Dioxin-like activity of brominated dioxins as individual compounds or mixtures in in vitro reporter gene assays with rat and mouse hepatoma cell lines.

In vitro reporter gene assays detecting dioxin-like compounds have been developed and validated since the middle 1990's, and applied to the determination of dioxin-like activities in various samples for their risk management. Data on characterizing the potency of individual brominated dioxins and their activity in mixture with chlorinated dioxins are still limited on the cell-based assay. This study characterized the dioxin-like activities of the 32 brominated dioxins, such as polybrominated dibenzo-p-dioxins, polybrominated dibenzofurans (PBDFs), coplanar polybrominated biphenyls, mixed halogenated dibenzo-p-dioxins and dibenzofurans (PXDFs), as a sole component or in a mixture by DR-CALUX (dioxin-responsive chemically activated luciferase expression) using the rat hepatoma H4IIE cell line and XDS-CALUX (xenobiotic detection systems-chemically activated luciferase expression) assays using the mouse hepatoma H1L6.1 cell line. The 2,3,7,8-TCDD-relative potencies (REPs) of most of the brominated dioxins were within a factor of 10 of the WHO toxicity equivalency factor (WHO-TEF) for the chlorinated analogues. The REPs of a few PXDFs were an order of magnitude higher than the corresponding WHO-TEFs, indicating their toxicological importance. Results with reconstituted mixtures suggest that the activity of brominated and chlorinated dioxins in both CALUX assays was dose-additive. Thus, obtained results indicated the applicability of the CALUX assays as screening tools of brominated dioxins together with their chlorinated analogues.

Neurodegeneration in frontotemporal lobar degeneration and motor neurone disease associated with expansions in C9orf72 is linked to TDP-43 pathology and not associated with aggregated forms of dipeptide repeat proteins.

AIMS: A hexanucleotide expansion in C9orf72 is the major genetic cause of inherited behavioural variant Frontotemporal dementia (bvFTD) and motor neurone disease (MND), although the pathological mechanism(s) underlying disease remains uncertain. METHODS: Using antibodies to poly-GA, poly-GP, poly-GR, poly-AP and poly-PR proteins, we examined sections of cerebral cortex, hippocampus, thalamus, cerebellum and spinal cord, from 20 patients with bvFTD and/or MND bearing an expansion in C9orf72 for aggregated deposits of dipeptide repeat proteins (DPR). RESULTS: Antibodies to poly-GA, poly-GP and poly-GR detected numerous rounded cytoplasmic inclusions (NCI) within granule cells of hippocampal dentate gyrus and those of the cerebellum, as well as 'star-burst' shaped NCI in pyramidal neurones of CA3/4 region of hippocampus. NCI were uncommon in Purkinje cells, and only very rarely seen in anterior horn cells. Poly-PA antibody detected occasional NCI within CA3/4 neurones alone, whereas poly-PR antibody did not identify any NCI but immunostained the nucleus of anterior horn cells, CA3/4 neurones and Purkinje cells, in patients with or without expansion in C9orf72, as well as in normal controls. Poly-GA antibody generally detected more DPR than poly-GP, which in turn was greater than poly-GR. All patients with bvFTD + MND or MND showed plentiful p62/TDP-43 positive inclusions in remaining anterior horn cells. CONCLUSION: Degeneration and loss of anterior horn cells associated with expansions in C9orf72 occurs in the absence of DPR, and implies that changes involving loss of nuclear staining for and a cytoplasmic aggregation of TDP-43 are more likely to be the cause of this.

Usefulness of colonoscopic examination with indigo carmine in diagnosing microscopic colitis.

Microscopic colitis, comprising collagenous colitis and lymphocytic colitis, is epitomized by chronic watery diarrhea, endoscopically normal colonic mucosa, and characteristic histopathological features. Reports on chromoendoscopic findings in microscopic colitis are scarce and in this paper we describe such findings. We have examined 13 patients with microscopic colitis by means of chromoendoscopy with indigo carmine 0.2 % - 0.5 %. In all 13 cases continuous mucosal changes were seen, with disappearance of innominate grooves or with irregularity of grooves. The segmental distribution of abnormal chromoendoscopic findings corresponded almost completely with the microscopic features. A diffuse mosaic pattern was found in five of 10 cases of collagenous colitis and in all three cases of lymphocytic colitis. Uneven surface was seen in four cases of collagenous colitis, one of collagenous colitis in remission, and one of lymphocytic colitis, and a nodular surface was recorded in five cases of collagenous colitis but in none of the lymphocytic colitis cases. If these findings can be reproduced in larger series of microscopic colitis cases, the need for biopsies as a diagnostic tool might be restricted to patients where chromoendoscopy shows clear mucosal changes, thereby saving costs and limiting possible complications associated with multiple biopsies.

Outcomes of multimodality therapy for stage IVB esophageal cancer with distant organ metastasis (M1-Org).

Esophageal cancer patients with distant organ metastasis have usually been treated only to palliate symptoms without multimodality therapy. The current study evaluates the role of multimodality therapy in esophageal squamous cell cancer patients with distant organ metastasis. Between February 1988 and January 2007, 80 esophageal squamous cell cancer patients with distant organ metastases were treated at our institution. Multimodality therapy was performed in 58 patients: 43 patients received chemoradiotherapy, 13 underwent surgery followed by chemotherapy and/or radiation therapy, and two received chemotherapy or chemoradiotherapy followed by surgery. Thirteen patients received single-modality therapy; chemotherapy, radiotherapy, or surgery alone. The remaining nine patients received best supportive care alone. The metastatic organ was the liver (n= 40), the lungs (n= 33), bone (n= 10), and other (n= 6). Nine patients had metastasis in two organs. There was no difference in the median survival among the sites of organ metastasis, lung, liver, or bone (P= 0.8786). The survival of patients treated with multimodality therapy was significantly better than that of the patients who received single-modality therapy or best supportive care alone (P < 0.0001). In patients treated with multimodallity therapy, there was no difference in survival for patients treated with surgery compared with patients treated without surgery (P= 0.1291). This retrospective study involves an inevitable issue of patient selection bias. However, these results suggested that multimodality therapy could improve survival of the esophageal squamous cell cancer patients with distant organ metastasis.

Effect of CFMTI, an allosteric metabotropic glutamate receptor 1 antagonist with antipsychotic activity, on Fos expression in regions of the brain related to schizophrenia.

The main purpose of this study was to explore the sites and mechanisms of action of metabotropic glutamate receptor 1 (mGluR1) blockade for antipsychotic-like activity using a Fos mapping approach, with the intent of better understanding the similarities and differences between the pharmacological actions of mGluR1 antagonists and atypical antipsychotic drugs such as clozapine. Previously, we showed that an allosteric mGluR1 antagonist (negative allosteric modulator), 2-cyclopropyl-5-[1-(2-fluoro-3-pyridinyl)-5-methyl-1H-1,2,3-triazol-4-yl]-2,3-dihydro-1H-isoindol-1-one (CFMTI), induces Fos expression in the nucleus accumbens and the medial prefrontal cortex (mPFC), but not in the dorsolateral striatum, similar to the action of clozapine. In the present study, the Fos expression profile of CFMTI was more extensively evaluated in various areas of the brain. CFMTI induced Fos expression mainly in glutamatergic neurons in the mPFC, in a manner similar to clozapine. A significant increase in Fos expression was also observed in the locous coeruleus, central amygdaloid nucleus, the bed nucleus of the stria terminalis and the primary somatosensory cortex, but not in the ventral tegmental area, dorsal raphe or lateral septum. Fos expression in orexin neurons in the lateral hypothalamic/perifornical area (LH/PFA) is known to be positively correlated with the weight gain liability of atypical antipsychotics. CFMTI did not increase Fos expression in orexin neurons in the LH/PFA, in contrast to clozapine, which does have weight gain liability. These results suggest that CFMTI has unique and shared actions on Fos expression in various regions of the brain compared with clozapine.

Minor salivary gland carcinomas of oral cavity and oropharynx.

This paper reviews 22 cases of minor salivary gland carcinoma of the oral cavity or oropharynx which were treated at Kurume University Hospital between 1976 and 2005. Minor salivary gland carcinoma was observed in eight of 362 patients with cancer of the oral cavity (2 per cent), and in 14 of 275 patients with cancer of the oropharynx (5 per cent). The five-year and 10-year survival rates of patients with oropharyngeal minor salivary gland carcinoma were 90 per cent. No statistically significant difference was observed between survival rates for oropharyngeal minor salivary gland carcinoma and for oropharyngeal squamous cell carcinoma (p = 0.06). The five- and 10-year survival rates of patients with oral cavity minor salivary gland carcinoma were 75 and 37 per cent, respectively. No statistically significant difference was observed between survival rates for oral cavity minor salivary gland carcinoma and oral cavity squamous cell carcinoma.Patients' survival results correlated well with the clinical stage of their lesions. A significant difference in survival was observed, comparing stage IV with stages I, II and III (p = 0.04). In contrast, no significant relationship was found between either survival and tumour type or survival and treatment. Adjuvant therapy is recommended for patients with grade III adenoid cystic carcinoma with perineural infiltration or intravascular infiltration.

First Report of Tomato chlorotic spot virus Infecting Spilanthes oleracea in Brazil.

Spilanthes oleracea L., popularly known as toothache plant, belongs to the family Asteraceae and is a South American native plant. Fresh leaves can be eaten for their medicinal properties or used by the cosmetics industry for their spilol contents. Plants showing leaf deformation that were collected in a field in São Paulo State, Brazil in March 2005 were suspected to be infected by a virus. Electron microscopy of leaf dip preparations of symptomatic plants revealed pleiomorphic particles typical of tospoviruses. Extracts from these plants prepared with 0.01 M sodium phosphate buffer, pH 7.0, containing 1% sodium sulfite were mechanically inoculated to indicator plants. Chenopodium amaranticolor and Gomphrena globosa were symptomless. Necrotic local lesions were observed on C. quinoa. Necrotic local lesions followed by a systemic necrosis that caused the death of the plants were observed on Datura stramonium, Nicotiana glutinosa, and N. tabacum 'TNN' and 'Turkish'. Concentric rings followed by systemic necrosis and plant death were induced on N. rustica, N. tabacum 'Havana 425', N. clevelandii, Physalis floridana, Capsicum annum 'Magda', and Solanum lycopersicum 'Santa Clara'. Total RNA was extracted (1) from infected S. oleracea and N. rustica plants for reverse transcription-PCR amplification with tospovirus specific primers BR60 (5' CCCGGATCCTGCAGAGCAATTGTGTCA 3') and BR65 (5' ATCAAGCCTTCTGAAAGTCAT 3') (2), which amplified an approximate 440-bp fragment covering part of the nucleocapsid protein gene. This fragment was sequenced (EMBL Accession No. AM887766) and showed 99% nt sequence identity with Tomato chlorotic spot virus (TCSV) (GenBank Accession No. AF521102), a tospovirus species (3). To our knowledge, this is the first report of a tospovirus infecting S. oleracea in Brazil and indicates that this plant might constitute a reservoir of TCSV or other tospoviruses that could also infect tomato and pepper plants. References: (1) Y. D. Bertheau et al. DNA amplification by polymerase chain reaction (PCR) 1998 in: Methods for the Detection and Quantification of Erwinia carotovora subsp. atroseptica on Potatoes. M. C. N. Perombelon and J. M. van der Wolf, eds. Scott. Crop Res. Inst. Occas. Publ. Dundee, Scotland, 1998. (2) M. Eiras et al. Fitopatol. Bras. 26:170, 2001. (3) F. Lovato et al. Virus Genes 29:321, 2004.

Mortality of rheumatoid arthritis in Japan: a longitudinal cohort study.

OBJECTIVE: To determine the mortality risk of Japanese patients with rheumatoid arthritis, taking into account lifestyle and physical factors, including comorbidity. METHODS: 91 individuals with rheumatoid arthritis were identified during screening a cohort of 16 119 Japanese atomic bomb survivors in the period 1958 to 1966. These individuals and the remainder of the cohort were followed for mortality until 1999. Mortality risk of the rheumatoid patients was estimated by the Cox proportional hazards model. In addition to age and sex, lifestyle and physical factors such as smoking status, alcohol consumption, blood pressure, and comorbidity were included as adjustment factors for the analysis of total mortality and for analysis of mortality from each cause of death. RESULTS: 83 of the rheumatoid patients (91.2%) and 8527 of the non-rheumatoid controls (52.9%) died during mean follow up periods of 17.8 and 28.0 years, respectively. The age and sex adjusted hazard ratio for mortality in the rheumatoid patients was 1.60 (95% confidence interval, 1.29 to 1.99), p < 0.001. Multiple adjustments, including for lifestyle and physical factors, resulted in a similar mortality hazard ratio of 1.57 (1.25 to 1.94), p < 0.001. Although mortality risk tended to be higher in male than in female rheumatoid patients, the difference was not significant. Pneumonia, tuberculosis, and liver disease were significantly increased as causes of death in rheumatoid patients. CONCLUSIONS: Rheumatoid arthritis is an independent risk factor for mortality. Infectious events are associated with increased mortality in rheumatoid arthritis.

Relationship between HbA(1)c and mortality in a Japanese population.

AIM/HYPOTHESIS: HbA(1)c concentrations are known to be associated with all-cause excess mortality risk in Caucasians. However, the relationship has not been clarified well in the Japanese. In addition, studies of the relationship between HbA(1)c and mortality from malignant neoplasms are scarce. METHODS: HbA(1)c was measured for 3,710 people of a cohort composed of A-bomb survivors and controls. At baseline they were divided into five groups: a normal HbA(1)c group of 1,143 individuals with HbA(1)c of <5.5%, a slightly high but normal HbA(1)c group of 1,341 individuals with HbA(1)c > or =5.5% to <6.0%, a slightly high HbA(1)c group of 589 individuals with HbA(1)c > or =6.0% to <6.5%, a high HbA(1)c group of 259 individuals with HbA(1)c > or =6.5%, and a group of 378 individuals known to have type 2 diabetes. Using a Cox proportional hazards model, hazard ratios based on comparisons with the normal HbA(1)c group were obtained. RESULTS: During the observation period there were 754 deaths. For all-cause and cardiovascular disease mortality, a significant increase of the hazard ratio was observed for the slightly high HbA(1)c group. A similar increase in malignant neoplasm-related mortality was observed for both the high HbA(1)c group and the diabetes group. CONCLUSIONS/INTERPRETATION: Our results suggest that individuals in the Japanese population with HbA(1)c levels of 6% or more might have increased mortality risk. The results indicate that HbA(1)c measurements should be sought even for people who have not been diagnosed with diabetes.

Anesthesia-related mortality and morbidity over a 5-year period in 2,363,038 patients in Japan.

BACKGROUND: Statistical data of mortality and morbidity related to anesthesia have not been reported in Japan since World War II. The need to comprehensively examine the events of cardiac arrest as well as mortality prompted the first national study in Japan. METHODS: Confidential questionnaires were sent to all Japan Society of Anesthesiologists Certified Training Hospitals every year from 1994 through 1998. Collected data were analyzed for incidence of cardiac arrest and other critical events during anesthesia and surgery, and their outcomes within 7 postoperative days. The principal causes of the critical incidents were also analyzed. RESULTS: With an average response rate of 39.9%, a total of 2,363,038 cases were documented over 5 years. The average incidence per year of cardiac arrest during surgery due to all etiologies and that totally attributable to anesthesia was 7.12 [95%CI: 6.30,7.94] and 1.00 [0.88, 1.12]) per 10,000 cases, respectively. The average mortality per year in the operating room or within 7 postoperative days due to all etiologies and that totally attributable to anesthesia was 7.18 [6.22, 8.13] and 0.21 [0.15, 0.27] per 10,000 cases, respectively. The two principal causes of cardiac arrest during anesthesia and surgery due to all etiologies were massive hemorrhage (31.9%) and surgery (30.2%), and those totally attributable to anesthesia were drug overdose or selection error (15.3%) and serious arrhythmia (13.9%). Preventable human errors caused 53.2% of cardiac arrest and 22.2% of deaths in the operating room totally attributable to anesthesia. CONCLUSIONS: The rates in Japan of cardiac arrest and death during anesthesia and surgery due to all etiologies as well as those totally attributable to anesthesia are comparable to those of other developed countries.

Initial medical management of patients severely irradiated in the Tokai-mura criticality accident.

A nuclear criticality accident occurred in Japan on September 30, 1999, which resulted in severe exposure of three victims to mixed flux of neutrons and gamma-rays. Estimated average doses for the three victims were 5.4 Gy of neutrons and 8.5 Gy of gamma-rays for Patient A, 2.9 Gy of neutrons and 4.5 Gy of gamma-rays for Patient B, and 0.81 Gy of neutrons and 1.3 Gy of gamma-rays for Patient C. They then suffered the consequences of the effects of ionizing radiation resulting in acute radiation syndrome. In Patients A and B, bone marrow failure was so severe that they received haematopoietic stem cell transplantation. The graft initially took successfully in both patients, although in Patient B it was later taken over by his own haematopoietic cells. They also suffered from severe skin lesions, later exhibited gastrointestinal bleeding and eventually died of multiple organ failure 82 and 210 days after the accident, respectively. The survival of these patients beyond the period of agranulocytosis means that bone marrow failure per se caused by exposure to ionizing radiation may now be overcome. Patient C also developed bone marrow failure and was treated with granulocyte colony-stimulating factor as well as supportive care. He recovered without major complications and is now under periodical follow-up. Remarkably, during the prodromal phase, all the patients exhibited hypoxaemia, two of whom also showed interstitial oedema of the lungs. In Patient C these manifestations improved within a week. The circumstances of the accident and the initial medical treatment of the victims are described.

Chromosomal instability and radiosensitivity in myelodysplastic syndrome cells.

Myelodysplastic syndrome (MDS) is a clonal disorder of hematopoietic stem cells. To investigate whether chromosomal instability and/or DNA repair defects are involved in the development of MDS, we measured the micronucleus (MN) frequency in peripheral blood lymphocytes exposed to various doses of X-rays, using a cytokinesis-block micronucleus assay. The spontaneous MN frequencies in RAEB and RAEB-T patients were significantly higher than those in normal individuals (P = 0.0224, P = 0.008, respectively). Also, the X-ray-induced MN frequencies in RA/RARS, RAEB, and RAEB-T patients were significantly higher than those in normal individuals (P = 0.007, P = 0.003, P = 0.003, respectively, at 2 Gy). In order to elucidate the cause of unusual radiosensitivity, we measured the expression levels of nucleotide excision repair (NER) genes in peripheral blood mononuclear cells using a RT-PCR method. Reduction of NER gene expression was found in only one of 10 patients with low risk MDS, but in four of 11 patients with high risk MDS. Our data suggest that chromosomal instability and DNA repair defects may be involved in the pathophysiology of disease progression of MDS.

Transplantation for accidental acute high-dose total body neutron- and gamma-radiation exposure.

Accidental exposure to acute high-dose total body neutron radiation is rare. We report a 35-year-old man exposed to a total body dose of 5.4 Gy neutron- and 8.5-13 Gy gamma-radiation in a radiation criticality accident. He received a blood stem cell transplant from his HLA-identical sister. There was bone marrow recovery with complete donor chimerism. Random chromatid breaks were observed in donor cells suggesting a bystander effect of neutron exposure. The subject died 82 days after the accident (75 days post transplant) from multi-organ failure.

OK-432 reduces mortality and bacterial translocation in irradiated and granulocyte-colony stimulating factor (G-CSF)-treated mice.

Bacterial translocation/Acute radiation syndrome/Endotoxin/G-CSF/OK-432 Acute radiation induces bacterial translocation from the gut, followed by systemic infection and sepsis. In order to reduce the mortality after acute whole body irradiation, it is essential to control bacterial translocation. In this study, we established a bacterial translocation assay as a sensitive method to detect minor mucosal injury by radiation. By utilizing this assay, we evaluated the adverse effects, if any, of hematopoietic reagents on the mucosal integrity in the respiratory and gastro-intestinal tracts. Bacterial translocation to the liver and spleen occurred after whole-body irradiation if the dose exceeded 6 Gy. The administration of G-CSF unexpectedly increased the bacterial translocation in 8 Gy-irradiated mice. The pharmaceutical preparation of low-virulent Streptococcus pyogenes, OK-432, significantly reduced the endotoxin levels in peripheral blood without any reduction of bacterial translocation. A combined treatment with G-CSF and OK-432 decreased bacterial translocation and prevented death. This result indicates that the early administration of G-CSF has an adverse effect on bacterial translocation, and that a combined treatment of G-CSF and OK-432 attenuates the adverse effect of G-CSF and improves the survival rate after acute irradiation.

Development of a yeast stop codon assay readily and generally applicable to human genes.

We established a yeast-based method to screen chain-terminating mutations that is readily applicable to any gene of interest. Based on the finding that 18- to 24-base-long homologous sequences are sufficient for gap repair in vivo in yeast, we used a strategy to amplify a test-gene fragment with addition of 24-bp sequences homologous to both cut-ends of a yeast expression vector, pMT18. After co-transformation with the amplified fragment and the linearized pMT18, each yeast (Saccharomyces cerevisiae) cell automatically forms a single-copy circular plasmid (because of CEN/ARS), which expresses a test-gene::ADE2 chimera protein. When the reading frame of the test-gene contains a nonsense or frameshift mutation, truncation of the chimera protein results in lack of ADE2 activity, leading to formation of a red colony. By using a nested polymerase chain reaction using proofreading Pfu polymerase to ensure specificity of the product, the assay achieved a low background (false positivity). We applied the assay to BRCA1, APC, hMSH6, and E-cadherin genes, and successfully detected mutations in mRNA and genomic DNA. Because this method--universal stop codon assay--requires only 4 to 5 days to screen a number of samples for any target gene, it may serve as a high-throughput screening system of general utility for chain-terminating mutations that are most prevalent in human genetic diseases.

A coordinated change in chemokine responsiveness guides plasma cell movements.

Antibody-secreting plasma cells are nonrecirculatory and lodge in splenic red pulp, lymph node medullary cords, and bone marrow. The factors that regulate plasma cell localization are poorly defined. Here we demonstrate that, compared with their B cell precursors, plasma cells exhibit increased chemotactic sensitivity to the CXCR4 ligand CXCL12. At the same time, they downregulate CXCR5 and CCR7 and have reduced responsiveness to the B and T zone chemokines CXCL13, CCL19, and CCL21. We demonstrate that CXCL12 is expressed within splenic red pulp and lymph node medullary cords as well as in bone marrow. In chimeric mice reconstituted with CXCR4-deficient fetal liver cells, plasma cells are mislocalized in the spleen, found in elevated numbers in blood, and fail to accumulate normally in the bone marrow. Our findings indicate that as B cells differentiate into plasma cells they undergo a coordinated change in chemokine responsiveness that regulates their movements in secondary lymphoid organs and promotes lodgment within the bone marrow.

Influence of thoracic radiotherapy on exhaled nitric oxide levels in patients with lung cancer.

BACKGROUND: To determine the physiological role of exhaled nitric oxide (NO) in patients with lung cancer. METHODS: We investigated changes in exhaled NO levels in 29 patients undergoing thoracic radiation therapy with or without chemotherapy. The exhaled NO level was assessed using a chemiluminescence analyzer. RESULTS: The level of exhaled NO was higher in patients with lung cancer before treatment than in controls. With radiotherapy, the exhaled NO level decreased for patients undergoing 40 Gy irradiation and post-radiotherapy. However, five patients showed elevated levels of exhaled NO three times or more than that before radiotherapy. Three of these patients showed signs of radiation pneumonitis. However, none of the other patients showed signs of radiation pneumonitis (p = 0.002). CONCLUSION: Radiation therapy can lower exhaled levels of NO and the levels of exhaled NO may be a useful index for the early prediction of radiation pneumonitis.

Characteristic association between K-ras gene mutation with loss of heterozygosity in X-ray-induced thymic lymphomas of the B6C3F1 mouse.

PURPOSE: To elucidate the characteristics of radiation carcinogenesis, the spectra of K- and N-ras oncogene mutations, loss of heterozygosity (LOH) and their association in X-ray-induced thymic lymphomas (TL) were determined by comparing with those of N-ethyl-N-nitrosourea (ENU)-induced and spontaneously occurring TL. MATERIALS AND METHODS: TL that arose in untreated, X-ray-irradiated and ENU-treated B6C3F1 mice were examined both for K- and N-ras mutations by PCR-SSCP and DNA sequencing and for LOH by PCR with polymorphic microsatellite markers. RESULTS: (1) ras gene mutations were found in a proportion of TL from X-ray-exposed (approximately 20%) and ENU-treated (30-40%) mice while no ras gene mutations were found in spontaneous TL. N-ras mutations were rare. (2) The spectrum of ras gene mutations was diverse and seemed to differ little between X-ray-induced and ENU-induced TL, even though there was a higher frequency of ras mutations in ENU-induced TL that clustered to K-ras codon 12. (3) The X-ray-induced TL showing K-ras mutation were associated with LOH on chromosome 6, while those showing no K-ras mutation were associated with high frequency of LOH on chromosomes 4, 11 and 12. CONCLUSION: These results demonstrate that, in the B6C3F1 mouse TL, X-ray-induced lymphomagenesis showed both the co-expression, yet low occurrence of allelic imbalance on chromosome 6 and K-ras mutation, and exclusive expression of frequent allelic imbalance on chromosomes 4, 11 and 12 and K-ras mutation.

Radiological findings of accidental radiation injury of the fingers: a case report.

This case report describes the medical follow-up of a 46-y-old (at the time of exposure) man who in 1971 accidentally exposed the fingers of his right hand to gamma-ray radiation from an iridium source that was used for nondestructive testing [estimated radiation dose: 26 Gy to 90 Gy (2,600 rad to 9,000 rad)]. No prominent acute injury was detected except for leukocytopenia (800 mm(-3)) and thrombocytopenia (15,000 mm(-3)). Three years later, the first, second, and third fingers presented repeated infection and started to develop contracture. Twenty-two years after exposure, he underwent amputation of the first and second fingers, and a toe graft was done. Radiological examinations prior to and following the operation revealed atrophic change of the finger bones and arterial injuries. Angiographic findings coincided with the region and extent of radiation injury of the fingers, which indicates that arterial damage is involved in the development of this chronic disorder.

Acute ventricular reduction with the acorn cardiac support device: effect on progressive left ventricular dysfunction and dilation in dogs with chronic heart failure.

BACKGROUND AND AIM: Surgical resection of myocardium that acutely reduces left ventricular (LV) volume in patients with advanced heart failure (HF), the so-called "Batista Operation," remains controversial. We examined the effects of acute LV reduction with the Acorn Cardiac Support Device (CSD) in dogs with HF (LV ejection fraction < 30%). METHODS: HF was produced in 15 dogs by intracoronary microembolization. In nine dogs, intravenous dobutamine was administered to reduce LV end-diastolic dimension (LVEDD) by 10%-25%. While on dobutamine infusion, the CSD, a preformed knitted polyester device, was surgically placed around the ventricles, anchored to the arteriovenous (AV) groove, and tailored anteriorly to fit snugly over the ventricles. Dogs were then weaned off dobutamine. RESULTS: On average, the procedure reduced LVEDD by 7 +/- 1 mm (range 5-12 mm). Of the nine dogs, two died before completion of the study and seven survived for the entire period. Six dogs did not undergo device placement and served as controls. All were followed for 3 months prior to sacrifice. In controls, LV end-diastolic volume increased after 3 months (66 +/- 5 mL vs 77 +/- 6 mL; p = 0.007), while in CSD-treated dogs (n = 7), it decreased (80 +/- 5 mL vs 60 +/- 3 mL; p = 0.002). In controls, LV ejection fraction (EF) decreased after 3 months (27 +/- 1% vs 23 +/- 1%; p = 0.001) but was unchanged in CSD-treated dogs (25 +/- 1% vs 26 +/- 1%; p = 0.66). Compared to controls, CSD-treated dogs showed improved LV diastolic dysfunction and chamber sphericity, decreased wall stress, and no functional mitral regurgitation (MR). CONCLUSION: In dogs with advanced HF, acute LV reduction with the Acorn CSD prevents progressive global LV dilatation and ameliorates functional MR.