General Direct Anticancer Effects of Deer Growing Antler Extract in Several Tumour Cell Lines, and Immune System-Mediated Effects in Xenograft Glioblastoma.

Deer antlers are the fastest growing tissue. Because they are based on proto-oncogenes, to avoid the risk of cancer, antlers evolved strong anticancer mechanisms, and thus their extract (DVA) is effective also against the few human tumours studied so far. We assessed whether DVA is a general anticancer compound by testing the direct effects in cells of different tumours: glioblastoma (GBM; lines U87MG and U251), colorectal (CRC; lines DLD-1, HT-29, SW480, and SW620), breast cancer (BRCA; lines MCF7, SKBR3, and PA00), and leukaemia (THP-1). DVA reduced the viability of tumours but not healthy cells (NHC; lines 293T and HaCaT). Mobility decreased at least for the longest test (72 h). Intraperitoneal/oral 200 mg DVA/kg administration in GBM xenograft mice for 28 d reduced tumour weight by 66.3% and 61.4% respectively, and it also reduced spleen weight (43.8%). In addition, tumours treated with DVA showed symptoms of liquefactive necrosis. Serum cytokines showed DVA up-regulated factors related to tumour fighting and down-regulated those related to inducing immune tolerance to the tumour. DVA shows general anticancer effects in the lines tested and, in GBM mice, also strong indirect effects apparently mediated by the immune system. DVA may contain a future anticancer medicine without secondary effects.

Anti-tumour activity of deer growing antlers and its potential applications in the treatment of malignant gliomas.

A recent study showed that antlers have evolved a high rate of growth due to the expression of proto-oncogenes and that they have also evolved to express several tumour suppressor genes to control the risk of cancer. This may explain why deer antler velvet (DAV) extract shows anti-tumour activity. The fast growth of antler innervation through the velvet in close association to blood vessels provides a unique environment to study the fast but non-cancerous proliferation of heterogeneous cell populations. We set out to study the anti-cancer effect of DAV in glioblastoma (GB) cell lines in comparison with temozolomide, a chemotherapeutic drug used to treat high-grade brain tumours. Here we report, for the first time, that DAV extract from the tip, but not from mid-parts of the antler, exhibits an anti-tumour effect in GB cell lines (T98G and A172) while being non-toxic in non-cancerous cell lines (HEK293 and HACAT). In T98G cells, DAV treatment showed reduced proliferation (37.5%) and colony-formation capacity (84%), inhibited migration (39%), induced changes in cell cycle progression, and promoted apoptosis. The anticancer activity of DAV extract as demonstrated by these results may provide a new therapeutic strategy for GB treatment.

Synthesis, structure and molecular modelling of anionic carbosilane dendrimers.

Anionic carbosilane dendrimers of generations 1-3 have been synthesized containing carboxylate G(n)X(C(2)H(4)CO(2)Na)(m) and sulfonate G(n)X(C(2)H(4)SO(3)Na)(m) peripheral groups and derived from two different cores, 1,3,5-(HO)(3)C(6)H(3) (X = O(3)) and Si(C(3)H(5))(4) (X = Si). The peripheral anionic groups make these dendrimers water soluble, despite their highly hydrophobic framework. These dendrimers present a net negative charge in water, which was influenced by the pH of the medium. This characteristic was studied by pH titration. Also molecular modeling calculations have been performed to study differences in an aqueous medium between carboxylate and sulfonate dendrimers of different cores. The results obtained were also compared with those obtained from DOSY NMR experiments and zeta-potential measurements.

Gene therapy in HIV-infected cells to decrease viral impact by using an alternative delivery method.

The ability of dendrimer 2G-[Si{O(CH(2))(2)N(Me)(2) (+)(CH(2))(2)NMe(3) (+)(I(-))(2)}](8) (NN16) to transfect a wide range of cell types, as well as the possible biomedical application in direct or indirect inhibition of HIV replication, was investigated. Cells implicated in HIV infection such as primary peripheral blood mononuclear cells (PBMC) and immortalized suspension cells (lymphocytes), primary macrophages and dendritic cells, and immortalized adherent cells (astrocytes and trophoblasts) were analyzed. Dendrimer toxicity was evaluated by mitochondrial activity, cell membrane rupture, release of lactate dehydrogenase, erythrocyte hemolysis, and the effect on global gene expression profiles using whole-genome human microarrays. Cellular uptake of genetic material was determined using flow cytometry and confocal microscopy. Transfection efficiency and gene knockdown was investigated using dendrimer-delivered antisense oligonucleotides and small interfering RNA (siRNA). Very little cytotoxicity was detected in a variety of cells relevant to HIV infection and erythrocytes after NN16 dendrimer treatment. Imaging of cellular uptake showed high transfection efficiency of genetic material in all cells tested. Interestingly, NN16 further enhanced the reduction of HIV protein 24 antigen release by antisense oligonucleotides due to improved transfection efficiency. Finally, the dendrimer complexed with siRNA exhibited therapeutic potential by specifically inhibiting cyclooxygenase-2 gene expression in HIV-infected nervous system cells. NN16 dendrimers demonstrated the ability to transfect genetic material into a vast array of cells relevant to HIV pathology, combining high efficacy with low toxicity. These results suggest that NN16 dendrimers have the potential to be used as a versatile non-viral vector for gene therapy against HIV infection.

Analysis of interaction between dendriplexes and bovine serum albumin.

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.