RESUMO
The onsite detection of glyphosate requires an easy-to-handle, low-cost and disposable assay for untrained users as requested by the ASSURED guidelines. A new strategy based on the expression of fusion proteins is proposed here. A glyphosate oxidase derived from Bacillus subtilis and the 6E10 variant of the dye peroxidase from Pseudomonas putida, both fused with the carbohydrate binding module (CBM) 3a from Clostridium thermocellum, were designed and expressed, leading to GlyphOx-CBM and 6E10-CBM. Cell lysates were used to immobilise both enzymes on cotton buds' heads without any purification. The cotton buds exhibit glyphosate oxidase activity when dipped into a glyphosate-contaminated water sample containing the 6E10-CBM chromogenic substrates. The chromophore could be quantified both in the solution and on the cotton buds' heads. Photography followed by image analysis allows to detect glyphosate with a linear range of 0.25-2.5 mM and a limit of detection (LoD) of 0.12 mM. When the chromogenic substrates are replaced by luminol, the chemiluminescence reaction allows the detection of glyphosate with a linear range of 2-500 µM and a LoD of 0.45 µM. No interference was observed using glyphosate analogues (glycine, sarcosine, aminomethylphosphonic acid) or other herbicides used in a mixture. Only cysteine was found to inhibit 6E10-CBM. Two river waters spiked with glyphosate lead to recoveries of 64-131%. This work describes a very easy-to-handle and inexpensive signal-on bioassay for glyphosate detection in real surface water samples.
Assuntos
Betacoronavirus/isolamento & purificação , Pérnio/diagnóstico , Infecções por Coronavirus/complicações , Pneumonia Viral/complicações , Pele/imunologia , Urticária/diagnóstico , Betacoronavirus/genética , Betacoronavirus/imunologia , Biópsia , COVID-19 , Teste para COVID-19 , Pérnio/imunologia , Pérnio/patologia , Pérnio/virologia , Técnicas de Laboratório Clínico , Infecções por Coronavirus/diagnóstico , Infecções por Coronavirus/virologia , Diagnóstico Diferencial , Feminino , Humanos , Pessoa de Meia-Idade , Nasofaringe/virologia , Pandemias , Pneumonia Viral/diagnóstico , Pneumonia Viral/virologia , Reação em Cadeia da Polimerase , RNA Viral , SARS-CoV-2 , Pele/patologia , Pele/virologia , Urticária/imunologia , Urticária/patologia , Urticária/virologiaRESUMO
INTRODUCTION: Clinical presentation of cholesterol crystal embolism (CCE) can be dermatologic when cholesterol crystals become lodged in small cutaneous arteries resulting in ischemia. We report a case of CCE with erythroderma misleading to a diagnostic of drug reaction with eosinophilia and systemic symptoms (DRESS). CASE REPORT: A 66 year-old woman presented with erythroderma few months after initiation of allopurinol. Acute renal failure was present with elevation in plasma creatinine concentration (523µmol/L) and hypereosinophilia (HE) (5666/mm3). Finally, the REGISCAR score helped to rule out DRESS diagnostic. Past blood-count tests were analyzed revealing chronic HE present before allopurinol initiation. Renal biopsy identified CCE. CONCLUSION: This case is the first to report a DRESS like presentation of CCE. Clinical findings are secondary to HE and not to occlusion of cutaneous arteries.
Assuntos
Síndrome de Hipersensibilidade a Medicamentos/diagnóstico , Embolia de Colesterol/diagnóstico , Idoso , Colesterol/química , Colesterol/metabolismo , Cristalização , Diagnóstico Diferencial , Embolia de Colesterol/complicações , Eosinofilia/diagnóstico , Eosinofilia/etiologia , Exantema/diagnóstico , Exantema/etiologia , Feminino , HumanosRESUMO
INTRODUCTION: Renbök phenomenon describes the inhibition of a lesion when a different one appears. We describe the first case of Renbök phenomenon occurring in a context of erythema migrans (EM) spared by an amoxicillin-induced skin rash and we also present a literature review. CASE REPORT: A 60-year-old patient was treated with amoxicillin for EM on the right knee and subsequently developed generalized erythema as a result of an antibiotic-induced skin rash, with sparing of the area previously affected by EM. Renbök phenomenon was diagnosed. DISCUSSION: In 1981, Cochran et al. first described a maculopapular drug reaction, which spared the sites of previous X irradiation for a tumor. Since then, nearly 40 cases have been reported, mostly describing patient with alopecia areata of the scalp with hair growth within plaques of psoriasis. One of the mechanisms suggested is a role played by cytokine cross-regulation in competition among distinct immune responses. CONCLUSION: We report the first case of Renbök phenomenon involving EM spared by a drug reaction. This phenomenon provides an insight into inflammatory response competition within a single patient.
Assuntos
Amoxicilina/efeitos adversos , Antibacterianos/efeitos adversos , Toxidermias/patologia , Eritema Migrans Crônico/patologia , Amoxicilina/uso terapêutico , Antibacterianos/uso terapêutico , Doxiciclina/uso terapêutico , Toxidermias/etiologia , Substituição de Medicamentos , Eritema Migrans Crônico/tratamento farmacológico , Feminino , Humanos , Joelho , Pessoa de Meia-IdadeRESUMO
No instruments in the inner radiation belt are immune from the unforgiving penetration of the highly energetic protons (tens of MeV to GeV). The inner belt proton flux level, however, is relatively stable; thus, for any given instrument, the proton contamination often leads to a certain background noise. Measurements from the Relativistic Electron and Proton Telescope integrated little experiment on board Colorado Student Space Weather Experiment CubeSat, in a low Earth orbit, clearly demonstrate that there exist sub-MeV electrons in the inner belt because their flux level is orders of magnitude higher than the background, while higher-energy electron (>1.6 MeV) measurements cannot be distinguished from the background. Detailed analysis of high-quality measurements from the Relativistic Electron and Proton Telescope on board Van Allen Probes, in a geo-transfer-like orbit, provides, for the first time, quantified upper limits on MeV electron fluxes in various energy ranges in the inner belt. These upper limits are rather different from flux levels in the AE8 and AE9 models, which were developed based on older data sources. For 1.7, 2.5, and 3.3 MeV electrons, the upper limits are about 1 order of magnitude lower than predicted model fluxes. The implication of this difference is profound in that unless there are extreme solar wind conditions, which have not happened yet since the launch of Van Allen Probes, significant enhancements of MeV electrons do not occur in the inner belt even though such enhancements are commonly seen in the outer belt. KEY POINTS: Quantified upper limit of MeV electrons in the inner beltActual MeV electron intensity likely much lower than the upper limitMore detailed understanding of relativistic electrons in the magnetosphere.
RESUMO
Early observations indicated that the Earth's Van Allen radiation belts could be separated into an inner zone dominated by high-energy protons and an outer zone dominated by high-energy electrons. Subsequent studies showed that electrons of moderate energy (less than about one megaelectronvolt) often populate both zones, with a deep 'slot' region largely devoid of particles between them. There is a region of dense cold plasma around the Earth known as the plasmasphere, the outer boundary of which is called the plasmapause. The two-belt radiation structure was explained as arising from strong electron interactions with plasmaspheric hiss just inside the plasmapause boundary, with the inner edge of the outer radiation zone corresponding to the minimum plasmapause location. Recent observations have revealed unexpected radiation belt morphology, especially at ultrarelativistic kinetic energies (more than five megaelectronvolts). Here we analyse an extended data set that reveals an exceedingly sharp inner boundary for the ultrarelativistic electrons. Additional, concurrently measured data reveal that this barrier to inward electron radial transport does not arise because of a physical boundary within the Earth's intrinsic magnetic field, and that inward radial diffusion is unlikely to be inhibited by scattering by electromagnetic transmitter wave fields. Rather, we suggest that exceptionally slow natural inward radial diffusion combined with weak, but persistent, wave-particle pitch angle scattering deep inside the Earth's plasmasphere can combine to create an almost impenetrable barrier through which the most energetic Van Allen belt electrons cannot migrate.
RESUMO
The aim of this study was to evaluate differences between the small and large intestines (SI and LI) with regard to colonization and immunity during infection with Trichinella spiralis. In orally infected C57BL/6 mice, the gender ratios of worms differed among the SI, cecum, and LI. Mucosal mastocytosis developed in the SI but not in the LI, consistent with reduced IL-9 and IL-13 production by explants from the LI. Despite these differences, worms were cleared at the same rate from both sites. Furthermore, IL-10 production was reduced in the LI, yet it was instrumental in limiting local inflammation. Finally, passive immunization of rat pups with tyvelose-specific antibodies effectively cleared fist-stage larvae from all intestinal regions. We conclude that despite regional differences in immune responsiveness and colonization, immune mechanisms that clear T. spiralis operate effectively throughout the intestinal tract.
Assuntos
Citocinas/imunologia , Intestino Grosso/parasitologia , Intestino Delgado/parasitologia , Trichinella spiralis/imunologia , Triquinelose/imunologia , Animais , Animais Recém-Nascidos , Anticorpos Anti-Helmínticos/imunologia , Citocinas/metabolismo , Feminino , Imunização Passiva , Interleucina-10/metabolismo , Intestino Grosso/imunologia , Intestino Delgado/imunologia , Larva , Masculino , Mastócitos/imunologia , Mastocitose/imunologia , Mastocitose/parasitologia , Camundongos , Camundongos Endogâmicos BALB C , Camundongos Endogâmicos C57BL , Ratos , Organismos Livres de Patógenos Específicos , Triquinelose/parasitologiaRESUMO
TAAs (tumor-associated antigens) microarrays were designed to detect auto-antibodies directly in patient sera. Twelve different probes were chosen according to their described occurrence in cancer pathologies (Cyclin B1, Cyclin D1, Complement factor H, c-myc, IMP1, p53, p62, survivin, Her2/neu, Koc, NY-ESO-1 and PSA). Microarrays of these 12 proteins were immobilized within the nitrocellulose/cellulose acetate membrane of a 96-well filtering microtiter plate bottom. The captured auto-antibodies were detected using a staining approach based on alkaline phosphatase labeling. Thus, the presence of specific auto-antibodies in samples was visualized through the positive staining of the corresponding TAA spots. The TAA HiFi microarrays were shown to be able to capture specific purified anti-TAA antibodies. In real samples, 9 proteins from the 12 TAAs panel were shown to generate specific signal and 5 antigens (p53, NY-ESO-1, IMP1, cyclin B1 and c-myc) were shown to have interaction with more than 10% of the positive sera from cancer patients. This protein subpanel was proven to be able to detect 72.2% of the cancer patients tested (within a 34 panel of 18 patients and 16 healthy donors).
Assuntos
Antígenos de Neoplasias/imunologia , Autoanticorpos/análise , Imunoensaio/métodos , Fosfatase Alcalina/química , Fosfatase Alcalina/metabolismo , Antígenos de Neoplasias/sangue , Autoanticorpos/imunologia , Humanos , Análise Serial de Proteínas/instrumentação , Análise Serial de Proteínas/métodosAssuntos
Anti-Inflamatórios não Esteroides/efeitos adversos , Antirreumáticos/efeitos adversos , Toxidermias/etiologia , Granuloma/induzido quimicamente , Imunoglobulina G/efeitos adversos , Tatuagem , Fator de Necrose Tumoral alfa/antagonistas & inibidores , Adulto , Causalidade , Etanercepte , Seguimentos , Humanos , Masculino , Receptores do Fator de Necrose Tumoral , Fatores de RiscoRESUMO
A new electrochemical biochip for the detection of DNA sequences was developed. The entire biochip-i.e., working, reference, and counter electrodes-was constructed based on the screen-printing technique and exhibits eight working electrodes that could be individually addressed and grafted through a simple electrochemical procedure. Screen-printed electrode networks were functionalized electrochemically with 1-ethyl-3-(3dimethylaminopropyl)carbodidiimide according to a simple procedure. Single-stranded DNA with a C6-NH(2) linker at the 5'-end was then covalently bound to the surface to act as probe for the direct, nonlabeled, detection of complementary strands in a conductive liquid medium. In the present system, the study was focused on a particular codon (273) localized in the exon 8 of the p53 gene (20 mer, TTGAGGTGCATGTTTGTGCC). The integrity of the immobilized probes and its ability to capture target sequences was monitored through chemiluminescent detection following the hybridization of a peroxidase-labeled target. The grafting of the probe at the electrode surface was shown to generate significant shifts of the Nyquist curves measured in the 10-kHz to 80-Hz range. These variations of the faradaic impedance were found to be related to changes of the double layer capacitance of the electrochemical system's equivalent circuit. Similarly, hybridization of complementary strands was monitored through the measurements of these shifts, which enabled the detection of target sequences from 1 to 200 nM. Discrimination between complementary, noncomplementary, and single-nucleotide mismatch targets was easily accomplished.
Assuntos
DNA/química , Análise em Microsséries , Análise de Sequência de DNA/métodos , Proteína Supressora de Tumor p53/análise , Sequência de Bases , Eletroquímica , Eletrodos , Humanos , Medições Luminescentes , Análise em Microsséries/instrumentação , Técnicas de Sonda Molecular , Hibridização de Ácido Nucleico/métodos , Sensibilidade e Especificidade , Proteína Supressora de Tumor p53/genéticaAssuntos
Granulomatose com Poliangiite/complicações , Doenças da Boca/etiologia , Feminino , Humanos , Lábio , Pessoa de Meia-Idade , Necrose , LínguaRESUMO
Pachydermoperiostosis (idiopathic or primary hypertrophic osteoarthropathy) is a rare condition of unknown origin involving the skin and the skeleton, with an autosomal dominant transmission. We report a case of anaemia in a patient with pachydermoperiostosis indicating myelofibrosis, and review the literature and the pathogenetic mechanisms.
Assuntos
Anemia/etiologia , Osteoartropatia Hipertrófica Secundária/complicações , Mielofibrose Primária/complicações , Acitretina/uso terapêutico , Adulto , Anemia/tratamento farmacológico , Fíbula/diagnóstico por imagem , Humanos , Ceratolíticos/uso terapêutico , Masculino , Osteoartropatia Hipertrófica Secundária/diagnóstico , Mielofibrose Primária/diagnóstico , Radiografia , Tíbia/diagnóstico por imagemRESUMO
The electrochemiluminescence (ECL) of a luminol derivate (ABEI) generated both by a carbon electrode and a polypyrrole-coated carbon electrode was examined. It was found that the polypyrrole film (ppy) did not inhibit the ECL. After that, ABEI anchored on a single stranded DNA target (ODNt) has been used for the ECL detection of the hybridization between a complementary single stranded DNA probe (ODNp) covalently linked to a polypyrrole support and the ODNt. The ECL detection has been performed using a DNA sensor having a low surface concentration of ODNp probes, constituted of a polypyrrole copolymer electrosynthesized from a pyrrole-ODNp/pyrrole monomer ratio of 1/20,000.
Assuntos
Luminol/análogos & derivados , Hibridização de Ácido Nucleico/métodos , Análise de Sequência com Séries de Oligonucleotídeos/métodos , Eletroquímica/métodos , Eletrodos , Medições Luminescentes/métodos , Luminol/química , Membranas Artificiais , Polímeros , PirróisRESUMO
Acute gastric dilatation with necrosis is a rare and severe complication associated with anorexia nervosa, bulimia, and psychogenic polyphagia. The Authors report an unusual case without underlying psychiatric context. Gastric necrosis was suspected based on imaging findings (plain radiograph and computed tomography). The detection of these imaging signs in an appropriate clinical setting, even without underlying psychiatric context, is important to avoid any delay in diagnosis and reduce mortality.
Assuntos
Dilatação Gástrica/diagnóstico , Enfisema Subcutâneo/diagnóstico , Dor Abdominal/etiologia , Doença Aguda , Adolescente , Anastomose em-Y de Roux , Transtornos da Alimentação e da Ingestão de Alimentos/complicações , Febre/etiologia , Gastrectomia , Dilatação Gástrica/etiologia , Dilatação Gástrica/mortalidade , Dilatação Gástrica/cirurgia , Gastroenterostomia , Humanos , Leucocitose/etiologia , Masculino , Necrose , Fatores de Risco , Enfisema Subcutâneo/etiologia , Enfisema Subcutâneo/mortalidade , Enfisema Subcutâneo/cirurgia , Taquicardia/etiologia , Fatores de Tempo , Tomografia Computadorizada por Raios X , Vômito/etiologiaRESUMO
PURPOSE: To evaluate the efficacy of percutaneous sclerotherapy for the treatment of venous malformations (VMs) with regards to cosmetic and functional outcome as a function of their size and to review the complications. MATERIALS AND METHODS: A retrospective study was performed between January 1997 and January 2002 on 68 patients (45 females and 23 males) ranging in age from 3 to 60 Years at the CHRU of Tours. RESULTS: Percutaneous sclerotherapy was a very effective treatment for small and medium-size VMs, for which the aim was to achieve cure. Aetoxisclerol and Ethibloc are the sclerosing agents used. They were associated with minimal side effects and no major complication. For larger lesions, the treatment was more complex and combined stronger and also more dangerous agents like absolute ethanol and Histoacryl. The aim was then a decrease of cosmetic and functional problems. CONCLUSION: Percutaneous sclerotherapy with Aetoxisclerol, Ethibloc, absolute ethanol or Histoacryl, either alone or before surgery, is a safe and effective method of managing soft-tIssue venous malformations.
Assuntos
Escleroterapia/métodos , Varizes/congênito , Venostomia , Adolescente , Adulto , Criança , Pré-Escolar , Embolização Terapêutica , Estética , Face/irrigação sanguínea , Feminino , Seguimentos , Humanos , Articulação do Joelho/irrigação sanguínea , Pessoa de Meia-Idade , Músculo Esquelético/irrigação sanguínea , Flebografia , Estudos Retrospectivos , Soluções Esclerosantes/efeitos adversos , Pele/irrigação sanguínea , Resultado do Tratamento , Varizes/diagnóstico , Varizes/terapiaRESUMO
We retrospectively reviewed 5 cases of hemophagocytic lymphohistiocytosis (HL) associated with human herpesvirus 8 (HHV-8) reactivation in human immunodeficiency virus (HIV)-infected patients. All patients had clinical and biological features characteristic of HL. Pulmonary symptoms were present in all patients and were frequently life threatening. The mean number of HL episodes was 6. Four patients had HL-associated Kaposi sarcoma, and 3 had multicentric Castleman disease. The mean CD4 cell count was 200 cells/mm(3). HIV loads were stable in all patients. All patients had high levels of HHV-8 in peripheral blood mononuclear cells during attacks, and a significant increase in this parameter before the attacks was seen in 3 patients. Although 2 patients died of HL, 3 are still alive and receiving etoposide therapy (mean follow-up, 3 years). HHV-8-related HL is associated with life-threatening symptoms and biological HHV-8 reactivation, and it may be controlled in the long term by etoposide therapy combined with highly active antiretroviral therapy.
Assuntos
Infecções Oportunistas Relacionadas com a AIDS/virologia , Infecções por HIV/complicações , Infecções por Herpesviridae/virologia , Herpesvirus Humano 8 , Histiocitose de Células não Langerhans/virologia , Feminino , Infecções por Herpesviridae/patologia , Histiocitose de Células não Langerhans/patologia , Humanos , Masculino , Estudos RetrospectivosRESUMO
Highly active antiretroviral therapy (HAART) is responsible for a striking reduction in AIDS related morbidity and mortality by partly restoring immune function. However, HAART can also precipitate the development of clinically apparent opportunistic infections in patients with latent infections. We report a case of an HIV infected patient who developed granulomatous nodular and cavitatory lesions of the lungs due to Mycobacterium xenopi as a manifestation of the immune restoration syndrome.
Assuntos
Infecções Oportunistas Relacionadas com a AIDS/complicações , Síndrome da Imunodeficiência Adquirida/tratamento farmacológico , Pneumopatias/etiologia , Infecções por Mycobacterium não Tuberculosas/etiologia , Mycobacterium xenopi , Adulto , Fármacos Anti-HIV/uso terapêutico , Terapia Antirretroviral de Alta Atividade/métodos , Combinação de Medicamentos , Feminino , Humanos , Hospedeiro Imunocomprometido , Lamivudina/uso terapêutico , Combinação Trimetoprima e Sulfametoxazol/uso terapêutico , Zidovudina/uso terapêuticoRESUMO
Highly active antiretroviral therapy (HAART) is responsible for a striking reduction in AIDS related morbidity and mortality by partly restoring immune function. However, HAART can also precipitate the development of clinically apparent opportunistic infections in patients with latent infections. We report a case of an HIV infected patient who developed granulomatous nodular and cavitatory lesions of the lungs due to Mycobacterium xenopi as a manifestation of the immune restoration syndrome.
Assuntos
Infecções Oportunistas Relacionadas com a AIDS/induzido quimicamente , Terapia Antirretroviral de Alta Atividade/efeitos adversos , Infecções por Mycobacterium não Tuberculosas/induzido quimicamente , Mycobacterium xenopi , Pneumonia Bacteriana/induzido quimicamente , Adulto , Feminino , HIV-1 , HumanosRESUMO
The purpose of the work was to assess the predictive value of biologic factors on the efficacy of highly active antiretroviral therapy alone or combined with chemotherapy on AIDS-associated Kaposi's sarcoma. Twenty-six AIDS-Kaposi's sarcoma patients who started therapy with protease inhibitors were investigated. No baseline chemotherapy was associated with less severe initial clinical status. Median follow-up was 652 d. The main outcome measures were as follows: best Kaposi's sarcoma clinical response; Kaposi's-sarcoma-associated herpesviral load in peripheral blood mononuclear cells using real-time quantitative polymerase chain reaction (non-detectable if less than 100 copies per microg); human immunodeficiency viral charge in plasma (non-detectable if less than 200 copies per ml); and CD4 lymphocyte count. Time to undetectable Kaposi's-sarcoma-associated herpesviral load, time to undetectable human immunodeficiency viral charge, and time to CD4 >or= 150 per microl were also recorded over time, from 2 mo measurements. Patients were staged according to the AIDS Clinical Trials Group-based tumor, immune, systemic staging system criteria. At baseline, Kaposi's sarcoma was progressive for 25 (96%) of the 26 enrolled patients. Complete or partial response to highly active antiretroviral therapy alone or combined with chemotherapy was achieved in 22 patients (85%). Median time to clinical response was estimated at 251 d. Clinical response was faster in patients without chemotherapy at baseline (p = 0.003) as well as in patients not previously treated with reverse transcriptase inhibitors (p = 0.0012). Using univariable analyses, predictive factors of clinical response were undetectable Kaposi's-sarcoma-associated herpesviremia (p = 0.013), undetectable human immunodeficiency viremia (p = 0.03), and relative variation of CD4 lymphocytes (p = 0.004). Using multivariable analysis, undetectable Kaposi's-sarcoma-associated herpesviremia (p = 0.009) and relative variation of CD4 (p = 0.005) were independently selected as having a predictive value for clinical response. Occurrence of nondetection of either Kaposi's-sarcoma-associated herpesvirus or human immunodeficiency virus was not associated with baseline CD4 value. Kaposi's-sarcoma-associated herpesvirus quantitative viral charge is an independent predictive factor of the efficacy of highly active antiretroviral therapy on AIDS-Kaposi's sarcoma. Our results support immune reconstitution as a mechanism of response of Kaposi's sarcoma to highly active antiretroviral therapy.