RESUMO
In this paper, we investigate the structural and biological features of G-quadruplex (G4) aptamers as promising antiproliferative compounds affecting the STAT3 signalling pathway. Targeting the STAT3 protein through high-affinity ligands to reduce its levels or activity in cancer has noteworthy therapeutic potential. T40214 (STAT) [(G3C)4] is a G4 aptamer that can influence STAT3 biological outcomes in an efficient manner in several cancer cells. To explore the effects of an extra cytidine in second position and/or of single site-specific replacements of loop residues in generating aptamers that can affect the STAT3 biochemical pathway, a series of STAT and STATB [GCG2(CG3)3C] analogues containing a thymidine residue instead of cytidines was prepared. NMR, CD, UV, and PAGE data suggested that all derivatives adopt dimeric G4 structures like that of unmodified T40214 endowed with higher thermal stability, keeping the resistance in biological environments substantially unchanged, as shown by the nuclease stability assay. The antiproliferative activity of these ODNs was tested on both human prostate (DU145) and breast (MDA-MB-231) cancer cells. All derivatives showed similar antiproliferative activities on both cell lines, revealing a marked inhibition of proliferation, particularly at 72 h at 30 µM. Transcriptomic analysis aimed to evaluate STAT's and STATB's influence on the expression of many genes in MDA-MB-231 cells, suggested their potential involvement in STAT3 pathway modulation, and thus their interference in different biological processes. These data provide new tools to affect an interesting biochemical pathway and to develop novel anticancer and anti-inflammatory drugs.
Assuntos
Aptâmeros de Nucleotídeos , Quadruplex G , Neoplasias , Humanos , Masculino , Aptâmeros de Nucleotídeos/química , Linhagem Celular , Transdução de Sinais , Fator de Transcrição STAT3/metabolismo , FemininoRESUMO
In this paper, we study the biological properties of two TBA analogs containing one and two extra G-tetrads, namely TBAG3 and TBAG4, respectively, and two further derivatives in which one of the small loops at the bottom (TBAG41S) or the large loop at the top (TBAG4GS) of the TBAG4 structure has been completely modified by replacing all loop residues with abasic site mimics. The therapeutical development of the TBA was hindered by its low thermodynamic and nuclease stability, while its potential as an anticancer/antiproliferative molecule is also affected by the anticoagulant activity, being a side effect in this case. In order to obtain suitable TBA analogs and to explore the involvement of specific aptamer regions in biological activity, the antiproliferative capability against DU 145 and MDAMB 231 cancer cell lines (MTT), the anticoagulant properties (PT), the biological degradability (nuclease stability assay) and nucleolin (NCL) binding ability (SPR) of the above described TBA derivatives have been tested. Interestingly, none of the TBA analogs exhibits an anticoagulant activity, while all of them show antiproliferative properties to the same extent. Furthermore, TBAG4 displays extraordinary nuclease stability and promising antiproliferative properties against breast cancer cells binding NCL efficiently. These results expand the range of G4-structures targeting NCL and the possibility of developing novel anticancer and antiviral drugs.
Assuntos
Aptâmeros de Nucleotídeos , Quadruplex G , Neoplasias , Humanos , Aptâmeros de Nucleotídeos/química , Anticoagulantes/química , Trombina/metabolismoRESUMO
In this paper, we study the T30923 antiproliferative potential and the contribution of its loop residues in six different human cancer cell lines by preparing five T30923 variants using the single residue replacement approach of loop thymidine with an abasic site mimic (S). G-rich oligonucleotides (GRO) show interesting anticancer properties because of their capability to adopt G-quadruplex structures (G4s), such as the G4 HIV-1 integrase inhibitor T30923. Considering the multi-targeted effects of G4-aptamers and the limited number of cancer cell lines tested, particularly for T30923, it should be important to find a suitable tumor line, in addition to considering that the effects also strictly depend on G4s. CD, NMR and non-denaturating polyacrylamide gel electrophoresis data clearly show that all modified ODNs closely resemble the dimeric structure of parallel G4s' parent aptamer, keeping the resistance in biological environments substantially unchanged, as shown by nuclease stability assay. The antiproliferative effects of T30923 and its variants are tried in vitro by MTT assays, showing interesting cytotoxic activity, depending on time and dose, for all G4s, especially in MDA-MB-231 cells with a reduction in cell viability approximately up to 30%. Among all derivatives, QS12 results are the most promising, showing more pronounced cytotoxic effects both in MDA-MB-231 and Hela cells, with a decrease in cell viability from 70% to 60%. In summary, the single loop residue S substitution approach may be useful for designing antiproliferative G4s, considering that most of them, characterized by single residue loops, may be able to bind different targets in several cancer cell pathways. Generally, this approach could be of benefit by revealing some minimal functional structures, stimulating further studies aimed at the development of novel anticancer drugs.
Assuntos
Antineoplásicos , Aptâmeros de Nucleotídeos , Quadruplex G , Inibidores de Integrase de HIV , Neoplasias , Antineoplásicos/química , Aptâmeros de Nucleotídeos/química , Inibidores de Integrase de HIV/farmacologia , Células HeLa , Humanos , Neoplasias/tratamento farmacológico , TimidinaRESUMO
The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or ß-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.
Assuntos
DNA/química , Desoxiadenosinas/química , Quadruplex G , Oligonucleotídeos/química , Telômero , Catálise , Humanos , EstereoisomerismoRESUMO
In this paper, we report our investigations on five T30175 analogues, prepared by replacing sequence thymidines with abasic sites (S) one at a time, in comparison to their natural counterpart in order to evaluate their antiproliferative potential and the involvement of the residues not belonging to the central core of stacked guanosines in biological activity. The collected NMR (Nuclear Magnetic Resonance), CD (Circular Dichroism), and PAGE (Polyacrylamide Gel Electrophoresis) data strongly suggest that all of them adopt G-quadruplex (G4) structures strictly similar to that of the parent aptamer with the ability to fold into a dimeric structure composed of two identical G-quadruplexes, each characterized by parallel strands, three all-anti-G-tetrads and four one-thymidine loops (one bulge and three propeller loops). Furthermore, their antiproliferative (MTT assay) and anti-motility (wound healing assay) properties against lung and colorectal cancer cells were tested. Although all of the oligodeoxynucleotides (ODNs) investigated here exhibited anti-proliferative activity, the unmodified T30175 aptamer showed the greatest effect on cell growth, suggesting that both its characteristic folding in dimeric form and its presence in the sequence of all thymidines are crucial elements for antiproliferative activity. This straightforward approach is suitable for understanding the critical requirements of the G-quadruplex structures that affect antiproliferative potential and suggests its application as a starting point to facilitate the reasonable development of G-quadruplexes with improved anticancer properties.
Assuntos
Antineoplásicos/química , Aptâmeros de Nucleotídeos/química , Neoplasias Colorretais/genética , Neoplasias Pulmonares/genética , Timidina/genética , Substituição de Aminoácidos , Antineoplásicos/farmacologia , Aptâmeros de Nucleotídeos/genética , Aptâmeros de Nucleotídeos/farmacologia , Linhagem Celular Tumoral , Movimento Celular/efeitos dos fármacos , Proliferação de Células/efeitos dos fármacos , Dicroísmo Circular , Neoplasias Colorretais/tratamento farmacológico , Ensaios de Seleção de Medicamentos Antitumorais , Quadruplex G , Células HCT116 , Humanos , Neoplasias Pulmonares/tratamento farmacológico , Espectroscopia de Ressonância MagnéticaRESUMO
The thrombin binding aptamer (TBA) possesses promising antiproliferative properties. However, its development as an anticancer agent is drastically impaired by its concomitant anticoagulant activity. Therefore, suitable chemical modifications in the TBA sequence would be required in order to preserve its antiproliferative over anticoagulant activity. In this paper, we report structural investigations, based on circular dichroism (CD) and nuclear magnetic resonance spectroscopy (NMR), and biological evaluation of four pairs of enantiomeric heterochiral TBA analogues. The four TBA derivatives of the d-series are composed by d-residues except for one l-thymidine in the small TT loops, while their four enantiomers are composed by l-residues except for one d-thymidine in the same TT loop region. Apart from the left-handedness for the l-series TBA derivatives, CD and NMR measurements have shown that all TBA analogues are able to adopt the antiparallel, monomolecular, 'chair-like' G-quadruplex structure characteristic of the natural D-TBA. However, although all eight TBA derivatives are endowed with remarkable cytotoxic activities against colon and lung cancer cell lines, only TBA derivatives of the l-series show no anticoagulant activity and are considerably resistant in biological environments.
Assuntos
Aptâmeros de Nucleotídeos/genética , Quadruplex G , Ligação Proteica/genética , Trombina/genética , Anticoagulantes/química , Anticoagulantes/uso terapêutico , Dicroísmo Circular , Humanos , Espectroscopia de Ressonância Magnética , Estereoisomerismo , Timidina/genéticaRESUMO
The antiproliferative G-quadruplex aptamers are a promising and challenging subject in the framework of the anticancer therapeutic oligonucleotides research field. Although several antiproliferative G-quadruplex aptamers have been identified and proven to be effective on different cancer cell lines, their mechanism of action is still unexplored. We have recently described the antiproliferative activity of a heterochiral thrombin binding aptamer (TBA) derivative, namely, LQ1. Here, we investigate the molecular mechanisms of LQ1 activity and the structural and antiproliferative properties of two further TBA derivatives, differing from LQ1 only by the small loop base-compositions. We demonstrate that in p53 deleted colon cancer cells, LQ1 causes nucleolar stress, impairs ribosomal RNA processing, leading to the accumulation of pre-ribosomal RNAs, arrests cells in the G2/M phase and induces early apoptosis. Importantly, the depletion of uL3 abrogates all these effects, indicating that uL3 is a crucial player in the mechanism of action of LQ1. Taken together, our findings identify p53-independent and uL3-dependent nucleolar stress as a novel stress response pathway activated by a specific G-quadruplex TBA derivative. To the best of our knowledge, this investigation reveals, for the first time, the involvement of the nucleolar stress pathway in the mechanism of action of antiproliferative G-quadruplex aptamers.
Assuntos
Aptâmeros de Nucleotídeos/farmacologia , Nucléolo Celular/metabolismo , Neoplasias do Colo/metabolismo , Neoplasias do Colo/patologia , Quadruplex G , Proteínas Ribossômicas/metabolismo , Estresse Fisiológico , Apoptose/efeitos dos fármacos , Aptâmeros de Nucleotídeos/química , Ciclo Celular/efeitos dos fármacos , Morte Celular/efeitos dos fármacos , Linhagem Celular Tumoral , Nucléolo Celular/efeitos dos fármacos , Proliferação de Células/efeitos dos fármacos , Humanos , Processamento Pós-Transcricional do RNA/efeitos dos fármacos , RNA Ribossômico/genética , Proteína Ribossômica L3 , Estresse Fisiológico/efeitos dos fármacosRESUMO
In this paper, we report studies concerning thrombin binding aptamer (TBA) dimeric derivatives in which the 3'-ends of two TBA sequences have been joined by means of linkers containing adenosine or thymidine residues and/or a glycerol moiety. CD and electrophoretic investigations indicate that all modified aptamers are able to form G-quadruplex domains resembling that of the parent TBA structure. However, isothermal titration calorimetry measurements of the aptamer/thrombin interaction point to different affinities to the target protein, depending on the type of linker. Consistently, the best ligands for thrombin show anticoagulant activities higher than TBA. Interestingly, two dimeric aptamers with the most promising properties also show far higher resistances in biological environment than TBA.
Assuntos
Antitrombinas/química , Aptâmeros de Nucleotídeos/química , Quadruplex G , Trombina/química , Ligantes , Modelos Moleculares , Ligação ProteicaRESUMO
Loss of telomeres stability is a hallmark of cancer cells. Exposed telomeres are prone to aberrant end-joining reactions leading to chromosomal fusions and translocations. Human telomeres contain repeated TTAGGG elements, in which the 3' exposed strand may adopt a G-quadruplex (G4) structure. The guanine-rich regions of telomeres are hotspots for oxidation forming 8-oxoguanine, a lesion that is handled by the base excision repair (BER) pathway. One key player of this pathway is Ape1, the main human endonuclease processing abasic sites. Recent evidences showed an important role for Ape1 in telomeric physiology, but the molecular details regulating Ape1 enzymatic activities on G4-telomeric sequences are lacking. Through a combination of in vitro assays, we demonstrate that Ape1 can bind and process different G4 structures and that this interaction involves specific acetylatable lysine residues (i.e. K27/31/32/35) present in the unstructured N-terminal sequence of the protein. The cleavage of an abasic site located in a G4 structure by Ape1 depends on the DNA conformation or the position of the lesion and on electrostatic interactions between the protein and the nucleic acids. Moreover, Ape1 mutants mimicking the acetylated protein display increased cleavage activity for abasic sites. We found that nucleophosmin (NPM1), which binds the N-terminal sequence of Ape1, plays a role in modulating telomere length and Ape1 activity at abasic G4 structures. Thus, the Ape1 N-terminal sequence is an important relay site for regulating the enzyme's activity on G4-telomeric sequences, and specific acetylatable lysine residues constitute key regulatory sites of Ape1 enzymatic activity dynamics at telomeres.
Assuntos
DNA Liase (Sítios Apurínicos ou Apirimidínicos)/química , DNA Liase (Sítios Apurínicos ou Apirimidínicos)/metabolismo , Quadruplex G , Lisina/metabolismo , Telômero/química , Telômero/metabolismo , Acetilação , Linhagem Celular Tumoral , Humanos , Nucleofosmina , Concentração OsmolarRESUMO
BACKGROUND: Although the thrombin binding aptamer (TBA) is endowed with both anticoagulant and antiproliferative properties, it is possible to reduce the first and enhance the second one by suitable chemical modifications. METHODS: Two oligonucleotides (TBA353 and TBA535) based on the TBA sequence (GGTTGGTGTGGTTGG) and containing inversion of polarity sites have been investigated by CD, UV and electrophoretic techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay), antiproliferative (MTT assay) and anti-motility (wound healing assay) properties against Calu-6 cells have been tested and compared with TBA. RESULTS: CD, UV and electrophoresis data indicate that both ODNs are able to form G-quadruplex structures. Particularly, results suggest that TBA535 adopts a G-quadruplex structure characterized by a loop arrangement different from that of TBA. Both TBA analogues drop the anticoagulant activity. However, TBA535 is endowed with a significant antiproliferative activity against lung cancer Calu-6 cells. Importantly, both TBA and TBA535 possess a remarkable anti-motility property against the same cell line. CONCLUSIONS: Both TBA analogues TBA353 and TBA535 are able to form G-quadruplex structures with no anticoagulant activity. However only TBA535 is endowed with noteworthy antiproliferative and anti-motility properties against lung cancer Calu-6 cells. GENERAL SIGNIFICANCE: The switching from the anticoagulant to antiproliferative property can be obtained also in TBA derivatives not adopting the "chair-like" G-quadruplex structure typical of TBA. Furthermore, results have highlighted an unprecedented anti-cell-motility property of TBA and TBA535 reinforcing the potential of these ODNs as anticancer drugs.
Assuntos
Aptâmeros de Nucleotídeos/metabolismo , Movimento Celular/efeitos dos fármacos , Proliferação de Células/efeitos dos fármacos , Antineoplásicos/química , Antineoplásicos/metabolismo , Antineoplásicos/farmacologia , Linhagem Celular Tumoral , Dicroísmo Circular , Eletroforese em Gel de Poliacrilamida , Quadruplex G , Humanos , Espectroscopia de Ressonância Magnética , Estrutura Molecular , Ligação Proteica , Espectrofotometria Ultravioleta , Difração de Raios XRESUMO
BACKGROUND: The thrombin binding aptamer (TBA) is endowed with both anticoagulant and antiproliferative activities. Its chemico-physical and/or biological properties can be tuned by the site-specific replacement of selected residues. METHODS: Four oligodeoxynucleotides (ODNs) based on the TBA sequence (5'-GGTTGGTGTGGTTGG-3') and containing 2'-deoxyuridine (U) or 5-bromo-2'-deoxyuridine (B) residues at positions 4 or 13 have been investigated by NMR and CD techniques. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay) have been tested and compared with two further ODNs containing 5-hydroxymethyl-2'-deoxyuridine (H) residues in the same positions, previously investigated. RESULTS: The CD and NMR data suggest that all the investigated ODNs are able to form G-quadruplexes strictly resembling that of TBA. The introduction of B residues in positions 4 or 13 increases the melting temperature of the modified aptamers by 7⯰C. The replacement of thymidines with U in the same positions results in an enhanced anticoagulant activity compared to TBA, also at low ODN concentration. Although all ODNs show antiproliferative properties, only TBA derivatives containing H in the positions 4 and 13 lose the anticoagulant activity and remarkably preserve the antiproliferative one. CONCLUSIONS: All ODNs have shown antiproliferative activities against two cancer cell lines but only those with U and B are endowed with anticoagulant activities similar or improved compared to TBA. GENERAL SIGNIFICANCE: The appropriate site-specific replacement of the residues in the TT loops of TBA with commercially available thymine analogues is a useful strategy either to improve the anticoagulant activity or to preserve the antiproliferative properties by quenching the anticoagulant ones.
Assuntos
Anticoagulantes/farmacologia , Antineoplásicos/farmacologia , Aptâmeros de Nucleotídeos/farmacologia , Anticoagulantes/síntese química , Anticoagulantes/metabolismo , Antineoplásicos/síntese química , Antineoplásicos/metabolismo , Aptâmeros de Nucleotídeos/síntese química , Aptâmeros de Nucleotídeos/genética , Aptâmeros de Nucleotídeos/metabolismo , Linhagem Celular Tumoral , Dicroísmo Circular , Estabilidade de Medicamentos , Quadruplex G , Humanos , Temperatura de TransiçãoRESUMO
In this paper, we report investigations, based on circular dichroism, nuclear magnetic resonance spectroscopy and electrophoresis methods, on three oligonucleotide sequences, each containing one 3'-3' and two 5'-5' inversion of polarity sites, and four G-runs with a variable number of residues, namely two, three and four (mTG2T, mTG3T and mTG4T with sequence 3'-TGnT-5'-5'-TGnT-3'-3'-TGnT-5'-5'-TGnT-3' in which n = 2, 3 and 4, respectively), in comparison with their canonical counterparts (TGnT)4 (n = 2, 3 and 4). Oligonucleotides mTG3T and mTG4T have been proven to form very stable unprecedented monomolecular parallel G-quadruplex structures, characterized by three side loops containing the inversion of polarity sites. Both G-quadruplexes have shown an all-syn G-tetrad, while the other guanosines adopt anti glycosidic conformations. All oligonucleotides investigated have shown a noteworthy antiproliferative activity against lung cancer cell line Calu 6 and colorectal cancer cell line HCT-116 p53-/-. Interestingly, mTG3T and mTG4T have proven to be mostly resistant to nucleases in a fetal bovine serum assay. The whole of the data suggest the involvement of specific pathways and targets for the biological activity.
Assuntos
Quadruplex G , Conformação de Ácido Nucleico , Desnaturação de Ácido Nucleico , Oligonucleotídeos/química , Linhagem Celular , Linhagem Celular Tumoral , Proliferação de Células/efeitos dos fármacos , Sobrevivência Celular/efeitos dos fármacos , Dicroísmo Circular , Eletroforese em Gel de Poliacrilamida , Células HCT116 , Humanos , Espectroscopia de Ressonância Magnética , Oligonucleotídeos/genética , Oligonucleotídeos/farmacologia , TemperaturaRESUMO
Endometrioid endometrial cancer is the most common gynaecological tumor in developed countries, and its incidence is increasing. The definition of subtypes, based on clinical and endocrine features or on histopathological characteristics, correlate to some extent with patient's prognosis, but there is substantial heterogeneity within tumor types. The search for molecules and mechanisms implied in determining the progression and the response to therapy for this cancer is still ongoing. BAG3 protein, a member of BAG family of co-chaperones, has a pro-survival role in several tumor types. BAG3 anti-apoptotic properties rely on its characteristic to bind several intracellular partners, thereby, modulating crucial events such as apoptosis, differentiation, cell motility, and autophagy. BAG3 expression in human endometrial cancer tissues was not investigated so far. Here, we show that BAG3 protein levels are elevated in tumoral and hyperplastic cells in respect to normal glands. Furthermore, BAG3 subcellular localization appears to be changed in tumoral compared to normal cells. Our results indicate a possible role for BAG3 protein in the maintenance of cell survival in endometrioid endometrial cancer and suggest that this field of studies is worthy of further investigations. J. Cell. Physiol. 232: 309-311, 2017. © 2016 Wiley Periodicals, Inc.
Assuntos
Proteínas Adaptadoras de Transdução de Sinal/metabolismo , Proteínas Reguladoras de Apoptose/metabolismo , Carcinoma Endometrioide/metabolismo , Neoplasias do Endométrio/metabolismo , Idoso , Idoso de 80 Anos ou mais , Carcinoma Endometrioide/patologia , Linhagem Celular Tumoral , Neoplasias do Endométrio/patologia , Feminino , Humanos , Pessoa de Meia-Idade , Coloração e RotulagemRESUMO
Aiming to assess the biological activities of synthetic 1,4-benzoquinones, we previously synthesized different libraries of benzoquinones with lipophilic and bulky alkyl- or aryl-substituents that inhibited 5-lipoxygenase (5-LO). The high potency of 4,5-dimethoxy-3-alkyl-1,2-benzoquinones on 5-LO led to the idea to further modify the structures and thus to improve the inhibitory potential in vitro and in vivo as well as to investigate SARs. Systematic structural optimization through accurate structure-based design resulted in compound 30 (3-tridecyl-4,5-dimethoxybenzene-1,2-diol), an ubiquinol derivative that exhibited the strongest anti-inflammatory effect, with a 10-fold improved 5-LO inhibitory activity (IC50 = 28 nM) in activated neutrophils. Moreover, 30 significantly reduced inflammatory reactions in the carrageenan-induced mouse paw oedema and in zymosan-induced peritonitis in mice. Compound 30 (1 mg/kg, i.p.) potently suppressed the levels of cysteinyl-LTs 30 min after zymosan, outperforming zileuton at a dose of 10 mg/kg. The binding patterns of the quinone- and hydroquinone-based 5-LO inhibitors were analyzed by molecular docking. Together, we elucidated the optimal alkyl chain pattern of quinones and corresponding hydroquinones and reveal a series of highly potent 5-LO inhibitors with effectiveness in vivo that might be useful as anti-inflammatory drugs.
Assuntos
Araquidonato 5-Lipoxigenase/metabolismo , Benzoquinonas/química , Benzoquinonas/farmacologia , Hidroquinonas/química , Hidroquinonas/farmacologia , Inibidores de Lipoxigenase/química , Inibidores de Lipoxigenase/farmacologia , Animais , Anti-Inflamatórios/química , Anti-Inflamatórios/metabolismo , Anti-Inflamatórios/farmacologia , Anti-Inflamatórios/uso terapêutico , Araquidonato 5-Lipoxigenase/química , Benzoquinonas/metabolismo , Benzoquinonas/uso terapêutico , Edema/tratamento farmacológico , Humanos , Hidroquinonas/metabolismo , Hidroquinonas/uso terapêutico , Inibidores de Lipoxigenase/metabolismo , Inibidores de Lipoxigenase/uso terapêutico , Masculino , Camundongos , Simulação de Acoplamento Molecular , Peritonite/tratamento farmacológico , Conformação Proteica , Relação Estrutura-AtividadeRESUMO
BACKGROUND: The thrombin binding aptamer (TBA) is endowed with antiproliferative properties but its potential development is counteracted by the concomitant anticoagulant activity. METHODS: Five oligonucleotides (ODNs) based on TBA sequence (GGTTGGTGTGGTTGG) and containing l-residues or both l-residues and inversion of polarity sites have been investigated by NMR and CD techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay), and their resistance in fetal bovine serum have been tested. RESULTS: CD and NMR data suggest that the investigated ODNs are able to form right- and left-handed G-quadruplex structures. All ODNs do not retain the anticoagulant activity characteristic of TBA but are endowed with a significant antiproliferative activity against two cancerous cell lines. Their resistance in biological environment after six days is variable, depending on the ODN. CONCLUSIONS: A comparison between results and literature data suggests that the antiproliferative activity of the TBA analogues investigated could depends on two factors: a) biological pathways and targets different from those already identified or proposed for other antiproliferative G-quadruplex aptamers, and b) the contribution of the guanine-based degradation products. GENERAL SIGNIFICANCE: Modified TBA analogues containing l-residues and inversion of polarity sites lose the anticoagulant activity but gain antiproliferative properties against two cancer cell lines. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio.
Assuntos
Antineoplásicos/farmacologia , Aptâmeros de Nucleotídeos/farmacologia , Proliferação de Células/efeitos dos fármacos , Neoplasias/tratamento farmacológico , Trombina/farmacologia , Anticoagulantes/química , Anticoagulantes/metabolismo , Anticoagulantes/farmacologia , Antineoplásicos/química , Antineoplásicos/metabolismo , Aptâmeros de Nucleotídeos/química , Aptâmeros de Nucleotídeos/metabolismo , Sequência de Bases , Coagulação Sanguínea/efeitos dos fármacos , Dicroísmo Circular , Estabilidade de Medicamentos , Esterases/química , Quadruplex G , Células HCT116 , Humanos , Espectroscopia de Ressonância Magnética , Modelos Moleculares , Neoplasias/patologia , Ligação Proteica , Relação Estrutura-Atividade , Trombina/análogos & derivados , Trombina/química , Trombina/metabolismo , Fatores de TempoRESUMO
Many antiproliferative G-quadruplexes (G4s) arise from the folding of GT-rich strands. Among these, the Thrombin Binding Aptamer (TBA), as a rare example, adopts a monomolecular well-defined G4 structure. Nevertheless, the potential anticancer properties of TBA are severely hampered by its anticoagulant action and, consequently, no related studies have appeared so far in the literature. We wish to report here that suitable chemical modifications in the TBA sequence can preserve its antiproliferative over anticoagulant activity. Particularly, we replaced one residue of the TT or TGT loops with a dibenzyl linker to develop seven new quadruplex-forming TBA based sequences (TBA-bs), which were studied for their structural (CD, CD melting, 1D NMR) and biological (fibrinogen, PT and MTT assays) properties. The three-dimensional structures of the TBA-bs modified at T13 (TBA-bs13) or T12 (TBA-bs12), the former endowed with selective antiproliferative activity, and the latter acting as potently as TBA in both coagulation and MTT assays, were further studied by 2D NMR restrained molecular mechanics. The comparative structural analyses indicated that neither the stability, nor the topology of the G4s, but the different localization of the two benzene rings of the linker was responsible for the loss of the antithrombin activity for TBA-bs13.
Assuntos
Anticoagulantes/química , Antineoplásicos/química , Aptâmeros de Nucleotídeos/química , Anticoagulantes/farmacologia , Antineoplásicos/farmacologia , Aptâmeros de Nucleotídeos/farmacologia , Compostos de Benzil/química , Testes de Coagulação Sanguínea , Proliferação de Células/efeitos dos fármacos , Fibrinogênio , Quadruplex G , Células HeLa , Humanos , Modelos Moleculares , Desnaturação de Ácido Nucleico , Oligonucleotídeos/síntese química , Tempo de ProtrombinaRESUMO
The human (h)-prune protein is a member of the DHH protein superfamily and it has a cAMP phosphodiesterase activity. Its overexpression in breast, colorectal and gastric cancers correlates with depth of invasion and a high degree of lymph-node metastasis. One mechanism by which h-prune stimulates cell motility and metastasis processes is through its phosphodiesterase activity, which can be suppressed by dipyridamole, a pyrimido[5,4-d]pyrimidine analogue. To obtain new and more potent agents that have high specificity towards inhibition of this h-prune activity, we followed structure-activity-relationship methodologies starting from dipyridamole and synthesised eight new pyrimido-pyrimidine derivatives. We analysed these newly generated compounds for specificity towards h-prune activities in vitro in cellular models using scintillation proximity assay for cAMP-PDE activity, cell index in cell proliferation assays and transwell methodology for two-dimensional cell migration in a top-down strategy of selection. Our findings show that two pyrimido[5,4-d]pyrimidine compounds are more effective than dipyridamole in two highly metastatic cellular models of breast cancer in vitro. Future studies will assess their therapeutic effectiveness against breast and other cancers where there is over-expression of h-prune, and in ad-hoc, proof of concept, animal models.
Assuntos
3',5'-AMP Cíclico Fosfodiesterases/antagonistas & inibidores , Proteínas de Transporte/antagonistas & inibidores , Dipiridamol/análogos & derivados , Dipiridamol/síntese química , Proteínas de Neoplasias/antagonistas & inibidores , 3',5'-AMP Cíclico Fosfodiesterases/metabolismo , Neoplasias da Mama/tratamento farmacológico , Neoplasias da Mama/enzimologia , Proteínas de Transporte/metabolismo , Linhagem Celular Tumoral , Movimento Celular/efeitos dos fármacos , Proliferação de Células/efeitos dos fármacos , Cultura em Câmaras de Difusão , Dipiridamol/farmacologia , Feminino , Humanos , Proteínas de Neoplasias/metabolismo , Monoéster Fosfórico Hidrolases , Relação Estrutura-AtividadeRESUMO
Several anti-HIV aptamers adopt DNA quadruplex structures. Among these, "Hotoda's aptamer" (base sequence TGGGAG) was one of the first to be discovered. Although it has been the topic of some recent research, no detailed structural investigations have been reported. Here we report structural investigations on this aptamer and analogues with related sequences, by using UV, CD, and NMR spectroscopy as well as electrophoretic techniques. The addition of a 3'-end thymine has allowed us to obtain a single, investigable quadruplex structure. Data clearly point to the presence of an A-tetrad. Furthermore, the effects of the incorporation of an 8-methyl-2'-deoxyguanosine at the 5'-end of the G-run were investigated.
Assuntos
Fármacos Anti-HIV/química , Aptâmeros de Nucleotídeos/química , Desoxiguanosina/análogos & derivados , Quadruplex G , Síndrome da Imunodeficiência Adquirida/tratamento farmacológico , Sequência de Bases , Dicroísmo Circular , Desoxiguanosina/química , HIV/efeitos dos fármacos , Humanos , Modelos Moleculares , Ressonância Magnética Nuclear Biomolecular , Espectrofotometria UltravioletaRESUMO
A series of trisubstituted naphthalimides have been synthesized and evaluated as telomeric G-quadruplex ligands by biophysical methods. Affinity for telomeric G-quadruplex AGGG(TTAGGG)(3) binding was first screened by fluorescence titrations. Subsequently, the interaction of the telomeric G-quadruplex with compounds showing the best affinity has been studied by isothermal titration calorimetry and UV-melting experiments. The two best compounds of the series tightly bind the telomeric quadruplex with a 2:1 drug/DNA stoichiometry. These derivatives have been further evaluated for their ability to inhibit telomerase by a TRAP assay and their pharmacological properties by treating melanoma (M14) and human lung cancer (A549) cell lines with increasing drug concentrations. A dose-dependent inhibition of cell proliferation was observed for all cellular lines during short-term treatment.
Assuntos
Quadruplex G , Naftalimidas/química , Naftalimidas/farmacologia , Animais , Calorimetria , Linhagem Celular Tumoral , Proliferação de Células/efeitos dos fármacos , Dicroísmo Circular , Inibidores Enzimáticos/síntese química , Inibidores Enzimáticos/química , Inibidores Enzimáticos/farmacologia , Humanos , Ligantes , Neoplasias Pulmonares/tratamento farmacológico , Espectroscopia de Ressonância Magnética , Melanoma/tratamento farmacológico , Camundongos , Estrutura Molecular , Células NIH 3T3 , Naftalimidas/síntese química , Espectrometria de Fluorescência , Espectrofotometria Ultravioleta , Telomerase/antagonistas & inibidores , Telomerase/metabolismoRESUMO
Cystatins are small proteins, typically composed of 100-120 amino acids, which together with similar proteins devoid of inhibitory properties, belong to a cystatin 'superfamily'. Cystatins can do more than just inhibit proteases: two important aspects described here are aggregation properties linked to misfolding diseases and the unique ability of monellin, a plant cystatin, to elicit sweet taste. The explanation of the puzzling phenomenon of 'sweet proteins' required an in-depth structural study of monellin, also regarding the causes of the high thermal stability of its single chain structure. The detailed mechanisms by which cystatins aggregate could be relevant in the study of misfolding diseases involving cystatins. They are reviewed here with emphasis on 3D domain swapping, typical of aggregating cystatins. While studying monellin, we noticed that it aggregates in a conventional way, probably through the cross-ß spine mechanism. However, several cystatins derived from oryzacystatin_I to emulate the taste behavior of monellin aggregate via different mechanisms.