Visible-Light-Responsive Novel Ru(II)-Metallo-Antibiotics with Potential Antibiofilm and Antibacterial Activity.

Growing challenges with antibiotic resistance pose immense challenges in combating microbial infections and biofilm prevention on medical devices. Lately, antibacterial photodynamic therapy (aPDT) is now emerging as an alternative therapy to overcome this problem. Herein, we synthesized and characterized four Ru(II)-complexes, viz., [Ru(ph-tpy)(bpy)Cl]PF6 (Ru1), [Ru(ph-tpy)(dpq)Cl]PF6 (Ru2), [Ru(ph-tpy)(dppz)Cl]PF6 (Ru3), and [Ru(ph-tpy)(dppn)Cl]PF6 (Ru4) (where 4'-phenyl-2,2':6',2″-terpyridine = ph-tpy; 2,2'-bipyridine = bpy; dipyrido[3,2-f:2',3'-h]quinoxaline = dpq; dipyrido[3,2-a:2',3'-c]phenazine = dppz; and Benzo[I]dipyrido[3,2-a:2',3'-c]phenazine = dppn), among which Ru2-Ru4 are novel. Octahedral geometry of the complexes with a RuN5Cl core was evident from the crystal structure of Ru2. Ru1-Ru4 showed an MLCT absorption band in the 450-600 nm region, useful for aPDT performances. Further, optimum triplet excited state energy and excellent photostability of Ru1-Ru4 made them good photosensitizers for aPDT. Ru1-Ru4 demonstrated enhanced antimicrobial activity on visible-light exposure (400-700 nm, 10 J cm-2), confirmed using different antibacterial assays. Mechanistic studies revealed that inhibition of bacterial growth was due to the generation of oxidative stress (via NADH oxidation and ROS generation) upon treatment with Ru2-Ru4, resulting in destruction of the bacterial wall. Ru2 performed best killing performance against both Gram-negative (Escherichia coli) and Gram-positive (Bacillus subtilis) bacteria when exposed to light. Ru2-Ru4, when coated on a polydimethylsiloxane (PDMS) disk, showed long-term reusability and durable antibiofilm properties. Molecular docking confirmed the efficient interaction of Ru2-Ru4 with FabH (regulates fatty acid biosynthesis of E. coli) and PgaB (gives structural stability and helps biofilm formation of E. coli), resulting in probable downregulation. In vivo studies with healthy Wistar rats confirmed the biocompatibility of Ru2. This study shows that these lead complexes (Ru2-Ru4) can be used as potent alternative antimicrobial agents in low concentrations toward bacterial eradication with photodynamic therapy (PDT).

Comparative Study of Sonodynamic and Photoactivated Cancer Therapies with Re(I)-Tricarbonyl Complexes Comprising Phenanthroline Ligands.

Herein, we have compared the effectivity of light-based photoactivated cancer therapy and ultrasound-based sonodynamic therapy with Re(I)-tricarbonyl complexes (Re1-Re3) against cancer cells. The observed photophysical and TD-DFT calculations indicated the potential of Re1-Re3 to act as good anticancer agents under visible light/ultrasound exposure. Re1 did not display any dark- or light- or ultrasound-triggered anticancer activity. However, Re2 and Re3 displayed concentration-dependent anticancer activity upon light and ultrasound exposure. Interestingly, Re3 produced 1O2 and OH• on light/ultrasound exposure. Moreover, Re3 induced NADH photo-oxidation in PBS and produced H2O2. To the best of our knowledge, NADH photo-oxidation has been achieved here with the Re(I) complex for the first time in PBS. Additionally, Re3 released CO upon light/ultrasound exposure. The cell death mechanism revealed that Re3 produced an apoptotic cell death response in HeLa cells via ROS generation. Interestingly, Re3 showed slightly better anticancer activity under light exposure compared to ultrasound exposure.

Towards Selective Delivery of a Ruthenium(II) Polypyridyl Complex-Containing Bombesin Conjugate into Cancer Cells.

An increasing number of novel Ru(II) polypyridyl complexes have been successfully applied as photosensitizers (PSs) for photodynamic therapy (PDT). Despite recent advances in optimized PSs with refined photophysical properties, the lack of tumoral selectivity is often a major hurdle for their clinical development. Here, classical maleimide and versatile NHS-activated acrylamide strategies were employed to site-selectively conjugate a promising Ru(II) polypyridyl complex to the N-terminally Cys-modified Bombesin (BBN) targeting unit. Surprisingly, the decreased cell uptake of these novel Ru-BBN conjugates in cancer cells did not hamper the high phototoxic activity of the Ru-containing bioconjugates and even decreased the toxicity of the constructs in the absence of light irradiation. Overall, although deceiving in terms of selectivity, our new bioconjugates could still be useful for advanced cancer treatment due to their nontoxicity in the dark.

Lysosome-targeted ruthenium(II) complexes induce both apoptosis and autophagy in HeLa cells.

Ruthenium complexes with good biological properties have attracted increasing attention in recent decades. In this work, three ruthenium polypyridine complexes containing 5-fluorouracil derivatives as ligands, [Ru(bpy)2(L)]2+ (Ru1), [Ru(phen)2(L)]2+ (Ru2), [Ru(dip)2(L)]2+ (Ru3) (L = 1-((1,10-phenanthroline-5-amino) pentyl)-5-fluorouracil; bpy = 2,2'-bipyridine; phen =1,10-phenanthroline; dip = 4,7-diphenyl-1,10-phenanthroline), were synthesized and characterized. Based on in vitro cytotoxicity tests, Ru3 (IC50 = 7.35 ± 0.39 µM) showed the best anticancer activity among three compounds in the selected cell lines. It is worth noting that Ru3 also exerts less cytotoxicity on LO2 cell lines, with an IC50 value 5 times higher than that on HeLa cells, indicating its selective activity. Mechanism studies revealed that Ru3 can specifically target lysosomes and induce cell apoptosis in a caspase-dependent manner. Specifically, Ru3 can arrest cell cycle at the G0/G1 phase, increase the intracellular reactive oxygen species (ROS) level, and then damage DNA. In short, Ru3 can eventually cause cell death through the synergy of inducing apoptosis and autophagy, which was further proven by western blot assay results.

Single-Cell Chemistry of Photoactivatable Platinum Anticancer Complexes.

The Pt(IV) prodrug trans, trans, trans-[Pt(pyridine)2(N3)2(OH)2] (Pt1) and its coumarin derivative trans, trans, trans-[Pt(pyridine)2(N3)2(OH)(coumarin-3-carboxylate)] (Pt2) are promising agents for photoactivated chemotherapy. These complexes are inert in the dark but release Pt(II) species and radicals upon visible light irradiation, resulting in photocytotoxicity toward cancer cells. Here, we have used synchrotron techniques to investigate the in-cell behavior of these prodrugs and visualize, for the first time, changes in cellular morphology and Pt localization upon treatment with and without light irradiation. We show that photoactivation of Pt2 induces remarkable cellular damage with extreme alterations to multiple cellular components, including formation of vacuoles, while also significantly increasing the cellular accumulation of Pt species compared to dark conditions. X-ray absorption near-edge structure (XANES) measurements in cells treated with Pt2 indicate only partial reduction of the prodrug upon irradiation, highlighting that phototoxicity in cancer cells may involve not only Pt(II) photoproducts but also photoexcited Pt(IV) species.

An Activatable Near-Infrared Fluorescence Probe for in Vivo Imaging of Acute Kidney Injury by Targeting Phosphatidylserine and Caspase-3.

Renal-clearable and target-responsive near-infrared (NIR) fluorescent imaging probes have been promising for in vivo diagnosis of acute kidney injury (AKI). However, designing an imaging probe that is renal-clearable and concurrently responsive toward multiple molecular targets to facilitate early detection of AKI with improved sensitivity and specificity is challenging. Herein, by leveraging the receptor-mediated binding and retention effect along with enzyme-triggered fluorescence activation, we design and synthesize an activatable small-molecule NIR fluorescent probe (1-DPA2) using a "one-pot sequential click reaction" approach. 1-DPA2 can target both the externalized phosphatidylserine (PS) and active caspase-3 (Casp-3), two essential biomarkers of apoptosis, producing enhanced 808 nm NIR fluorescence and a high signal-to-background ratio (SBR) amenable to detecting the onset of cisplatin-induced AKI in mice as early as 24 h post-treatment with cisplatin. We not only monitor the gradual activation of Casp-3 in the kidney of mice upon AKI progression but also can report on the progressive recovery of kidney functions in AKI mice following N-acetyl-l-cysteine (NAC) therapy via real-time fluorescence imaging by 1-DPA2. This study demonstrates the ability of 1-DPA2 for longitudinal monitoring of renal cell apoptosis by concurrently targeting PS externalization and Casp-3 activation, which is efficient for early diagnosis of AKI and useful for prediction of potential drug nephrotoxicity as well as in vivo screening of anti-AKI drugs' efficacy.

Ultrasmall Zwitterionic Polypeptide-Coordinated Nanohybrids for Highly Efficient Cancer Photothermal Ferrotherapy.

Ferroptosis therapy (FT) based on the Fenton reaction of ferrous nanoparticles has been becoming a unique strategy for cancer treatment; however, current ferrous nanoparticles suffer from slower Fenton reaction kinetics, lower ferroptosis efficacy, and long-term toxicity, so it is urgent to construct biocompatible ferrous nanomaterials with highly efficient Fenton reaction activity for cancer FT. Inspired by single-atom catalysis and size-determined tumor penetration, we conceived an innovative strategy for constructing ultrasmall zwitterionic polypeptide-coordinated nanohybrids of PCGA@FeNP with about 6 nm by utilizing thiol/hydroxyl-iron cooperative coordination chemistry. The ultrasmall size, unsaturated ferrous coordination, and intracellular acidic pH could accelerate the Fenton reaction, thus boosting the efficacy of ferroptosis. Moreover, those coordinated nanohybrids exhibited prominent photothermia with 59.5% conversion efficiency, further accelerating the Fenton reaction and inducing a synergistic effect between FT and photothermal therapy (PTT). In vitro and in vivo GPX-4 expression ascertained that PCGA@FeNP indeed induced effective FT and synergistic FT-PTT. Remarkably, in vivo FT-PTT completely ablated 4T1 solid tumors by one treatment, presenting outstanding and synergistic antitumor efficacy via the photothermia-boosted ferroptosis and apoptosis pathways. This work supplies a practicable strategy to fabricate ultrasmall zwitterionic coordination nanohybrids for highly efficient cancer FT and FT-PTT theranostics with potential clinical transitions.

Conjugated Coordination Porphyrin-based Nanozymes for Photo-/Sono-Augmented Biocatalytic and Homologous Tumor Treatments.

Porphyrin-based nanozymes (Porzymes) have shown promising application potential to fight against tumors using catalytically generated reactive oxygen species from the excessively produced H2O2 in the tumor microenvironment. However, the low coordination porphyrin (CP) loading ratio, difficult controllable nanostructure, low bioavailability, and low biocatalytic activities of current established Porzymes have severely limited their antitumor applications. Here, a novel malignant melanoma cell membrane-coated Pd-based CP nanoplatform (Trojan Porzymes) has been synthesized for biocatalytic and homologous tumor therapies. The Trojan Porzymes exhibit a high CP loading ratio, uniform nanoscale size, single-atom nanostructure, homologous targeted ability, and high-efficiency photo/sono-augmented biocatalytic activities. The enzyme-like biocatalytic experiments display that the Trojan Porzymes can generate abundant •OH via chemodynamic path and 1O2 via visible light or ultrasound excitation. Then we demonstrate that the Trojan Porzymes show homologous targeting ability to tumor cells and can achieve efficient accumulation and long-term retention in cancer tissues. Our in vivo data further disclose that the photo/sono-assisted chemodynamic therapies can significantly augment the treatment efficiency of malignant melanoma. We believe that our work will afford a new biocatalytic and homologous strategy for future clinical malignant melanoma treatments, which may inspire and guide more future studies to develop individualized biomedicine in precise tumor therapies.

Oxoplatin-B, a cisplatin-based platinum(IV) complex with photoactive BODIPY for mitochondria specific "chemo-PDT" activity.

Oxoplatin-B, a platinum(IV) complex [Pt(NH3)2Cl2(L1)(OH)] (1) of 4-methylbenzoic acid (HL1) functionalized with 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene (BODIPY) was prepared, characterized and its antitumor activity studied. [Pt(NH3)2Cl2(L2)(OH)] (2) of 4-methylbenzoic acid (HL2) was studied as a control. Complex 1 showed an absorption band at 500 nm (ɛ = 4.34 × 104 M-1 cm-1) and an emission band at 515 nm (λex = 488 nm, ΦF = 0.64) in 1% dimethyl sulfoxide/Dulbecco's Modified Eagle's Medium (pH = 7.2). Visible light-induced (400-700 nm) generation of singlet oxygen was evidenced from 1,3-diphenylisobenzofuran titration study. Complex 1 showed photo-induced cytotoxicity in visible light (400-700 nm, 10 J cm-2) against human breast cancer (MCF-7), cervical cancer (HeLa) and lung cancer (A549) cells (IC50: 1.1-3.8 µM) while being less toxic in normal cells. Confocal imaging showed mitochondrial localization with additional evidence from platinum content from isolated mitochondria and 5,5,6,6'-tetrachloro-1,1',3,3' tetraethylbenzimi-dazoylcarbocyanine iodide (JC-1) assay. Cellular apoptosis was observed from Annexin-V-FITC (fluorescein isothiocyanate)/propidium iodide assay.

Carbon Monoxide Inhibits Cytochrome P450 Enzymes CYP3A4/2C8 in Human Breast Cancer Cells, Increasing Sensitivity to Paclitaxel.

Paclitaxel (PTX) is a first-line treatment in breast cancer, though resistance develops quickly and frequently. Cytochrome P450 enzymes CYP3A4 and CYP2C8, which metabolically inactivate PTX in hepatic tissue, are overexpressed in malignant breast tissues. CYP3A4 expression correlates with PTX therapy failure and poor outcomes, though no direct evidence of CYP3A4 contributing to PTX sensitivity exists. Because CYP3A4/2C8 is susceptible to carbon monoxide (CO)-mediated inhibition and CO (a gaseous signaling molecule) has previously exhibited drug-sensitizing effects in cancer cells, we hypothesized that CO-mediated inhibition of CYP3A4/2C8 could lead to enhanced drug sensitivity. Using a photo-activated CO-releasing molecule, we have assessed the ability of CO to alter the pharmacokinetics of PTX in breast cancer cells via inhibition of CYP3A4/2C8 and determined that CO does enhance sensitivity of breast cancer cells to PTX. Inhibition of CYP3A4/2C8 by CO could therefore be a promising therapeutic strategy to enhance PTX response in breast cancer.

A valproic acid-modified platinum diimine complex as potential photosensitizer for photodynamic therapy.

Histone deacetylase inhibitors have often been used in combination treatment of various types of cancers due to their non-genotoxic epigenetic potential. Valproic acid (VPA) is a well-known histone deacetylase inhibitor. Conjugate of VPA with a phtoactive platinum diimine complex through an ester bond has been fabricated to potentiate the photocytotoxicity of the photosensitizer. Its capability to generate singlet oxygen, behavior in the presence of esterase, and photocytotoxicity in tumor cells have also been studied. The results revealed that the novel VPA-modified platinum diimine complex could produce singlet oxygen efficiently and release VPA in the presence of porcine liver esterase. The results also suggested that incorporation of VPA moiety into the platinum diimine complex might significantly enhance the cytotoxicity of the complex.

Exploring the potential of highly charged Ru(II)- and heteronuclear Ru(II)/Cu(II)-polypyridyl complexes as antimicrobial agents.

The antimicrobial potential of two ruthenium(II) polypyridyl complexes, [Ru(phen)2L1]2+ and [Ru(phen)2L2]2+ (phen = 1,10-phenanthroline) containing the 4,4'-(2,5,8,11,14-pentaaza[15])-2,2'-bipyridilophane (L1) and the 4,4'-bis-[methylen-(1,4,7,10-tetraazacyclododecane)]-2,2' bipyridine (L2) units, is herein investigated. These peculiar polyamine frameworks afford the formation of highly charged species in solution, influence the DNA-binding and cleavage properties of compounds, but they do not undermine their singlet oxygen sensitizing capacities, thus making these complexes attractive 1O2 generators in aqueous solution. L1 and L2 also permit to stably host Fenton -active Cu2+ ion/s, leading to the formation of mixed Ru2+/Cu2+ forms capable to further strengthen the oxidative damages to biological targets. Herein, following a characterization of the Cu2+ binding ability by [Ru(phen)2L2]2+, the water-octanol distribution coefficients, the DNA binding, cleavage and 1O2 sensitizing properties of [Ru(phen)2L2]2+ and [Cu2Ru(phen)2L2]6+ were analysed and compared with those of [Ru(phen)2L1]2+ and [CuRu(phen)2L1]4+. The antimicrobial activity of all compounds was evaluated against B. subtilis, chosen as a model for gram-positive bacteria, both under dark and upon light-activation. Our results unveil a notable phototoxicity of [Ru(phen)2L2]2+ and [Cu2Ru(phen)2L2]6+, with MIC (minimal inhibitory concentrations) values of 3.12 µM. This study highlights that the structural characteristics of polyamine ligands gathered on highly charged Ru(II)-polypyridyl complexes are versatile tools that can be exploited to achieve enhanced antibacterial strategies.

Phototriggered cytotoxic properties of tricarbonyl manganese(I) complexes bearing α-diimine ligands towards HepG2.

Reaction between bromo tricarbonyl manganese(I) and N,N'-bis(phenyl)-1,4-diaza-1,3-butadiene ligands, bearing different electron-donating and electron-withdrawing groups R = OCH3, Cl, and NO2 in the ortho- and para-positions on the phenyl substituent, afforded [MnBr(CO)3(N-N)] complexes. The influence of the character and position of the substituent on the dark stability and carbon monoxide releasing kinetics was systematically investigated and correlated with the data of the time-dependent density functional theory calculations. The combined UV/Vis and IR data clearly revealed that the aerated solutions of [MnBr(CO)3(N-N)] in either coordinating or noncoordinating solvents are dark stable and the fluctuations observed during the incubation period especially in the case of the nitro derivatives may be attributed to the exchange of the axial bromo ligand with the coordinating solvent molecules. The free ligands and nitro complexes were non-cytotoxic to HepG2 cells under both the dark and illumination conditions. In the dark, Mn(I) compounds, incorporating o-OCH3 and o-Cl, exhibited excellent cytotoxicity with IC50 values of 18.1 and 11.8 µM, while their para-substituted analogues were inactive in the dark and active upon the irradiation at 365 nm with IC50 values of 5.7 and 6.7 µM, respectively.

The anti-cancer effect of series of strained photoactivatable Ru(II) polypyridyl complexes on non-small-cell lung cancer and triple negative breast cancer cells.

Ruthenium complexes have been recently reported as potential chemotherapeutic agents that offer tumor selectivity and low tumor resistance. This study investigates the photochemistry and the effect of four strained photoactivatable polypyridyl ruthenium(II) complexes on non-small-cell lung cancer (A549) and triple negative breast cancer (MDA-MB-231) cells. All four ruthenium(II) complexes, [Ru(bpy)2dmbpy]Cl2 (C1) where (bpy = 2,2'-bipyridine and dmbpy = 6,6'-dimethyl-2,2'-bipyridine), [Ru(phen)2dmbpy]Cl2 (C2) where (phen = 1,10-phenanthroline), [Ru(dpphen)2dmbpy]Cl2 (C3) (where dpphen = 4,7-diphenyl-1,10-phenanthroline) and [Ru(BPS)2dmbpy]Na2 (C4) where (BPS = bathophenanthroline disulfonate) eject the dmbpy ligand upon activation by blue light. Determination of the octanol-water partition coefficient (log P) revealed that C3 was the only lipophilic complex (log P = 0.42). LC-MS/MS studies showed that C3 presented the highest cellular uptake. The cytotoxic effect of the complexes was evaluated with and without blue light activation using WST-1 kit. Data indicated that C3 exhibited the highest cytotoxicity after 72 h (MDA-MB-231, IC50 = 0.73 µM; A549, IC50 = 1.26 µM) of treatment. The phototoxicity indices of C3 were 6.56 and 4.64 for MDA-MB-230 and A549, respectively. Upon light activation, C3 caused significant ROS production and induced apoptosis in MDA-MB-231 cells as shown by flow cytometry. It also significantly increased Bax/Bcl2 ratio and PERK levels without affecting caspase-3 expression. C3 exhibited poor dark toxicity (IC50 = 74 µM) on rat mesenchymal stem cells (MSCs). In conclusion, the physical property of the complexes dictated by the variable ancillary ligands influenced cellular uptake and cytotoxicity. C3 may be considered a promising selective photoactivatable chemotherapeutic agent that induces ROS production and apoptosis.

Investigating the influence of relativistic effects on absorption spectra for platinum complexes with light-activated activity against cancer cells.

We report the first systematic investigation of relativistic effects on the UV-vis spectra of two prototype complexes for so-called photo-activated chemotherapy (PACT), trans-trans-trans-[Pt(N3)2(OH)2(NH3)2] and cis-trans-cis-[Pt(N3)2(OH)2(NH3)2]. In PACT, design of new drugs requires in-depth understanding of the photo-activation mechanisms. A first step is usually to rationalize their UV-vis spectra for which time-dependent density functional theory (TD-DFT) is an indispensable tool. We carried out TD-DFT calculations with a systematic series of non-relativistic (NR), scalar-relativistic (SR), and four-component (4c) Hamiltonians. As expected, large differences are found between spectra calculated within 4c and NR frameworks, while the most intense features (found at higher energies below 300 nm) can be reasonably well reproduced within a SR framework. It is also shown that effective core potentials (ECPs) yield essentially similar results as all-electron SR calculations. Yet the underlying transitions can be strongly influenced by spin-orbit coupling, which is only present in the 4c framework: while this can affect both intense and less intense transitions in the spectra, the effect is most pronounced for weaker transitions at lower energies, above 300 nm. Since the investigated complexes are activated with light of wavelengths above 300 nm, employing a method with explicit inclusion of spin-orbit coupling may be crucial to rationalize the activation mechanism.

Hydroxy-corrole and its gallium(III) complex as new photosensitizer for photodynamic therapy against breast carcinoma.

Three mono-hydroxy corroles 1-3 and their gallium(III) complexes Ga1-3 were synthesized, and their photodynamic antitumour activities towards breast cancer cells were investigated. All corroles showed excellent cytotoxicity against the MDA-MB-231 and 4T1 cell lines upon light irradiation at 625 nm. Ga3 exhibited excellent phototoxicity and selectivity against MDA-MB-231 cells, with an IC50 of 0.06 ± 0.03 µM and a selective index value of 1338.83 (relative to human normal Huvec cells). The performance of Ga3 was even better than that of the clinical photodynamic therapy drug m-THPC. A preliminary mechanistic investigation revealed that corrole 3 and Ga3 were mainly located in the cytoplasm. Upon irradiation, they could generate intracellular reactive oxygen to destroy the mitochondrial membrane potential and arrest the cell cycle at the sub-G1 phase. Flow cytometry revealed that corrole 3 and Ga3 induced cancer cell apoptosis after photodynamic treatment. Corrole 3 and Ga3 displayed negligible cytotoxicity in the dark. These results suggest that corrole 3 and Ga3 are promising candidates for use in the photodynamic therapy of breast cancer.

Cyclometalated Iridium(III) Complexes as High-Sensitivity Two-Photon Excited Mitochondria Dyes and Near-Infrared Photodynamic Therapy Agents.

Photodynamic therapy (PDT) using two-photon near-infrared light excitation is a very effective way to avoid the use of short-wavelength ultraviolet or visible light which cannot efficiently penetrate into the biological tissues and is harmful to the healthy cells. Herein, a series of cyclometalated Ir(III) complexes with a structurally simple diimine ligand were designed and the synthetic route and preparation procedure were optimized, so that the complexes could be obtained in apparently higher yield, productivity, and efficiency in comparison to the traditional methods. Their ground state and excited singlet and triplet state properties were studied by spectroscopy and quantum chemistry theoretical calculations to investigate the effect of substituent groups on the photophysical properties of the complexes. The Ir(III) complexes, especially Ir1 and Ir3, showed very low dark toxicities and high phototoxicities under both one-photon and two-photon excitation, indicating their great potential as PDT agents. They were also found to be highly sensitive two-photon mitochondria dyes.

Photofunctional Cyclometalated Iridium(III) Polypyridine Complexes Bearing a Perfluorobiphenyl Moiety for Bioconjugation, Bioimaging, and Phototherapeutic Applications.

In this article, we report the design, synthesis, and characterization of a series of cyclometalated iridium(III) polypyridine complexes containing a perfluorobiphenyl (PFBP) moiety [Ir(N^C)2(bpy-PFBP)](PF6) (bpy-PFBP = 4-(S-(perfluoro-(1,1'-biphenyl)-4-yl)-N-mercaptoethylaminocarbonyloxymethyl)-4'-methyl-2,2'-bipyridine; HN^C = 2-phenylpyridine (Hppy) (1a), 2-(4-hydroxymethylphenyl)pyridine (Hppy-CH2OH) (2a), 2-((1,1'-biphenyl)-4-yl)pyridine (Hpppy) (3a), 2-((4'-hydroxymethyl-1,1'-biphenyl)-4-yl)pyridine (Hpppy-CH2OH) (4a), 2-phenylquinoline (Hpq) (5a), 2-(4-hydroxymethylphenyl)quinoline (Hpq-CH2OH) (6a)). Their PFBP-free counterparts [Ir(N^C)2(bpy-C4)](PF6) (bpy-C4 = 4-(N-n-butylaminocarbonyloxymethyl)-4'-methyl-2,2'-bipyridine; HN^C = Hppy (1b), Hppy-CH2OH (2b), Hpppy (3b), Hpppy-CH2OH (4b), Hpq (5b), Hpq-CH2OH (6b)) were also prepared for comparison studies. Upon irradiation, all the complexes displayed intense and long-lived greenish-yellow to orange luminescence in solutions under ambient conditions and in low-temperature alcohol glass. Reactions of the PFBP complexes with peptides containing the FCPF sequence via the π-clamp-mediated cysteine conjugation afforded luminescent peptide conjugates that exhibited rich photophysical properties. Using complex 3a as an example, we demonstrated that the conjugation of complexes to organelle-targeting peptides is an effective means to modulate their intracellular localization behavior, which was further shown to be important to their performance in photodynamic therapy. The results of this work will contribute to the development of photofunctional transition metal complexes as theranostic agents.

Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects.

Polypyridyl backbone nitrosyl complexes of ruthenium with the molecular framework [RuII(antpy)(bpy)NO+/˙]n+ [4](PF6)3 (n = 3), [4](PF6)2 (n = 2), where antpy = 4'-(anthracene-9-yl)-2,2':6',2''-terpyridine and bpy = 2,2'-bipyridine, were synthesized via a stepwise synthetic route from the chloro precursor [RuII(antpy)(bpy)(Cl)](PF6) [1](PF6) and [RuII(antpy)(bpy)(CH3CN)](PF6)2 [2](PF6)2 and [RuII(antpy)(bpy)(NO2)](PF6) [3](PF6). After column chromatographic purification, all the synthesized complexes were fully characterized using different spectroscopic and analytical techniques including mass spectroscopy, 1H NMR, FT-IR and UV-vis spectrophotometry. The Ru-NO stretching frequency of [4](PF6)3 was observed at 1941 cm-1, which suggests moderately strong Ru-NO bonding. A massive shift in the νNO frequency occurred at Δν = 329 cm-1 (solid) upon reducing [4](PF6)3 to [4](PF6)2. To understand the molecular integrity of the complexes, the structure of [3](PF6) was successfully determined by X-ray crystallography. The redox properties of [4](PF6)3 were thoroughly investigated together with the other precursor complexes. The rate constants for the first-order photo-release of NO from [4](PF6)3 and [4](PF6)2 were determined to be 8.01 × 10-3 min-1 (t1/2 ∼ 86 min) and 3.27 × 10-2 min-1 (t1/2 ∼ 21 min), respectively, when exposed to a 200 W Xenon light. Additionally, the photo-cleavage of Ru-NO occurred within ∼2 h when [4](PF6)3 was irradiated with an IR light source (>700 nm) at room temperature. The first-order rate constant of 9.4 × 10-3 min-1 (t1/2 ∼ 73 min) shows the efficacy of the system and its capability to release NO in the photo-therapeutic window. The released NO triggered by light was trapped by reduced myoglobin, a biologically relevant target protein. The one-electron reduction of [4](PF6)3 to [4](PF6)2 was systematically carried out chemically (hydrazine hydrate), electrochemically and biologically. In the biological reduction, it was found that the reduction is much slower with double-stranded DNA compared to a single-stranded oligonucleotide (CAAGGCCAACCGCGAGAAGATGAC). Moreover, [4](PF6)3 exhibited significant photo-toxicity to the VCaP prostate cancer cell line upon irradiation with a visible light source (IC50 ∼ 8.97 µM).

A divergent mode of activation of a nitrosyl iron complex with unusual antiangiogenic activity.

Nitric oxide (NO) and nitroxyl (HNO) have gained broad attention due to their roles in several physiological and pathophysiological processes. Remarkably, these sibling species can exhibit opposing effects including the promotion of angiogenic activity by NO compared to HNO, which blocks neovascularization. While many NO donors have been developed over the years, interest in HNO has led to the recent emergence of new donors. However, in both cases there is an expressive lack of iron-based compounds. Herein, we explored the novel chemical reactivity and stability of the trans-[Fe(cyclam)(NO)Cl]Cl2 (cyclam = 1,4,8,11-tetraazacyclotetradecane) complex. Interestingly, the half-life (t1/2) for NO release was 1.8 min upon light irradiation, vs 5.4 h upon thermal activation at 37 °C. Importantly, spectroscopic evidence supported the generation of HNO rather than NO induced by glutathione. Moreover, we observed significant inhibition of NO donor- or hypoxia-induced HIF-1α (hypoxia-inducible factor 1α) accumulation in breast cancer cells, as well as reduced vascular tube formation by endothelial cells pretreated with the trans-[Fe(cyclam)(NO)Cl]Cl2 complex. Together, these studies provide the first example of an iron-nitrosyl complex with anti-angiogenic activity as well as the potential dual activity of this compound as a NO/HNO releasing agent, which warrants further pharmacological investigation.