Epigenetic and gene therapy in human and veterinary medicine.

Gene therapy is a focus of interest in both human and veterinary medicine, especially in recent years due to the potential applications of CRISPR/Cas9 technology. Another relatively new approach is that of epigenetic therapy, which involves an intervention based on epigenetic marks, including DNA methylation, histone post-translational modifications, and post-transcription modifications of distinct RNAs. The epigenome results from enzymatic reactions, which regulate gene expression without altering DNA sequences. In contrast to conventional CRISP/Cas9 techniques, the recently established methodology of epigenetic editing mediated by the CRISPR/dCas9 system is designed to target specific genes without causing DNA breaks. Both natural epigenetic processes and epigenetic editing regulate gene expression and thereby contribute to maintaining the balance between physiological functions and pathophysiological states. From this perspective, knowledge of specific epigenetic marks has immense potential in both human and veterinary medicine. For instance, the use of epigenetic drugs (chemical compounds with therapeutic potential affecting the epigenome) seems to be promising for the treatment of cancer, metabolic, and infectious diseases. Also, there is evidence that an epigenetic diet (nutrition-like factors affecting epigenome) should be considered as part of a healthy lifestyle and could contribute to the prevention of pathophysiological processes. In summary, epigenetic-based approaches in human and veterinary medicine have increasing significance in targeting aberrant gene expression associated with various diseases. In this case, CRISPR/dCas9, epigenetic targeting, and some epigenetic nutrition factors could contribute to reversing an abnormal epigenetic landscape to a healthy physiological state.

Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene.

An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.

Early recruitment of PARP-dependent m8A RNA methylation at DNA lesions is subsequently accompanied by active DNA demethylation.

RNA methylation, especially 6-methyladenosine (m6A)-modified RNAs, plays a specific role in DNA damage response (DDR). Here, we also observe that RNA modified at 8-methyladenosine (m8A) is recruited to UVA-damaged chromatin immediately after microirradiation. Interestingly, the level of m8A RNA at genomic lesions was reduced after inhibition of histone deacetylases and DNA methyltransferases. It appears in later phases of DNA damage response, accompanied by active DNA demethylation. Also, PARP inhibitor (PARPi), Olaparib, prevented adenosine methylation at microirradiated chromatin. PARPi abrogated not only m6A and m8A RNA positivity at genomic lesions, but also XRCC1, the factor of base excision repair (BER), did not recognize lesions in DNA. To this effect, Olaparib enhanced the genome-wide level of γH2AX. This histone modification interacted with m8A RNAs to a similar extent as m8A RNAs with DNA. Pronounced interaction properties we did not observe for m6A RNAs and DNA; however, m6A RNA interacted with XRCC1 with the highest efficiency, especially in microirradiated cells. Together, we show that the recruitment of m6A RNA and m8A RNA to DNA lesions is PARP dependent. We suggest that modified RNAs likely play a role in the BER mechanism accompanied by active DNA demethylation. In this process, γH2AX stabilizes m6A/m8A-positive RNA-DNA hybrid loops via its interaction with m8A RNAs. R-loops could represent basic three-stranded structures recognized by PARP-dependent non-canonical m6A/m8A-mediated DNA repair pathway.

Localization of METTL16 at the Nuclear Periphery and the Nucleolus Is Cell Cycle-Specific and METTL16 Interacts with Several Nucleolar Proteins.

METTL16 methyltransferase is responsible for the methylation of N6-adenosine (m6A) in several RNAs. In mouse cells, we showed that the nuclear distribution of METTL16 is cell cycle-specific. In the G1/S phases, METTL16 accumulates to the nucleolus, while in the G2 phase, the level of METTL16 increases in the nucleoplasm. In metaphase and anaphase, there is a very low pool of the METTL16 protein, but in telophase, residual METTL16 appears to be associated with the newly formed nuclear lamina. In A-type lamin-depleted cells, we observed a reduction of METTL16 when compared with the wild-type counterpart. However, METTL16 does not interact with A-type and B-type lamins, but interacts with Lamin B Receptor (LBR) and Lap2α. Additionally, Lap2α depletion caused METTL16 downregulation in the nuclear pool. Furthermore, METTL16 interacted with DDB2, a key protein of the nucleotide excision repair (NER), and also with nucleolar proteins, including TCOF, NOLC1, and UBF1/2, but not fibrillarin. From this view, the METTL16 protein may also regulate the transcription of ribosomal genes because we observed that the high level of m6A in 18S rRNA appeared in cells with upregulated METTL16.

The SC-35 Splicing Factor Interacts with RNA Pol II and A-Type Lamin Depletion Weakens This Interaction.

The essential components of splicing are the splicing factors accumulated in nuclear speckles; thus, we studied how DNA damaging agents and A-type lamin depletion affect the properties of these regions, positive on the SC-35 protein. We observed that inhibitor of PARP (poly (ADP-ribose) polymerase), and more pronouncedly inhibitors of RNA polymerases, caused DNA damage and increased the SC35 protein level. Interestingly, nuclear blebs, induced by PARP inhibitor and observed in A-type lamin-depleted or senescent cells, were positive on both the SC-35 protein and another component of the spliceosome, SRRM2. In the interphase cell nuclei, SC-35 interacted with the phosphorylated form of RNAP II, which was A-type lamin-dependent. In mitotic cells, especially in telophase, the SC35 protein formed a well-visible ring in the cytoplasmic fraction and colocalized with ß-catenin, associated with the plasma membrane. The antibody against the SRRM2 protein showed that nuclear speckles are already established in the cytoplasm of the late telophase and at the stage of early cytokinesis. In addition, we observed the occurrence of splicing factors in the nuclear blebs and micronuclei, which are also sites of both transcription and splicing. This conclusion supports the fact that splicing proceeds transcriptionally. According to our data, this process is A-type lamin-dependent. Lamin depletion also reduces the interaction between SC35 and ß-catenin in mitotic cells.

Cell differentiation and aging accompanied by depletion of the ACE2 protein.

ACE2 was observed as the cell surface receptor of the SARS-CoV-2 virus. Interestingly, we also found ACE2 positivity inside the cell nucleus. The ACE2 levels changed during cell differentiation and aging and varied in distinct cell types. We observed ACE2 depletion in the aortas of aging female mice, similarly, the aging caused ACE2 decrease in the kidneys. Compared with that in the heart, brain and kidneys, the ACE2 level was the lowest in the mouse lungs. In mice exposed to nicotine, ACE2 was not changed in olfactory bulbs but in the lungs, ACE2 was upregulated in females and downregulated in males. These observations indicate the distinct gender-dependent properties of ACE2. Differentiation into enterocytes, and cardiomyocytes, caused ACE2 depletion. The cardiomyogenesis was accompanied by renin upregulation, delayed in HDAC1-depleted cells. In contrast, vitamin D2 decreased the renin level while ACE2 was upregulated. Together, the ACE2 level is high in non-differentiated cells. This protein is more abundant in the tissues of mouse embryos and young mice in comparison with older animals. Mostly, downregulation of ACE2 is accompanied by renin upregulation. Thus, the pathophysiology of COVID-19 disease should be further studied not only by considering the ACE2 level but also the whole renin-angiotensin system.

The Distinct Function and Localization of METTL3/METTL14 and METTL16 Enzymes in Cardiomyocytes.

It has become evident that epitranscriptome events, mediated by specific enzymes, regulate gene expression and, subsequently, cell differentiation processes. We show that methyltransferase-like proteins METTL3/METTL14 and N6-adenosine methylation (m6A) in RNAs are homogeneously distributed in embryonic hearts, and histone deacetylase (HDAC) inhibitors valproic acid and Trichostatin A (TSA) up-regulate METTL3/METTL14 proteins. The levels of METTL3 in mouse adult hearts, isolated from male and female animals, were lower in the aorta and pulmonary trunks when compared with atria, but METT14 was up-regulated in the aorta and pulmonary trunk, in comparison with ventriculi. Aging caused METTL3 down-regulation in aorta and atria in male animals. Western blot analysis in differentiated mouse embryonic stem cells (mESCs), containing 10-30 percent of cardiomyocytes, showed METTL3/METTL14 down-regulation, while the differentiation-induced increased level of METTL16 was observed in both wild type (wt) and HDAC1 depleted (dn) cells. In parallel, experimental differentiation in especially HDAC1 wild type cells was accompanied by depletion of m6A in RNA. Immunofluorescence analysis of individual cells revealed the highest density of METTL3/METTL14 in α-actinin positive cardiomyocytes when compared with the other cells in the culture undergoing differentiation. In both wt and HDAC1 dn cells, the amount of METTL16 was also up-regulated in cardiomyocytes when compared to co-cultivated cells. Together, we showed that distinct anatomical regions of the mouse adult hearts are characterized by different levels of METTL3 and METTL14 proteins, which are changed during aging. Experimental cell differentiation was also accompanied by changes in METTL-like proteins and m6A in RNA; in particular, levels and distribution patterns of METTL3/METTL14 proteins were different from the same parameters studied in the case of the METTL16 protein.

A device for investigation of natural cell mobility and deformability.

A microfluidic device made of polydimethylsiloxane was developed for continuous evaluation of natural migration mobility of many eukaryotic cells in relaxed and deformed state. The device was fabricated by standard photolithography and soft lithography techniques using the SU-8 3010 negative photoresist on a glass wafer as the master mold. The simple flow-free device exploits the chemotactic movement of cells through a set of mechanical barriers in the direction of concentration gradients of attractants. The barriers are formed by arrays of circular cross-section pillars with decreasing spacing 7, 5, and 3 µm. To pass through the obstacles, the cells are deformed and change their cytoskeletal architecture. The instantaneous migration velocities of cells are monitored in a time-lapse setup of the scanning confocal microscope. Thus, the cellular deformability and migratory activity can easily be evaluated. The functionality of the device was tested with model HeLa cells stably transfected with fluorescent Premo FUCCI Cell Cycle Sensor. The designed device has the potential to be implemented for testing the tendency of patients' tumors to metastasis.

Spatiotemporal Mislocalization of Nuclear Membrane-Associated Proteins in γ-Irradiation-Induced Senescent Cells.

Cellular senescence, induced by genotoxic or replication stress, is accompanied by defects in nuclear morphology and nuclear membrane-heterochromatin disruption. In this work, we analyzed cytological and molecular changes in the linker of nucleoskeleton and cytoskeleton (LINC) complex proteins in senescence triggered by γ-irradiation. We used human mammary carcinoma and osteosarcoma cell lines, both original and shRNA knockdown clones targeting lamin B receptor (LBR) and leading to LBR and lamin B (LB1) reduction. The expression status and integrity of LINC complex proteins (nesprin-1, SUN1, SUN2), lamin A/C, and emerin were analyzed by immunodetection using confocal microscopy and Western blot. The results show frequent mislocalization of these proteins from the nuclear membrane to cytoplasm and micronuclei and, in some cases, their fragmentation and amplification. The timing of these changes clearly preceded the onset of senescence. The LBR deficiency triggered neither senescence nor changes in the LINC protein distribution before irradiation. However, the cytological changes following irradiation were more pronounced in shRNA knockdown cells compared to original cell lines. We conclude that mislocalization of LINC complex proteins is a significant characteristic of cellular senescence phenotypes and may influence complex events at the nuclear membrane, including trafficking and heterochromatin attachment.

N6-Adenosine Methylation in RNA and a Reduced m3G/TMG Level in Non-Coding RNAs Appear at Microirradiation-Induced DNA Lesions.

The DNA damage response is mediated by both DNA repair proteins and epigenetic markers. Here, we observe that N6-methyladenosine (m6A), a mark of the epitranscriptome, was common in RNAs accumulated at UV-damaged chromatin; however, inhibitors of RNA polymerases I and II did not affect the m6A RNA level at the irradiated genomic regions. After genome injury, m6A RNAs either diffused to the damaged chromatin or appeared at the lesions enzymatically. DNA damage did not change the levels of METTL3 and METTL14 methyltransferases. In a subset of irradiated cells, only the METTL16 enzyme, responsible for m6A in non-coding RNAs as well as for splicing regulation, was recruited to microirradiated sites. Importantly, the levels of the studied splicing factors were not changed by UVA light. Overall, if the appearance of m6A RNAs at DNA lesions is regulated enzymatically, this process must be mediated via the coregulatory function of METTL-like enzymes. This event is additionally accompanied by radiation-induced depletion of 2,2,7-methylguanosine (m3G/TMG) in RNA. Moreover, UV-irradiation also decreases the global cellular level of N1-methyladenosine (m1A) in RNAs. Based on these results, we prefer a model in which m6A RNAs rapidly respond to radiation-induced stress and diffuse to the damaged sites. The level of both (m1A) RNAs and m3G/TMG in RNAs is reduced as a consequence of DNA damage, recognized by the nucleotide excision repair mechanism.

RETROSPECTIVE STUDY OF CAUSES OF ANIMAL MORTALITY IN LJUBLJANA ZOO 2005-2015.

Zoos harbor large collections of diverse species, aiding in both conservation and education, as well as research in multiple scientific fields. However, the most common causes of death in zoo animals around the world remain unclear because few extensive reports or reviews are published on this topic. This information could greatly improve preventive veterinary medicine in zoologic gardens. This study provides a retrospective overview of the causes of death of animals from the Ljubljana Zoo in the years 2005-2015. During this period, a total of 353 animals were submitted for necropsy, of which 244 were mammals, 85 were birds, and 25 were reptiles. The causes of deaths were divided into infectious diseases (38%), dysfunctions of individual organs (20%), traumas (13%), parasitosis (7%), reproductive disorders (6%), metabolic disorders (3%), neoplastic disease (4%), and intoxications (4%). In some cases, the cause of death was unable to be determined (7%), most commonly because of autolysis of the body. The results of this retrospective study bring a general overview of the epizootiologic situation in the Ljubljana Zoo over an 11-yr period and valuable information to other zoos to optimize preventative plans and diagnostics.

DNA Damage Changes Distribution Pattern and Levels of HP1 Protein Isoforms in the Nucleolus and Increases Phosphorylation of HP1ß-Ser88.

The family of heterochromatin protein 1 (HP1) isoforms is essential for chromatin packaging, regulation of gene expression, and repair of damaged DNA. Here we document that γ-radiation reduced the number of HP1α-positive foci, but not HP1ß and HP1γ foci, located in the vicinity of the fibrillarin-positive region of the nucleolus. The additional analysis confirmed that γ-radiation has the ability to significantly decrease the level of HP1α in rDNA promoter and rDNA encoding 28S rRNA. By mass spectrometry, we showed that treatment by γ-rays enhanced the HP1ß serine 88 phosphorylation (S88ph), but other analyzed modifications of HP1ß, including S161ph/Y163ph, S171ph, and S174ph, were not changed in cells exposed to γ-rays or treated by the HDAC inhibitor (HDACi). Interestingly, a combination of HDACi and γ-radiation increased the level of HP1α and HP1γ. The level of HP1ß remained identical before and after the HDACi/γ-rays treatment, but HDACi strengthened HP1ß interaction with the KRAB-associated protein 1 (KAP1) protein. Conversely, HP1γ did not interact with KAP1, although approximately 40% of HP1γ foci co-localized with accumulated KAP1. Especially HP1γ foci at the periphery of nucleoli were mostly absent of KAP1. Together, DNA damage changed the morphology, levels, and interaction properties of HP1 isoforms. Also, γ-irradiation-induced hyperphosphorylation of the HP1ß protein; thus, HP1ß-S88ph could be considered as an important marker of DNA damage.

A role of the 53BP1 protein in genome protection: structural and functional characteristics of 53BP1-dependent DNA repair.

Nuclear architecture plays a significant role in DNA repair mechanisms. It is evident that proteins involved in DNA repair are compartmentalized in not only spontaneously occurring DNA lesions or ionizing radiation-induced foci (IRIF), but a specific clustering of these proteins can also be observed within the whole cell nucleus. For example, 53BP1-positive and BRCA1-positive DNA repair foci decorate chromocenters and can appear close to nuclear speckles. Both 53BP1 and BRCA1 are well-described factors that play an essential role in double-strand break (DSB) repair. These proteins are members of two protein complexes: 53BP1-RIF1-PTIP and BRCA1-CtIP, which make a "decision" determining whether canonical nonhomologous end joining (NHEJ) or homology-directed repair (HDR) is activated. It is generally accepted that 53BP1 mediates the NHEJ mechanism, while HDR is activated via a BRCA1-dependent signaling pathway. Interestingly, the 53BP1 protein appears relatively quickly at DSB sites, while BRCA1 is functional at later stages of DNA repair, as soon as the Mre11-Rad50-Nbs1 complex is recruited to the DNA lesions. A function of the 53BP1 protein is also linked to a specific histone signature, including phosphorylation of histone H2AX (γH2AX) or methylation of histone H4 at the lysine 20 position (H4K20me); therefore, we also discuss an epigenetic landscape of 53BP1-positive DNA lesions.

Serologic Survey of Selected Viral Pathogens in Free-Ranging Eurasian Brown Bears ( Ursus arctos arctos) from Slovakia.

We tested sera of 24 free-ranging European brown bears ( Ursus arctos) from six regions of Slovakia for antibodies to 10 viral agents. We tested sera by an indirect fluorescence antibody test for antibodies to canine distemper virus (CDV), canine coronavirus (CCV), canine parvovirus type 2 (CPV-2), canine adenovirus, canine parainfluenza virus type 2 (CPIV-2), and canine herpesvirus type 1 (CHV-1). We used an enzyme-linked immunosorbent assay for detection of antibodies to hepatitis E virus, bluetongue virus, West Nile virus (WNV), and Aujeszky's disease virus (ADV). We detected antibodies to CDV, CHV-1, CPV-2, CPIV-2, CCV, WNV, and ADV in seven (29%), three (12%), two (8%), two (8%), one (4%), one (4%), and one (4%) bear, respectively. Evidence of exposure of free-ranging European brown bears to CCV and ADV has not been reported.

H3K9me3 and H4K20me3 represent the epigenetic landscape for 53BP1 binding to DNA lesions.

Methylation of histones H4 at lysine 20 position (H4K20me), which is functional in DNA repair, represents a binding site for the 53BP1 protein. Here, we show a radiation-induced increase in the level of H4K20me3 while the levels of H4K20me1 and H4K20me2 remained intact. H4K20me3 was significantly pronounced at DNA lesions in only the G1 phase of the cycle, while this histone mark was reduced in very late S and G2 phases when PCNA was recruited to locally micro-irradiated chromatin. H4K20me3 was diminished in locally irradiated Suv39h1/h2 double knockout (dn) fibroblasts, and the same phenomenon was observed for H3K9me3 and its binding partner, the HP1ß protein. Immunoprecipitation showed the existence of an interaction between H3K9me3-53BP1 and H4K20me3-53BP1; however, HP1ß did not interact with 53BP1. Together, H3K9me3 and H4K20me3 represent epigenetic markers that are important for the function of the 53BP1 protein in non-homologous end joining (NHEJ) repair. The very late S phase represents the cell cycle breakpoint when a DDR function of the H4K20me3-53BP1 complex is abrogated due to recruitment of the PCNA protein and other DNA repair factors of homologous recombination to DNA lesions.

Deacetylation of Histone H4 Accompanying Cardiomyogenesis is Weakened in HDAC1-Depleted ES Cells.

Cell differentiation into cardiomyocytes requires activation of differentiation-specific genes and epigenetic factors that contribute to these physiological processes. This study is focused on the in vitro differentiation of mouse embryonic stem cells (mESCs) induced into cardiomyocytes. The effects of clinically promising inhibitors of histone deacetylases (HDACi) on mESC cardiomyogenesis and on explanted embryonic hearts were also analyzed. HDAC1 depletion caused early beating of cardiomyocytes compared with those of the wild-type (wt) counterpart. Moreover, the adherence of embryonic bodies (EBs) was reduced in HDAC1 double knockout (dn) mESCs. The most important finding was differentiation-specific H4 deacetylation observed during cardiomyocyte differentiation of wt mESCs, while H4 deacetylation was weakened in HDAC1-depleted cells induced to the cardiac pathway. Analysis of the effect of HDACi showed that Trichostatin A (TSA) is a strong hyperacetylating agent, especially in wt mESCs, but only SAHA reduced the size of the beating areas in EBs that originated from HDAC1 dn mESCs. Additionally, explanted embryonic hearts (e15) responded to treatment with HDACi: all of the tested HDACi (TSA, SAHA, VPA) increased the levels of H3K9ac, H4ac, H4K20ac, and pan-acetylated lysines in embryonic hearts. This observation shows that explanted tissue can be maintained in a hyperacetylation state several hours after excision, which appears to be useful information from the view of transplantation strategy and the maintenance of gene upregulation via acetylation in tissue intended for transplantation.

Depletion of A-type lamins and Lap2α reduces 53BP1 accumulation at UV-induced DNA lesions and Lap2α protein is responsible for compactness of irradiated chromatin.

We studied how deficiency in lamins A/C and lamina-associated polypeptide 2α (Lap2α) affects DNA repair after irradiation. A-type lamins and Lap2α were not recruited to local DNA lesions and did not accumulate to γ-irradiation-induced foci (IRIF), as it is generally observed for well-known marker of DNA lesions, 53BP1 protein. At micro-irradiated chromatin of lmna double knockout (dn) and Lap2α dn cells, 53BP1 protein levels were reduced, compared to locally irradiated wild-type counterpart. Decreased levels of 53BP1 we also observed in whole populations of lmna dn and Lap2α dn cells, irradiated by UV light. We also studied distribution pattern of 53BP1 protein in a genome outside micro-irradiated region. In Lap2α deficient cells, identical fluorescence of mCherry-tagged 53BP1 protein was found at both microirradiated region and surrounding chromatin. However, a well-known marker of double strand breaks, γH2AX, was highly abundant in the lesion-surrounding genome of Lap2α deficient cells. Described changes, induced by irradiation in Lap2α dn cells, were not accompanied by cell cycle changes. In Lap2α dn cells, we additionally performed analysis by FLIM (Fluorescence Lifetime Imaging Microscopy) that showed different dynamic behavior of mCherry-tagged 53BP1 protein pools when it was compared with wild-type (wt) fibroblasts. This analysis revealed three different fractions of mCherry-53BP1 protein. Two of them showed identical exponential decay times (τ1 and τ3), but the decay rate of τ2 and amplitudes of fluorescence decays (A1-A3) were statistically different in wt and Lap2α dn fibroblasts. Moreover, γ-irradiation weakened an interaction between A-type lamins and Lap2α. Together, our results demonstrate how depletion of Lap2α affects DNA damage response (DDR) and how chromatin compactness is changed in Lap2α deficient cells exposed to radiation.

Nuclear apoptotic volume decrease in individual cells: Confocal microscopy imaging and kinetic modeling.

The dynamics of nuclear morphology changes during apoptosis remains poorly investigated and understood. Using 3D time-lapse confocal microscopy we performed a study of early-stage apoptotic nuclear morphological changes induced by etoposide in single living HepG2 cells. These observations provide a definitive evidence that nuclear apoptotic volume decrease (AVD) is occurring simultaneously with peripheral chromatin condensation (so called "apoptotic ring"). In order to describe quantitatively the dynamics of nuclear morphological changes in the early stage of apoptosis we suggest a general molecular kinetic model, which fits well the obtained experimental data in our study. Results of this work may clarify molecular mechanisms of nuclear morphology changes during apoptosis.

The Occurrence of Some Nonblood Protozoan Parasites in Wild and Domestic Mammals in South Africa.

Relatively little is known about protozoan parasites in African animals. Here we investigated the occurrence of protozoan parasites in mammals from South Africa. Oocysts of protozoan parasites were detected in 13 of 56 (23%) fecal samples using conventional microscopic examination methods. Cryptosporidium spp. and Cystoisospora spp. were detected in eight (14%) and five (9%) samples, respectively. Mixed parasitic infection of Cryptosporidium spp. and Cystoisospora spp. was recorded in banded mongoose ( Mungos mungo). Cryptosporidium spp. was detected for the first time in cheetah ( Acinonyx jubatus), spotted hyena ( Crocuta crocuta), and African polecat ( Ictonyx striatus). Antibodies to Toxoplasma gondii and Neospora caninum were not detected by enzyme-linked immunosorbent assay in any of 32 sera tested. We detected T. gondii by PCR in tissues of five of 243 (2%) animals: domestic dog ( Canis lupus familiaris), gerbil ( Gerbilliscus spp.), greater kudu ( Tragelaphus strepsiceros), honey badger ( Mellivora capensis), and white-tailed mongoose ( Ichneumia albicauda). Our isolation of T. gondii from white-tailed mongoose and honey badger was a unique finding. All tissue samples were negative for N. caninum. The study increases our knowledge on the occurrence of protozoan parasites in populations of wild and domestic animals in South Africa.

Advanced Confocal Microscopy Techniques to Study Protein-protein Interactions and Kinetics at DNA Lesions.

Local microirradiation with lasers represents a useful tool for studies of DNA-repair-related processes in live cells. Here, we describe a methodological approach to analyzing protein kinetics at DNA lesions over time or protein-protein interactions on locally microirradiated chromatin. We also show how to recognize individual phases of the cell cycle using the Fucci cellular system to study cell-cycle-dependent protein kinetics at DNA lesions. A methodological description of the use of two UV lasers (355 nm and 405 nm) to induce different types of DNA damage is also presented. Only the cells microirradiated by the 405-nm diode laser proceeded through mitosis normally and were devoid of cyclobutane pyrimidine dimers (CPDs). We also show how microirradiated cells can be fixed at a given time point to perform immunodetection of the endogenous proteins of interest. For the DNA repair studies, we additionally describe the use of biophysical methods including FRAP (Fluorescence Recovery After Photobleaching) and FLIM (Fluorescence Lifetime Imaging Microscopy) in cells with spontaneously occurring DNA damage foci. We also show an application of FLIM-FRET (Fluorescence Resonance Energy Transfer) in experimental studies of protein-protein interactions.