawley , Receptores CXCR4/genética , Receptores CXCR4/metabolismo , Factor de Necrosis Tumoral alfa/genética , Interleucina-6 , Factor de Crecimiento Nervioso , Transducción de Señal , MicroARNs/genética , ARN MensajeroRESUMEN
G-quadruplexes (G4s) are non-canonical four-stranded structures and are emerging as novel genetic regulatory elements. However, a comprehensive genomic annotation of endogenous G4s (eG4s) and systematic characterization of their regulatory network are still lacking, posing major challenges for eG4 research. Here, we present EndoQuad (https://EndoQuad.chenzxlab.cn/) to address these pressing issues by integrating high-throughput experimental data. First, based on high-quality genome-wide eG4s mapping datasets (human: 1181; mouse: 24; chicken: 2) generated by G4 ChIP-seq/CUT&Tag, we generate a reference set of genome-wide eG4s. Our multi-omics analyses show that most eG4s are identified in one or a few cell types. The eG4s with higher occurrences across samples are more structurally stable, evolutionarily conserved, enriched in promoter regions, mark highly expressed genes and associate with complex regulatory programs, demonstrating higher confidence level for further experiments. Finally, we integrate millions of functional genomic variants and prioritize eG4s with regulatory functions in disease and cancer contexts. These efforts have culminated in the comprehensive and interactive database of experimentally validated DNA eG4s. As such, EndoQuad enables users to easily access, download and repurpose these data for their own research. EndoQuad will become a one-stop resource for eG4 research and lay the foundation for future functional studies.
Asunto(s)
Bases de Datos Genéticas , G-Cuádruplex , Secuencias Reguladoras de Ácidos Nucleicos , Animales , Humanos , Ratones , Genoma , GenómicaRESUMEN
INTRODUCTION: Given the increase in ultra-processed food (UPF) consumption, their potential health effects have aroused concern. Whether UPF consumption is associated with cancer and cardiovascular disease mortality is debatable. This study evaluates the association of UPF consumption with mortality. METHODS: A total of 108,714 U.S. adults from the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial (1993-2001), 208,051 UK adults from UK Biobank (2006-2010), and 41,070 U.S. adults from National Health and Nutrition Examination Survey (1999-2018) were included. Dietary data were collected by dietary questionnaire and classified using the NOVA classification. UPF consumption was expressed as the weight proportion of UPFs in total foods consumed. Cox proportional hazard models were used to calculate hazard ratios and 95% CIs. Mediation analysis was used to evaluate whether multiple metabolic pathways mediated the associations in UK Biobank. Analyses were performed in 2022-2023. RESULTS: Combined analyses of the three cohorts showed that those with the highest quartile of UPF consumption had higher risks of all-cause mortality (hazard ratio, 1.16; 95% CI, 1.11-1.20) and cardiovascular disease mortality (hazard ratio, 1.17; 95% CI, 1.06-1.28) compared to the lowest quartile of UPF consumption. UPF consumption was not associated with cancer mortality risk. Biomarkers of liver function have the greatest mediating effects on all-cause mortality (20.3%), and biomarkers of inflammation have the greatest mediating effects on cardiovascular disease mortality (29.2%). CONCLUSIONS: Higher UPF consumption was associated with increased all-cause and cardiovascular disease mortality risk, with multiple metabolic pathways playing mediating roles.
Asunto(s)
Enfermedades Cardiovasculares , Neoplasias , Adulto , Humanos , Masculino , Biomarcadores , Estudios de Cohortes , Dieta , Comida Rápida/efectos adversos , Manipulación de Alimentos , Alimentos Procesados , Encuestas Nutricionales , Reino Unido/epidemiología , Femenino , Ensayos Clínicos como AsuntoRESUMEN
The cancer burden in China is increasing. We aimed to assess the time trends in the prevalence of 16 modifiable risk factors involved in lifestyle, diet, infection, and air pollution between 1997 and 2025 based on the China Health and Nutrition Survey, the Global Burden of Disease website, and publically available studies. The population attributable fraction (PAF) and its 95% uncertainty interval (UI) from 2007 to 2035 were calculated to quantify the attributable cancer burden in major 12 anatomic sites using the comparative risk assessment method, considering a 10-year lag effect. As a result, 1,559,476 cancer cases (PAF = 54.1%, 95% UI: 36.8%-65.8%) from the 12 anatomic sites were attributable to these modifiable risk factors in 2007, with lung, liver, and gastric cancer raging the top three. It was predicted that by 2035, the attributable cancer cases would reach 1,680,098 (PAF = 44.2%, 95% UI: 29.1%-55.5%), with the top three of lung, liver, and colorectal cancer. Smoking, physical inactivity, insufficient fruit consumption, HBV infection, and Helicobacter pylori infection were the most attributable risk factors in 2007, contributing to 480,352, 233,684, 215,009, 214,455, and 187,305 associated cancer cases, respectively. In 2035, the leading factors for cancer would be smoking, physical inactivity, insufficient fruit intake, HPV infection, and HBV infection, resulting in 427,445, 424,327, 185,144, 156,535, and 154,368 cancer cases, respectively. Intervention strategies should be swiftly established and dynamically altered in response to risk factors like smoking, physical inactivity, poor fruit intake, and infectious factors that may cause a high cancer burden in the Chinese population.
Asunto(s)
Infecciones por Helicobacter , Helicobacter pylori , Neoplasias , Humanos , Factores de Riesgo , Fumar/efectos adversos , Fumar/epidemiología , Neoplasias/epidemiología , Neoplasias/etiologíaRESUMEN
A novel virus infecting a Paris polyphylla var. yunnanensis plant, tentatively named "Paris polyphylla chlorotic mottle virus" (PpCMV), was discovered in the city of Lijiang, Yunnan Province, China. Its genome consists of 6384 nucleotides (nt), excluding the 3'-terminal poly(A) tail, and contains two open reading frames: ORF1 and ORF2. ORF1 is 6150 nt in length, encoding a large 2050-aa polyprotein with at least two conserved regions encoding a replication-associated protein and a coat protein, the latter of which is located at the 3' end of ORF1. ORF2, consisting of 1185 nt, is located within ORF1 but has a different reading frame. It encodes a 394-aa-long putative movement protein. Phylogenetic analysis based on amino acid sequences revealed that the newly discovered virus exhibited the closest relationship to Hobart betaflexivirus 1 and rhodiola betaflexivirus 1, both of which belong to the genus Capillovirus, sharing 48.8% and 36.5% amino acid sequence identity, respectively, in the structural protein. This is the first report of the complete genome sequence of PpCMV in China.
Asunto(s)
Ascomicetos , Flexiviridae , Liliaceae , Melanthiaceae , China , Filogenia , Secuencia de Aminoácidos , Nucleótidos , ARN MensajeroRESUMEN
Numerous studies have revealed associations between high intake of whole grains and reduced risk of various cancers. Yet, in recent decades, the traditional Chinese diets have been challenged by reduction in whole grains and increase in refined grains. To assess the impact of this dietary transition on cancer prevention, we analyzed the time trend of whole grain intake using nationally representative sampling data of over 15 thousand individuals from the China Health and Nutrition Survey. We applied the comparative risk assessment method to estimate the population attributable fraction of cancers due to insufficient whole grain intake from 1997 to 2011 and projected the trend of whole grain intake and the associated burden of cancers to 2035. We found a significant decrease of approximately 59% of whole grain intake in the Chinese population from 1997 to 2011. Compared with 1997, insufficient intake of whole grains was responsible for 9940 more cases of breast cancer, 12,903 more cases of colorectal cancer and 434 more cases of pancreatic cancer in 2011. Our projections suggest that if every Chinese would consume 125 g whole grain per day as recommended by the latest Chinese Dietary Guidelines, 0.63% bladder cancer, 8.98% breast cancer, 15.85% colorectal cancer, 3.86% esophageal cancer, 2.52% liver cancer and 2.22% pancreatic cancer (totaling 186,659 incident cases) could theoretically be averted by 2035. Even if everyone maintained the 2011 whole grain intake level, an estimated 8.38% of cancer events could still be prevented by 2035.
RESUMEN
MiRNAs are biomarkers widely used in research but their clinical application is still challenging due to their low expression levels. Current methods for miRNA detection involve separate transcription and quantification for each target, which is costly and unsuitable for large sample sizes. This study provides a strategy for designing and screening miRNA-specific stem-loop reverse transcription (RT) primers, which enable the simultaneous transcription of three miRNAs and U6, and the concurrent detection of miRNA and U6 in the same transcript using TaqMan probes labeled with different dyes. The strategy was successfully employed to establish multiplex RT-PCR and dual-quantitative PCR (qPCR) quantification systems for 21 differentially expressed miRNAs during wound healing. The corresponding system can accurately quantify the cell culture samples containing miR-7a-5p mimic, miR-7a-5p inhibitor, or negative control. In summary, our results demonstrate that this strategy could efficiently accomplish the design, screening, and analysis of stem-loop RT primers for multiplex miRNA detection. Compared with the commercially customized miRNA assay kits, our system showed a higher degree of automation, more accurate qPCR assay capabilities, and lower assay costs, which could provide practical value for clinical diagnosis.
Asunto(s)
MicroARNs , MicroARNs/análisis , Biomarcadores , Reacción en Cadena de la Polimerasa Multiplex , Regulación Neoplásica de la Expresión Génica , Perfilación de la Expresión Génica/métodos , Reacción en Cadena en Tiempo Real de la Polimerasa/métodosRESUMEN
Background: This study created a predictive preoperative nomogram dependent on multimodal ultrasound characteristics and primary lesion biopsy results for various pathologic response assessment systems following neoadjuvant chemotherapy (NAC). Methods: This retrospective study included 145 breast cancer patients treated at Gansu Cancer Hospital between January 2021 and June 2022 who underwent shear wave elastography (SWE) prior to completing NAC. Intra- and peritumoral SWE features, including maximum (Emax), mean (Emean), minimum (Emin), and standard deviation (Esd) elasticity, were measured individually and linked with the Miller-Payne grading system and residual cancer burden (RCB) class. Univariate analysis was used for conventional ultrasound and puncture pathology. Binary logistic regression analysis was used to screen for independent risk factors and to develop a prediction model. Results: Intratumor Emean and peritumoral Esd differed significantly from the Miller-Payne grade [intratumor Emean: r=0.129, 95% confidence interval (CI): -0.002 to 0.260; P=0.042; peritumoral Esd: r=0.126, 95% CI: -0.010 to 0.254; P=0.047], RCB class (intratumor Emean: r=-0.184, 95% CI: -0.318 to -0.047; P=0.004; peritumoral Esd: r=-0.139, 95% CI: -0.265 to 0.000; P=0.029) and RCB score components (r=-0.277 to -0.139; P=0.001-0.041). Two prediction model nomograms-pathologic complete response (pCR)/non-pCR and good responder/nonresponder-for the RCB class were developed using binary logistic regression analysis for all significant variables in SWE, conventional ultrasound, and puncture results. The area under the receiver operating characteristic curve for the pCR/non-pCR and good responder/nonresponder models was 0.855 (95% CI: 0.787-0.922) and 0.845 (95% CI: 0.780-0.910), respectively. According to the calibration curve, the nomogram had excellent internal consistency between estimated and actual values. Conclusions: The preoperative nomogram can effectively guide clinicians to predict pathological response of breast cancer after NAC and has the potential to guide individualized treatment.
RESUMEN
Diabetic foot ulcers (DFUs) are a severe and rapidly growing diabetic complication, but treating DFUs remains a challenge for the existing therapies are expensive and highly non-responsive. Recently, we discovered that a natural adhesive from snail mucus can promote skin wound healing. Herein, inspired by the finding, we developed a double-network hydrogel biomaterial that composed of snail glycosaminoglycan (AFG) and methacrylated gelatin (GelMA), in which AFG is the main bioactive component of snail mucus and GelMA provides a scaffold mimicking the proteins in snail mucus. The biomimetic hydrogel exhibited strong tissue adhesion, potent anti-inflammatory activity, and excellent biocompatibility. The biodegradable AFG/GelMA hydrogel markedly promoted chronic wound healing in both STZ-induced type 1 diabetic rat and db/db mouse models after a single treatment. Further mechanistic research showed that the hydrogel significantly attenuated inflammation by sequestrating pro-inflammatory cytokines, as well as downregulated their expression by inhibiting NF-ĸB signaling pathway, and it can also promote macrophage polarization to M2 phenotype. Taken together, the bioinspired hydrogel can effectively promote the transition of chronic wounds from inflammation to proliferation stage. These data suggest that the AFG/GelMA hydrogel is a promising therapeutic biomaterial for the treatment of chronic diabetic wounds.
Asunto(s)
Diabetes Mellitus , Hidrogeles , Ratones , Ratas , Animales , Hidrogeles/farmacología , Gelatina/farmacología , Cicatrización de Heridas , Materiales Biocompatibles/farmacología , Diabetes Mellitus/metabolismo , Citocinas/metabolismo , Macrófagos/metabolismoRESUMEN
Children are the high-risk group for COVID-19, and in need of vaccination. However, humoral and cellular immune responses of COVID-19 vaccine remain unclear in vaccinated children. To establish the rational immunization strategy of inactivated COVID-19 vaccine for children, the immunogenicity of either one dose or two doses of the vaccine in children was evaluated. A prospective cohort study of 322 children receiving inactivated COVID-19 vaccine was established in China. The baseline was conducted after 28 days of the first dose, and the follow-up was conducted after 28 days of the second dose. The median titers of receptor binding domain (RBD)-IgG, and neutralizing antibody (NAb) against prototype strain and Omicron variant after the second dose increased significantly compared to those after the first dose (first dose: 70.0, [interquartile range, 30.0-151.0] vs. second dose: 1261.0 [636.0-2060.0] for RBD-IgG; 2.5 [2.5-18.6] vs. 252.0 [138.6-462.1] for NAb against prototype strain; 2.5 [2.5-2.5] vs. 15.0 [7.8-26.5] for NAb against Omicron variant, all p < 0.05). The flow cytometry results showed that the first dose elicited SARS-CoV-2 specific cellular immunity, while the second dose strengthened SARS-CoV-2 specific IL-2+ or TNF-α+ monofunctional, IFN-γ+ TNF-α+ bifunctional, and IFN-γ- IL-2+ TNF-α+ multifunctional CD4+ T cell responses (p < 0.05). Moreover, SARS-CoV-2 specific memory T cells were generated after the first vaccination, including the central memory T cells and effector memory T cells. The present findings provide scientific evidence for the vaccination strategy of the inactive vaccines among children against COVID-19 pandemic.