Dimensionality of the premenstrual syndrome: confirmatory factor analysis of premenstrual dysphoric symptoms among college students

Premenstrual syndrome and premenstrual dysphoric disorder (PMDD) seem to form a severity continuum with no clear-cut boundary. However, since the American Psychiatric Association proposed the research criteria for PMDD in 1994, there has been no agreement about the symptomatic constellation that constitutes this syndrome. The objective of the present study was to establish the core latent structure of PMDD symptoms in a non-clinical sample. Data concerning PMDD symptoms were obtained from 632 regularly menstruating college students (mean age 24.4 years, SD 5.9, range 17 to 49). For the first random half (N = 316), we performed principal component analysis (PCA) and for the remaining half (N = 316), we tested three theory-derived competing models of PMDD by confirmatory factor analysis. PCA allowed us to extract two correlated factors, i.e., dysphoric-somatic and behavioral-impairment factors. The two-dimensional latent model derived from PCA showed the best overall fit among three models tested by confirmatory factor analysis (c²53 = 64.39, P = 0.13; goodness-of-fit indices = 0.96; adjusted goodness-of-fit indices = 0.95; root mean square residual = 0.05; root mean square error of approximation = 0.03; 90 percentCI = 0.00 to 0.05; Akaike's information criterion = -41.61). The items "out of control" and "physical symptoms" loaded conspicuously on the first factor and "interpersonal impairment" loaded higher on the second factor. The construct validity for PMDD was accounted for by two highly correlated dimensions. These results support the argument for focusing on the core psychopathological dimension of PMDD in future studies.

Estrogen-related receptor-gamma and peroxisome proliferator-activated receptor-gamma coactivator-1alpha regulate estrogen-related receptor-alpha gene expression via a conserved multi-hormone response element.

The expression of estrogen-related receptor-alpha (ERRalpha) is stimulated by estrogen in selective tissues. Recently, a correlation between ERRalpha expression and the induction of peroxisome proliferator-activated receptor-gamma coactivator-1alpha (PGC-1alpha) in the liver of fasting animals and in cold-stressed brown-fat tissues and skeletal muscle was shown. To explore the molecular mechanisms of ERRalpha regulation by diverse signals, the promoter of the human ERRalpha gene was cloned and characterized. Mutation and deletion analyses revealed that a 53 bp region containing repeated core element AGGTCA motifs of the ERRalpha gene serves as a multi-hormone response element (MHRE) for several nuclear receptors in transient co-transfection studies of human endometrial carcinoma (HEC-1B) cells. Among the nuclear receptors tested, ERRgamma bound to and robustly stimulated the transcription of reporters containing at least two AGGTCA motifs. Ectopic expression of PGC-1alpha in HEC-1B cells strongly activated the reporter containing the MHRE, presumably via the endogenous nuclear receptor binding to the element. Reducing the endogenous level of ERRgamma by small interfering RNA, and increasing the ERRgamma level by ectopic expression, substantially decreased and increased respectively the transactivation capability of PGC-1alpha. The activation function 2 domain of the ERRgamma and the L2 and L3 motifs of PGC-1alpha were essential to transactivate the MHRE. Additionally, PGC-1alpha increases the amount of endogenous ERRgamma bound to the MHRE region as determined by a chromatin immunoprecipitation assay. The present study demonstrates that the MHRE of the ERRalpha gene is a target for ERRgamma transactivation, which is enhanced by PGC-1alpha.

Estrogen receptor alpha and estrogen receptor-related receptor alpha1 compete for binding and coactivator.

The human estrogen receptor (ERalpha) and the human estrogen receptor-related receptor (ERRalpha1, NR3B1a) are members of the steroid/thyroid hormone receptor superfamily. We previously cloned an isoform of ERRalpha1 cDNA and demonstrated that ERRalpha1 binds to the human lactoferrin gene promoter and enhances estrogen responsiveness during transient transfection experiments. In this study, we show that ERRalpha1 and ERalpha may interfere in each other's transcriptional activity by competition for binding and coactivator. A VP16-ERRalpha1 chimera was constructed and transiently transfected into human endometrial carcinoma HEC-1B cells. This chimera activated reporter constructs containing the human lactoferrin gene estrogen response element (ERE) and the synthetic palindromic 3X-ERE, suggesting that ERRalpha1 binds to these EREs. Therefore, ERRalpha1 can compete with ERalpha for binding to the same EREs. ERRalpha1 is organized into modules which include a N-terminal region that shows repression function, a Zn-finger region that binds DNA and an activation region at the C terminus. The activation function of ERRalpha1 was mapped to the conserved AF2 region in the C-terminus by deletion analysis. The transactivation activity of ERRalpha1 can be enhanced by coactivator (SRC-1a) and suppressed by ERalpha in the presence of estrogen, suggesting that SRC-1a is required by both receptors for their activity. The repression of ERRalpha1 activation function by estrogen bound ERalpha, however, could not be reversed by increasing concentration of SRC-1a in the cells. This finding is consistent with the squelching phenomenon that exists between ERalpha and other steroid receptor family members. The studies demonstrated that ERRalpha1 and ERalpha may potentially regulate the same target gene independently as well as interfere with each other's functional activity by competition for binding and coactivator.

Estrogen receptor-related receptor alpha 1 interacts with coactivator and constitutively activates the estrogen response elements of the human lactoferrin gene.

The human estrogen receptor-related receptor (ERRalpha1, NR3B1a) was shown to bind a steroidogenic factor binding element (SFRE), TCAAGGTCATC, 26 base pairs upstream from the estrogen response element (ERE) of the human lactoferrin gene promoter. A mutation made at SFRE significantly reduced estrogen-dependent transcription from the lactoferrin ERE in human endometrial cells. In this study, we demonstrated that ERRalpha1 binds both SFRE and ERE elements and constitutively transactivates the lactoferrin gene promoter. In DNase I footprinting protection analysis, both SFRE and ERE regions were protected by glutathione S-transferase-ERRalpha1 fusion protein. The receptor formed two protein-DNA complexes with either SFRE or ERE in electrophoresis mobility shift assay. Homodimerization of ERRalpha1 was confirmed with the mammalian two-hybrid system. ERRalpha1 activates reporter constructs containing various types of estrogen response elements in endometrial and non-endometrial cells in transient transfection experiments. Overexpressing the coactivator, SRC1a or GRIP1, further enhances ERRalpha1-induced transcriptional activity. We demonstrated that the AF2 domain of ERRalpha1 is essential for the transactivation function and that deletion or mutation at this region abrogates the activation capability. Protein-protein interaction between the SRC1a and ERRalpha1 C terminus was confirmed with a GST glutathione S-transferase "pull-down" assay. When comparing ERRalpha1 and the estrogen receptor alpha (ERalpha) in many of the experiments, we found that ERalpha can also bind SFRE of the lactoferrin gene and transactivate the promoter activity in a ligand-dependent manner. The present study demonstrated that ERRalpha1 binds similar DNA elements as ERalpha and confers its transactivation function constitutively. Therefore, ERRalpha1 may actively modulate the estrogen response of lactoferrin gene as well as other estrogen-responsive genes.

Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter.

The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C-terminus of Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and small intestine. A full-length cDNA clone was isolated from a human colon library using EGFREB as the hybridization probe. The full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'-UTR, and a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue distribution and sequence homology to the mouse IKLF, we renamed this protein IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is organized into four exons, whose intron/exon junctions follow the GT/AG rule. The three zinc fingers are encoded by three exons. Nuclear localization of IKLF was demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection experiments and western analysis. Overexpression of IKLF in RL95 cells represses the activity of reporter constructs containing the CAAT/GT box of the mouse lactoferrin gene. These findings imply that IKLF is a nuclear transcription factor that binds to the CAAT/GT box, and functions as a modulator of the mouse lacto-ferrin gene promoter activity.

Regulation of lactoferrin gene expression by estrogen and epidermal growth factor: molecular mechanism.

Lactoferrin (LF) is a member of the transferrin gene family. Its expression in the mouse uterus is regulated by estrogen and epidermal growth factor (EGF). The author et al. cloned the LF gene promoter/enhancer region, and demonstrated that multihormone signaling pathways are involved in modulating LF gene activity. Three short but complex modules, within 400 bp from the transcription initiation site of the mouse LF gene, contain the response elements that are responsible for estrogen, retinoic acid, mitogen, and growth factor stimulation. These elements have been identified and characterized, using reporter constructs transiently transfected into human endometrial carcinoma RL95-2 cells. The author et al. used molecular approaches, such as deletion, insertion, and site-directed mutagenesis, to determine the relationship between the response elements, and to fine-map the crucial nucleotides within them. This article reviews the characterization of the estrogen and EGF response elements of the mouse LF gene promoter.

Tissue and site-specific methylation correlates with expression of the mouse lactoferrin gene.

We have previously examined the regulatory region of the mouse lactoferrin gene and have identified sequences essential for basal and hormonally induced expression. In this study, we explore the relationship between the methylation state of the mouse lactoferrin gene promoter and its expression in selected mouse tissues. In a transient expression system, transcriptional activity was blocked after in vitro methylation of the regulatory region of the mouse lactoferrin gene. In addition, the in vivo methylation state of three promoter region sites was assessed using Southern blot analysis of DNA digested with methylation-insensitive and -sensitive restriction enzymes. The results showed that site -455, upstream of the mouse lactoferrin estrogen response module, was highly unmethylated in DNA from both hormone-treated and -untreated mouse lung, liver, and spleen tissues. Also, in both treated and untreated samples, the -54 site is uniquely highly unmethylated in liver DNA, while the -22 site is unmethylated in spleen DNA. Northern blot analysis showed lactoferrin expression in tissues that were unmethylated at a minimum of two sites. These results show that the alteration of the methylation status of the three sites are tissue-specific and are associated with constitutive expression of lactoferrin.

Familial subepithelial corneal amyloidosis (gelatinous drop-like corneal dystrophy): exclusion of linkage to lactoferrin gene.

PURPOSE: Because corneal tissue with familial subepithelial corneal amyloidosis (FSCA; gelatinous drop-like dystrophy of the cornea) contains lactoferrin the possibility that the FSCA gene was the human lactoferrin (hLF) gene was investigated. Due to contradictory published information we also mapped the hLF gene. METHODS: We mapped the hLF gene using a genomic clone of the entire hLF gene as a probe by fluorescence in situ hybridization (FISH). Utilizing PCR primers that are specific to the hLF gene, we also mapped the hLF via radiation somatic cell hybrid analysis. Linkage of the FSCA gene to the hLF gene was evaluated by genetic linkage analysis using polymorphic markers within and in the vicinity of the hLF gene. RESULTS: The hLF gene mapped to the short arm of chromosome 3 at 3p21. Linkage analysis using polymorphic markers for hLF and haplotype analysis of the 3p21 loci indicates that the FSCA gene is not linked to the 3p21 locus. CONCLUSIONS: The gene for FSCA is not the hLF gene in these families.

Human estrogen receptor-like 1 (ESRL1) gene: genomic organization, chromosomal localization, and promoter characterization.

Estrogen receptor-like 1a (ESRL1a; same as estrogen receptor-related orphan receptors, ERR1) belongs to a subfamily of the nuclear receptor superfamily. We have previously shown that human ESRL1a modulates estrogen responsiveness of the lactoferrin gene promoter in transiently transfected endometrial carcinoma RL95-2 cells. In this study, we cloned and characterized the human ESRL1 gene. Through the fluorescence in situ hybridization method, the ESRL1 gene was localized to the centromere region of chromosome 11q12. Partial sequencing, restriction mapping, and PCR analysis revealed that the ESRL1 gene consists of seven exons and is approximately 20 kb in length. We found that the smallest exon (exon 3) contains 117 bp and the largest exon (exon 7) has 1032 bp. The smallest intron (intron 5) is only 88 bp long and the largest intron (intron 2) is 8 kb long. All introns have the conserved GT and AG dinucleotides present at the donor and acceptor sites, respectively. Like the estrogen receptor, the highly conserved DNA-binding domain of hESRL1a is encoded by exon 2 and exon 3, and the intron/exon junctions (2 and 3) are well conserved between the two genes. Primer extension analysis revealed multiple transcription initiation start sites in human uterine (HeLa, HEC, and RL95-2) cell lines. However, one major initiation start site was found by RNase protection assay. The hESRL1a mRNA is differentially expressed in various human tissues. The nucleotide sequence adjacent to the transcription start sites of the ESRL1 lacks the typical TATA and CAAT boxes but is GC rich and contains 10 consensus Sp1-binding elements and two E boxes. The region that contains these transcription factor-binding elements showed a high level of promoter activity when transiently transfected into RL95-2 cells.

Lactoferrin expression in mammary epithelial cells is mediated by changes in cell shape and actin cytoskeleton.

Lactoferrin is a secreted iron binding protein which is expressed during normal functional development of mammary epithelium. Murine mammary epithelial cell lines competent for milk protein expression were used to identify microenvironmental factors that regulate lactoferrin expression. While lactoferrin was not expressed in adherent monolayer cultures under standard subconfluent conditions on plastic, lactoferrin mRNA and protein steadily accumulated when the cells aggregated to form spheroids on a reconstituted basement membrane gel. However, unlike other milk proteins such as beta-casein, lactoferrin expression was also induced at high cell density in the absence of exogenously added basement membrane or prolactin. These results led us to examine whether changes in cell growth, cell-cell interactions and/or cell shape were responsible for regulation of lactoferrin gene expression. Rounded, non-proliferating cells in suspension in serum-free medium expressed lactoferrin even as single cells. Conversely, lactoferrin expression could be inhibited in non-proliferative cells in serum-free medium by maintaining them in contact with an air-dried extracellular matrix which caused the cells to retain flat, spread morphologies. These findings indicated that cessation of cell growth was not sufficient, that cell-cell interactions were not required, and that cell culture conditions which minimize cell spreading may be important in maintaining lactoferrin expression. Additional data supporting this latter concept were generated by treating spread cells with cytochalasin D. The resulting disruption of microfilament assembly induced both cell rounding and lactoferrin expression. Shape-dependent regulation of lactoferrin mRNA was both transcriptional and post-transcriptional. Surprisingly, treatment of rounded cells with a transcription inhibitor, actinomycin D, produced a stabilization of lactoferrin mRNA, suggesting that transcription of an unstable factor is required for degradation of lactoferrin mRNA. Importantly, lactoferrin mRNA expression was regulated similarly in early passage normal human mammary epithelial cells. In vivo, the changing extracellular matrix components of the mammary gland during different stages of normal and abnormal growth and differentiation may provide different physical constraints on the configurations of cell surface molecules. These physical constraints may be communicated to the cell interior through mechanical changes in the cytoskeleton. Unlike beta-casein whose expression is upregulated by specific integrin-mediated signals, lactoferrin may be representative of a class of proteins synthesized in the mammary gland using basal transcriptional and translational machinery. The suppression of lactoferrin expression that is observed in monolayer culture and in malignant tissues may reflect inappropriate cell shapes and cytoskeletal structures that are manifested under these conditions.

The mouse estrogen receptor-related orphan receptor alpha 1: molecular cloning and estrogen responsiveness.

Estrogen receptor-related orphan receptor alpha 1 is a member of the steroid/thyroid nuclear receptor superfamily. We have previously cloned the human estrogen receptor-related orphan receptor alpha 1 (hERR alpha 1) cDNA and demonstrated that it enhances estrogen responsiveness of the lactoferrin gene promoter in transfected human endometrial carcinoma cells. In the present study, we used the hERR alpha 1 cDNA as a probe and isolated the mouse homologue of ERR alpha 1 from the cDNA libraries of the brain and kidney. Sequence comparison between human and mouse ERR alpha 1 (mERR alpha 1) revealed that the homologies are 89% in nucleotides and 97% in amino acids. By electrophoresis mobility shift assay, we showed that the glutathione S-transferase-mERR alpha 1 fusion protein produced in a bacterial system bound to the human ERR alpha 1 DNA-binding element. Mouse uterine nuclear extract also interacted with this DNA element and produced three complexes in the mobility shift assay, one of which was supershifted by the hERR alpha 1 antiserum. A 2.2 kbp transcript was detected by Northern analysis in all adult mouse tissues tested; however, large variations in the amount of ERR alpha 1 mRNA were found among them. Multiple immunoreactive forms of mouse ERR alpha 1 were detected by Western analysis in non-reproductive tissues, whereas a major 53 kDa protein was found in reproductive tissues such as uterus, cervix and vagina. Diethylstilbestrol (DES) stimulated the expression of ERR alpha 1 mRNA in the uterus of 19-day-old mouse. We showed that DES and estradiol, but not progesterone or dexamethasone, enhanced the level of immunoreactive ERR alpha 1 in the mouse uterus. These results demonstrated that the ERR alpha 1 is an estrogen-responsive gene in the mouse uterus and provides a model system with which to study the biological roles of this nuclear orphan receptor.

Estrogen-related receptor, hERR1, modulates estrogen receptor-mediated response of human lactoferrin gene promoter.

We have shown previously that estrogen-stimulated transcription from the human lactoferrin gene in RL95-2 endometrium carcinoma cells is mediated through an imperfect estrogen response element (ERE) at the 5 -flanking region of the gene. Upstream from the ERE, a DNA sequence (-418 to -378, FP1) was selectively protected from DNase I digestion by nuclear extracts from endometrial and mammary gland cell lines. In this report, using the electrophoresis mobility shift assay, site-directed mutagenesis, and DNA methylation interference analyses, we show that three different nuclear proteins bind to the FP1 region (C1, C2, and C3 sites). The nuclear receptor, COUP-TF, binds to the C2 site. Mutations in the C1 binding region abolish C1 complex formation and reduce estrogen-dependent transcription from the lactoferrin ERE. When the imperfect ERE of the lactoferrin gene is converted to a perfect palindromic structure, the enhancing effect of the C1 binding element for estrogen responsiveness was abolished. We isolated a complementary DNA (cDNA) clone from an RL95-2 expression library that encodes the C1 site-binding protein. The encoded polypeptide maintains 99% amino acid identity with the previously described orphan nuclear receptor hERR1. A 2.2-kilobase mRNA was detected in RL95-2 cells by the newly isolated cDNA but not by the first 180 base pair of the published hERR1 sequence. By Western analysis, a major 42-kDa protein is detected in the RL95-2 nuclear extract with antibody generated against GST-hERR1 fusion protein. Finally, we show that the hERR1 interacts with the human estrogen receptor through protein-protein contacts.

Cross talk between peptide growth factor and estrogen receptor signaling systems.

Epidermal growth factor reproduces many of the effects of estrogen on the murine female reproductive tract and may partially mediate estrogen-induced growth and differentiation. The mechanism by which the actions of estrogens and epidermal growth factor (EGF) converge is unknown. The studies described herein were performed to investigate the possibility that some of the actions of EGF may be mediated through the estrogen receptor. A specific estrogen receptor (ER) antagonist inhibited estrogenlike effects of EGF in the mouse uterus, specifically induction of DNA synthesis and phosphatidylinositol turnover. In addition, EGF elicited enhanced nuclear localization of uterine ER and formation of a unique nuclear form of ER that is present after estrogen treatment. These in vivo observations indicated that EGF may elicit some of its actions by activation of nuclear ER. Thus, the effect of peptide growth factors on activation of a consensus estrogen response element was assessed in Ishikawa human endometrial adenocarcinoma cells, which contain negligible ER levels, and in BG-1 human ovarian adenocarcinoma cells, which contain abundant ER. EGF and TGF alpha induced transcriptional activation of a consensus estrogen response element (ERE) in an ER-dependent manner in both cell types. In addition, insulinlike growth factor I (IGF-I) was as potent as 17 beta-estradiol in BG-1 cells. Synergism between growth factors and estrogen was observed in both cell types, although synergism was not observed between the different classes of growth factors [i.e., transforming growth factor alpha (TGF alpha) and IGF-I] in BG-1 cells. The most potent activator of ERE-dependent transcription was a protein kinase C activator (TPA), which acted synergistically with 17 beta-estradiol. A protein kinase C inhibitor abolished the effect of TPA but not that of 17 beta-estradiol, IGF-I, or TGF alpha. A protein kinase A activator elicited ER-dependent activation of transcription and did not synergize with estrogen or growth factors. In conclusion, some physiologic actions of peptide growth factors are dependent on ER. Indeed, growth factors are capable of eliciting ER-dependent activation of an ERE. Both the protein kinase A and protein kinase C pathways can elicit ER-dependent transcriptional activation; however, it is unlikely that these pathways mediate the effects of peptide growth factors on the ER in BG-1 cells.

Molecular feminization of mouse seminal vesicle by prenatal exposure to diethylstilbestrol: altered expression of messenger RNA.

Exposure to estrogens during critical stages of development has been reported to cause irreversible changes in estrogen target tissues such as the reproductive tract. In fact, recent studies using mice describe prenatal estrogen exposure resulting in the expression of the major estrogen-inducible uterine secretory protein, lactoferrin (LF), by the seminal vesicles of the male offspring. Thus, we have studied the role of estrogens in abnormal and normal gene expression in the developing male reproductive tract using LF and seminal vesicle secretory protein IV (SVS IV), an androgen-regulated murine seminal vesicle secretory protein, as markers. Lactoferrin and SVS IV protein and mRNA expression were studied in histological samples by using the techniques of in situ hybridization (ISH) and immunohistochemistry (IHC). Seminal vesicle secretory protein IV was expressed in all (100%) epithelial cells of the control seminal vesicle, but this protein was decreased by castration. However, LF expression was undetectable by ISH or IHC in control seminal vesicle epithelium. Lactoferrin was inducible in 2% of the seminal vesicle epithelial cells from adult castrated mice treated with estradiol 17 beta (E2; 20 micrograms/kg/day for 3 days), indicating that a small percentage of the seminal vesicle cells could be induced to secrete LF after modification of the endocrine environment. Prenatal DES treatment (100 micrograms./kg. maternal body weight on days 9 through 16 of gestation) resulted in the male offspring exhibiting constitutive expression of LF in 5% of the seminal vesicle epithelial cells, while expression of the androgen-regulated protein SVS IV was slightly decreased. The maximal contrast between LF and SVS IV expression was observed in prenatally DES-treated mice that were subsequently castrated as adults and further treated with E2; LF was detected in 40% of the epithelial cells in these mice. Double immunostaining techniques revealed that epithelial cells which were making LF had ceased production of SVS IV. Since a large percentage of the epithelial cells in the intact prenatal DES exposed male was capable of expressing the normal gene product, SVS IV, it was concluded that DES treatment during prenatal development appears to imprint or induce estrogenic sensitivity in the adult seminal vesicle, causing increased production of LF. The results suggest that this altered protein response may be an example of atypical gene expression in male reproductive tract tissues following hormonal manipulation early in development.

Identification of the estrogen sensitive marker in human endometrial carcinoma RL95-2 cells.

Estrogen exerts a variety of biological effects on human reproductive tissues. However, little is understood about the estrogenic effect on human endometrial cells in vitro. This study was designed to investigate estrogen action on c-myc and c-fos oncogenes and lactoferrin gene expression in human endometrial carcinoma RL95-2 cells. The results indicate that estrogen can induce c-myc oncogene expression in 4 h. Neither c-fos nor the lactoferrin messenger was detectable, nor could they be induced by estrogen. Transfection with human estrogen receptor expression vector to the RL95-2 cells does not restore the estrogen responsiveness. In addition to estrogen, epidermal growth factor (EGF) and tumor promoter 12-O-tetradecanoylphorbol 13-acetate (TPA) can also induce c-myc expression with no effect on c-fos or lactoferrin expression. Our data suggest that the c-myc oncogene in human endometrial carcinoma RL95-2 cells is the sensitive target gene for steroid hormone and growth factor action.

Characterization of a mitogen-response unit in the mouse lactoferrin gene promoter.

Lactoferrin is present in a variety of tissues and biological fluids; however, the amount differs significantly due to differential expressions. We have previously demonstrated that the mouse lactoferrin gene is regulated by estrogen through an estrogen-response DNA element located at -349, upstream from the transcription start site (+1). In this report, we characterized by deletion and mutation analyses a cluster of mitogen-response elements located between -80 and -40 of the mouse lactoferrin promoter. We demonstrated that the chimeric chloramphenicol acetyltransferase reporter constructs (the -103 to +1 sequence of the mouse lactoferrin gene) containing the mitogen-response unit of the lactoferrin gene were stimulated by cAMP, forskolin, 12-O-tetradecanoylphorbol-13-acetate, and epidermal growth factor/recombinant transforming growth factor-alpha (EGF/TGF-alpha) in a time- and dose-dependent manner. The sequence at position -52 to -40 (mLF-CRE) of the gene conferred transcriptional activation in the presence of forskolin, cyclic AMP, and 12-O-tetradecanoylphorbol-13-acetate in transiently transfected human endometrium carcinoma RL95-2 cells, whereas the region at -80 to -60 responded to EGF/TGF-alpha stimulation. Overexpression of the catalytic unit of protein kinase C or protein kinase A in the RL95-2 cells elevated the chloramphenicol acetyl-transferase activity of the reporter construct 5-6-fold. The mobility shift assay suggested that AP1 and CREB or related proteins participated in complex formation with the mLF-CRE, whereas different proteins bound to the EGF/TGF-alpha-response element.

Lactoferrin gene promoter in human and mouse. Analogous and dissimilar characteristics.

Lactoferrin promoter and the 5'-flanking region of both human and mouse were isolated from a genomic library constructed with lambda phage. A 2.0 kbp Sac I fragment of the human clone (HLF031a.30) and a 3.0 kbp Eco R I/Hinc II fragment of the mouse clone (mL14p9E) containing the lactoferrin promoter, 5'-flanking region, first exon and partial intron were sequenced completely. There were many sequence homologies between human and mouse at the promoter/enhancer (1 to -363) region, yet substantial divergence was observed beyond this region. To determine the promoter activity, 5'-deletion mutants of the mouse lactoferrin gene were linked to a CAT-reporter plasmid and transfected into the human endometrium carcinoma cell line, RL95-2. We identified a number of positive and negative regulatory sequences as well as the estrogen-response element in the 5'-flanking region of the lactoferrin gene. The imperfect estrogen response elements of both human and mouse are functional as demonstrated by transfection experiments, band-shift assay and DNase I footprint analysis. The molecular mechanism that governs the estrogen-stimulated response, however, differs between human and mouse.

Peptide growth factors elicit estrogen receptor-dependent transcriptional activation of an estrogen-responsive element.

Epidermal growth factor (EGF) elicits estrogen receptor (ER)-dependent physiological sequelae and estrogen-like biochemical effects on the ER in the mouse uterus. These in vivo observations indicate that EGF may elicit some of its actions by activation of the ER. The effect of peptide growth factors on activation of a consensus estrogen-responsive element was assessed in a strain of Ishikawa human endometrial adenocarcinoma cells with negligible levels of ERs, as determined by Western blot and [3H]estradiol binding, and in BG-1 human ovarian adenocarcinoma cells, which contain abundant ERs. EGF and transforming growth factor-alpha induced transcriptional activation of a consensus ERE in an ER-dependent manner in both cell types. Transcriptional activation by the growth factors was inhibited by ICI 164,384, an ER receptor antagonist, and neutralizing antibodies to the EGF receptor. Immunodetection of the ER in BG-1 cells demonstrated that receptor levels were not induced by transforming growth factor-alpha vs. untreated cells. ER deletion mutants containing amino acids 1-339 and 121-599 were transfected into Ishikawa cells. The 1-339 mutant was more active in inducing transcription after EGF treatment than the 121-599 mutant. Estrogen only stimulated transcription in the presence of the 121-599 mutant, while 1-339 was inactive. Interestingly, synergism between a physiological dose of estrogen and peptide growth factors was observed. The presence of cross-talk between EGF receptor and ER signaling pathways suggests that interactions between growth factors and steroid receptors may modulate hormonal activity influencing normal and aberrant function in mammalian cells.

COUP-TF acts as a competitive repressor for estrogen receptor-mediated activation of the mouse lactoferrin gene.

We previously demonstrated that the estrogen response module (mERM) of the mouse lactoferrin gene, which contains an overlapping chicken ovalbumin upstream promoter transcription factor (COUP-TF)- and estrogen receptor-binding element, is responsible for estrogen induction. In this report we show that COUP-TF represses the mERM response to estrogen stimulation. Mutation and deletion of the COUP-TF-binding element or reduction of the endogenous COUP-TF increases mERM estrogen responsiveness. Likewise, overexpression of the COUP-TF expression vector blocked the estrogen-stimulated response of mERM in transfected cells. The molecular mechanism of this repression is due to the competition between COUP-TF and the estrogen receptor for binding at identical contact sites in the overlapping region of the mERM. Our results indicate that two members of the steroid-thyroid receptor superfamily work in concert to modulate lactoferrin gene expression.

Differential molecular mechanism of the estrogen action that regulates lactoferrin gene in human and mouse.

The 5'-flanking region of the human lactoferrin gene was isolated from a human placental genomic library. This genomic clone contains a 16-kilobase pair (kbp) insert and produces seven fragments when digested with the SacI restriction enzyme. We sequenced one of the fragments that comprises 1294 bp of the 5'-flanking sequence, 79 bp of the first exon, and 690 bp of the first intron. A major transcription start site was mapped by primer extension. The region immediately upstream from the transcription initiation site following the first exon is abundant in G and C nucleotides. In the promoter and 5'-flanking region within a 300-bp stretch (-465 to -165) of the DNA, we found a noncanonical TATA box (ATAAA), CAAT-like sequence (CAAC) and sequences homologous to the consensus SP1 binding site, Pu.1/Sp.1 binding element (PU box), two half-palindromic estrogen response elements (EREs; GGTCA), an imperfect ERE (GGTCAAGGCGATC), and a sequence resembling the chicken ovalbumin upstream promoter transcription factor (COUP-TF) binding site (GTCTCACAGGTCA). The COUP-TF binding site and the imperfect ERE shared five nucleotides (GGTCA). With the exception of the two half-palindromic EREs, the elements with very well matched sequences were also found in the corresponding positions in the mouse lactoferrin gene. The synthetic oligonucleotide, including the 26 bp of COUP/ERE sequence, was cloned before the SV40 promoter in a chloramphenicol acetyltransferase reporter construct. These chimeric plasmids were transiently transfected into human endometrium carcinoma RL95-2 cells to assess hormone responsiveness. We found that the COUP/ERE element acted as an enhancer in response to estrogen stimulation. In vitro DNase I footprinting analysis showed binding of the estrogen receptor on the imperfect ERE. In contrast to the mouse lactoferrin COUP/ERE element, COUP-TF does not interact with this element, as demonstrated by band shift assay and site-directed mutagenesis. Therefore, the molecular mechanisms of the estrogen action that govern the lactoferrin gene expression differ between mouse and human.