Differences in ex-vivo Chemosensitivity to Anthracyclines in First Line Acute Myeloid Leukemia.

BACKGROUND: Induction schedules in acute myeloid leukemia (AML) are based on combinations of cytarabine and anthracyclines. The choice of the anthracycline employed has been widely studied in multiple clinical trials showing similar complete remission rates. MATERIALS AND METHODS: Using an ex vivo test we have analyzed if a subset of AML patients may respond differently to cytarabine combined with idarubicin, daunorubicin or mitoxantrone. Bone marrow (BM) samples of 198 AML patients were incubated for 48 hours in 96 well plates, each well containing different drugs or drug combinations at different concentrations. Ex vivo drug sensitivity analysis was made using the PharmaFlow platform maintaining the BM microenvironment. Drug response was evaluated as depletion of AML blast cells in each well after incubation. Annexin V-FITC was used to quantify the ability of the drugs to induce apoptosis, and pharmacological responses were calculated using pharmacokinetic population models. RESULTS: Similar dose-respond graphs were generated for the three anthracyclines, with a slight decrease in EC50 with idarubicin (p=1.462E-06), whereas the interpatient variability of either drug was large. To identify those cases of selective sensitivity to anthracyclines, potency was compared, in terms of area under the curve. Differences in anthracycline monotherapy potency greater than 30% from 3 pairwise comparisons were identified in 28.3% of samples. Furthermore, different sensitivity was detected in 8.2% of patients comparing combinations of cytarabine and anthracyclines. DISCUSSION: A third of the patients could benefit from the use of this test in the first line induction therapy selection, although it should be confirmed in a clinical trial specifically designed.

Elevated liver stiffness is linked to increased biomarkers of inflammation and immune activation in HIV/hepatitis C virus-coinfected patients.

OBJECTIVES: Immune dysregulation is a hallmark of HIV and hepatitis C virus (HCV) infections. We aimed to evaluate the relationship between liver stiffness measurement (LSM) and biomarkers of T-cell activation, bacterial translocation, inflammation, endothelial dysfunction, and coagulopathy in HIV/HCV-coinfected patients. DESIGN: Cross-sectional study. METHODS: We studied 238 HIV/HCV-coinfected patients, 32 healthy controls, and 39 HIV-monoinfected patients. Patients were stratified according to LSM into four groups: less than 12.5, 12.5-25, 25-40, and more than 40 kPa. T-cell subsets were measured using flow cytometry and plasma biomarkers using immunoassays. RESULTS: HIV/HCV-coinfected patients had higher biomarker levels of immune activation in peripheral blood [T-cell activation (CD4CD38 and CD8CD38), bacterial translocation (soluble CD14), inflammation [IL-1b, IL-6, IL-8, IL-18, IFN-γ-inducible protein 10 (IP-10)] endothelial dysfunction [soluble vascular cell adhesion molecule 1 (sVCAM1), soluble intercellular cell adhesion molecule 1 (sICAM1), and soluble tumor necrosis factor receptor 1 (sTNFR1)], and coagulopathy (plasminogen activator inhibitor-1)] than healthy controls and HIV-monoinfected patients. Moreover, in HIV/HCV-coinfected patients, a direct relationship between LSM and immune activation [T-cell activation (CD8CD38 bacterial translocation (lipopolysaccharide), inflammation (IL-8, IP-10), endothelial dysfunction (sVCAM1, sICAM1, and sTNFR1), and coagulopathy (D-dimer)] was found. Subsequently, patients were stratified into different fibrosis stages, finding that patients with cirrhosis who had LSM at least 40 kPa showed higher biomarker values of immune activation [T-cell activation (CD4CD38 and CD8CD38), bacterial translocation (lipopolysaccharide), inflammation (IL-8, IL-6, IP-10), endothelial dysfunction (sVCAM1, sICAM1, and sTNFR1), and coagulopathy (D-dimer)] than patients from the other three groups (<12.5, 12.5-25, and 25-40 kPa). CONCLUSION: T-cell activation, bacterial translocation, inflammation, endothelial dysfunction, and coagulopathy increased with the severity of liver fibrosis in HIV/HCV-coinfected patients, particularly in patients who had LSM at least 40 kPa.

Bryostatin activates HIV-1 latent expression in human astrocytes through a PKC and NF-ĸB-dependent mechanism.

Multiple studies have shown that HIV-1 patients may develop virus reservoirs that impede eradication; these reservoirs include the central nervous system (CNS). Despite an undetectable viral load in patients treated with potent antiretrovirals, current therapy is unable to purge the virus from these latent reservoirs. To broaden the inhibitory range and effectiveness of current antiretrovirals, the potential of bryostatin was investigated as a latent HIV-1 activator. We used primary astrocytes, NHA cells, and astrocytoma cells U-87. Infected cells with HIV-1(NL4.3) were treated with bryostatin alone or in combination with different inhibitors. HIV-1 production was quantified by using ELISA. Transcriptional activity was measured using luciferase reporter gene assays by using lipofectin. We performed cotransfection experiments of the LTR promoter with the active NF-κB member p65/relA. To confirm the NF-κB role, Western blot and confocal microscopy were performed. Bryostatin reactivates latent viral infection in the NHA and U87 cells via activation of protein kinase C (PKC)-alpha and -delta, because the PKC inhibitors rottlerin and GF109203X abrogated the bryostatin effect. No alteration in cell proliferation was found. Moreover, bryostatin strongly stimulated LTR transcription by activating the transcription factor NF-κB. Bryostatin could be a beneficial adjunct to the treatment of HIV-1 brain infection.

TNF-Α may mediate inflammasome activation in the absence of bacterial infection in more than one way.

Members of the mammalian nucleotide binding domain, leucine-rich repeat (LRR)-containing receptor family of proteins are key modulators of innate immunity regulating inflammation. To date, microbial pathogen-associated molecules and toxins have been identified as key triggers of activation of inflammasomes. However, recently, environmental, and neurodegenerative stimuli have been identified that lead to IL-1ß release by means of inflammasomes. IL-1ß plays a crucial role during brain inflammation, and caspase-1 appears to be a key modulator of IL-1ß bioactivity and the consequent transcriptional regulation of gene expression within the brain during inflammation. We show here that exposure of a human neuroblastoma cell line (SK-N-MC cells) to TNF-α promotes ROS-mediated caspase-1 activation and IL-1ß secretion. The involvement of NF-κB in the regulation of IL-1ß synthesis is investigated through specific inhibition of this transcription factor. The effect of TNF-α was abolished in the presence of ROS inhibitors as NAC, or DPI. Remarkably, SK-N-MC cells do not respond to ATP stimulation in spite of P2X7R expression. These results provide a mechanism by which danger signals and particulate matter mediate inflammation via the inflammasome in the absence of microbial infection.

Anionic sulfonated and carboxylated PPI dendrimers with the EDA core: synthesis and characterization of selective metal complexing agents.

Herein we describe the synthesis and characterization of new sulfonated and carboxylated poly(propyleneimino) (PPI) dendrimers with the ethylenediamino (EDA) core, at generations 1, 2 and 3. By means of UV-Vis and EPR spectroscopy, using Cu(2+) as a probe, we concluded that these dendrimers show a specific pattern in the coordination of metal ions. In agreement with the UV-Vis studies, EPR spectra of carboxylated compounds are constituted by 3 different signals which appear and then disappear with increasing copper concentration, corresponding to the saturation of different copper complexation sites. At the lowest copper concentration up to a 1:1 molar ratio between Cu(II) and the dendrimer, the spectrum is characteristic of a CuN2O2 coordination at the core of the dendrimer. The spectrum appearing at higher Cu(II) concentrations indicates a peripheral location of the ions coordinating one nitrogen and 3 oxygen atoms in a square planar geometry in restricted mobility conditions. For the highest concentrations tested, copper ions are confined at the external dendrimer surface with CuO4 coordination. For sulfonate systems, the EPR results are in line with a weaker interaction of Cu(II) with the nitrogen sites and a stronger interaction with the oxygen (SO3(-)) groups with respect to the interactions measured by EPR for carboxylate systems.

Thymic function failure and C-reactive protein levels are independent predictors of all-cause mortality in healthy elderly humans.

Relationship between thymic function and elderly survival has been suspected, despite the fact that formal proof is elusive due to technical limitations of thymic function-related markers. The newly described sj/ß-TREC ratio allows now, by overcoming these limitations, an accurate measurement of thymic output in elderly humans. Thus, the aim of this study was to determine the impact of thymic function and inflammatory markers on healthy elderly human survival. Healthy volunteers (n = 151), aged over 65, were asked to participate (CARRERITAS cohort). Subjects were excluded if diagnosed of dementia or, during the last 6 months, had clinical data of infection, hospital admission, antitumor therapy, or any treatment that could influence the immune status. Thymic function (sj/ß-TREC ratio), CD4:CD8 T cell ratio, C-reactive protein, interleukin-6, and neutrophilia were determined from basal samples. All basal variables and age were associated with 2-year all-cause mortality. Multivariate analysis showed that only thymic function and C-reactive protein were independently associated with time to death. In conclusion, we show, for the first time, the direct role of thymic function in human survival. C-reactive protein raise is also a marker of mortality in the healthy elderly, in a thymic-independent way.

Plasma IL-6 and IL-9 predict the failure of interferon-α plus ribavirin therapy in HIV/HCV-coinfected patients.

BACKGROUND: The cytokine profile plays an important role in treatment outcome of hepatitis C virus (HCV) infection, and probably modulates the immune response against HCV. The aim of this study was to evaluate which cytokines affect the response to interferon-α (IFN-α) and ribavirin therapy and how these cytokines change 72 weeks after starting anti-HCV therapy in HIV/HCV-coinfected patients. METHODS: We carried out a retrospective follow-up study of 65 patients on anti-HCV therapy. A sustained virological response (SVR) was defined as an undetectable HCV viral load up to 24 weeks after the end of treatment. Cytokines were measured using a multiplex immunoassay kit. RESULTS: On starting anti-HCV therapy, non-responder (NR) patients had higher levels of interleukin (IL)-6, IL-9, IL-10 and tumour necrosis factor (TNF)-α (P < 0.05), while IL-17A levels were increased in SVR patients (P = 0.058). However, only patients with high levels of IL-6 and IL-9 had decreased odds to achieve SVR (P < 0.05). Plasma levels of IL-6 and IL-9 had a high predictive value for SVR failure [area under the ROC curve (AUC) 0.839 (95% CI 0.733-0.945) and AUC 0.769 (95% CI 0.653-0.884)]. In addition, during anti-HCV therapy, IL-1ß showed an increase in NR patients (P = 0.015) and IL-10 decreased in SVR patients (P = 0.049). After clearing HCV infection, low levels of TNF-α, IL-6, IL-9, IL-10, IL-13 and IL-22 were found in SVR patients (P < 0.05), as well as IL-1ß, but only near statistical significance (P = 0.073). CONCLUSIONS: High plasma levels of IL-6 and IL-9 had a high predictive value for SVR failure. Furthermore, clearing of HCV infection was associated with low inflammatory and T helper (Th)2/Th9/Th22 cytokine levels.

TNF-α contributes to caspase-3 independent apoptosis in neuroblastoma cells: role of NFAT.

There is increasing evidence that soluble factors in inflammatory central nervous system diseases not only regulate the inflammatory process but also directly influence electrophysiological membrane properties of neurons and astrocytes. In this context, the cytokine TNF-α (tumor necrosis factor-α) has complex injury promoting, as well as protective, effects on neuronal viability. Up-regulated TNF-α expression has also been found in various neurodegenerative diseases such as cerebral malaria, AIDS dementia, Alzheimer's disease, multiple sclerosis, and stroke, suggesting a potential pathogenic role of TNF-α in these diseases as well. We used the neuroblastoma cells SK-N-MC. Transcriptional activity was measured using luciferase reporter gene assays by using lipofectin. We performed cotransfection experiments of NFAT (nuclear factor of activated T cells) promoter constructed with a dominant negative version of NFAT (dn-NFAT). Cell death was performed by MTT (3-(4,5-dimethylthiazol-2-yl)5,5-diphenyltetrazolium bromide) and TUNEL assays. NFAT translocation was confirmed by Western blot. Involvement of NFAT in cell death was assessed by using VIVIT. P53, Fas-L, caspase-3, and caspase-9 expressions were carried out by Western blot. The mechanisms involved in TNF-α-induced cell death were assessed by using microarray analysis. TNF-α causes neuronal cell death in the absence of glia. TNF-α treatment results in nuclear translocation of NFAT through activation of calcineurin in a Ca(2+) independent manner. We demonstrated the involvement of FasL/Fas, cytochrome c, and caspase-9 but the lack of caspase-3 activation. NB cell death was absolutely reverted in the presence of VIVIT, and partially diminished by anti-Fas treatment. These data demonstrate that TNF-α promotes FasL expression through NFAT activation in neuroblastoma cells and this event leads to increased apoptosis through independent caspase-3 activation.

Correlation between the Trofile test and virological response to a short-term maraviroc exposure in HIV-infected patients.

OBJECTIVES: The current validated assay to determine tropism of HIV variants is Trofile, which has some limitations. The aim of this work was to correlate the virological response to a short-term maraviroc exposure with Trofile. METHODS: From 1 July 2008 to 1 March 2009, 34 consecutive HIV-infected patients with detectable viral load during the last 6 months began an 8 day exposure to maraviroc (MCT group); six HIV-infected patients without antiretroviral therapy received no treatment (control group). Plasma viral load was evaluated on days 0, 2, 5 and 8. Baseline Trofile was performed in MCT group patients. The maraviroc clinical test (MCT) was considered positive if viral load was undetectable (< 40 HIV-RNA copies/mL) or a reduction > or = 1 log(10) HIV-RNA copies/mL was achieved after 8 days of maraviroc exposure. RESULTS: Global concordance between MCT and Trofile was 93.5%. In patients with R5 virus according to Trofile, MCT was positive in 19/20 (concordance 95%); in patients with dual/mixed virus, MCT was negative in 10/11 (concordance 90.9%). An additional phenotypic tropism assay was performed in patients with discordance between MCT and Trofile, being concordant with MCT in both cases. Three patients showed a non-reportable Trofile result, and all of them achieved undetectability after MCT. CONCLUSIONS: A clinical approach like short-term maraviroc exposure could be an additional resource to genetic and phenotypic HIV tropism assays. This clinical approach shows high concordance with Trofile, and could allow patients with non-reportable results by Trofile to benefit from maraviroc therapy.

HIV-2 induces NF-kappaB activation and cyclooxygenase-2 expression in human astroglial cells.

HIV-2 invades CNS and causes neurological disease as well as HIV-1 does. Induction of COX-2 in CNS of HIV-1 infected people has been proposed as a cause of cognitive impairment, so we tested whether HIV-2 may cause damage by a similar mechanism. COX-2 mRNA and protein expression were induced in human astrocytes upon interaction with HIV-2, being this induction abrogated by CXCR4 antagonists. HIV-2 induced COX-2 promoter transcription and deletion of the two NF-kappaB binding sites of the promoter abrogated this induction. Neither AP-1 nor NFAT seem to be involved in COX-2 transcriptional activation. Overexpression of IkappaBalpha completely abrogated COX-2 induction, and transfection of p65/relA NF-kappaB induced COX-2 transcription. Interestingly, HIV-2 activated NF-kappaB by inducing p65/relA transactivating activity through Ser536 phosphorylation. Moreover, the astrocyte activation induced by HIV-2 was abrogated by different COX inhibitors. In summary, HIV-2 induces COX-2 in human astrocytes depending on CXCR4 coreceptor.

Immunological predictors of CD4+ T cell decline in antiretroviral treatment interruptions.

BACKGROUND: The common response to stopping anti-HIV treatment is an increase of HIV-RNA load and decrease in CD4+, but not all the patients have similar responses to this therapeutic strategy. The aim was to identify predictive markers of CD4+ cell count declines to < 350/microL in CD4-guided antiretroviral treatment interruptions. METHODS: 27 HIV-infected patients participated in a prospective multicenter study in with a 24 month follow-up. Patients on stable highly active antiretroviral therapy (HAART), with CD4+ count > 600/microL, and HIV-RNA < 50 copies/ml for at least 6 months were offered the option to discontinue antiretroviral therapy. The main outcome was a decline in CD4+ cell count to < 350/microL. RESULTS: After 24 months of follow-up, 16 of 27 (59%) patients (who discontinued therapy) experienced declines in CD4+ cell count to < 350/microL. Patients with a CD4+ nadir of < 200 cells/microL had a greater risk of restarting therapy during the follow-up (RR (CI95%): 3.37 (1.07; 10.36)). Interestingly, lymphoproliferative responses to Mycobacterium tuberculosis purified protein derivative (PPD) below 10000 c.p.m. at baseline (4.77 (1.07; 21.12)), IL-4 production above 100 pg/mL at baseline (5.95 (1.76; 20.07)) in PBMC cultured with PPD, and increased IL-4 production of PBMC with p24 antigen at baseline (1.25 (1.01; 1.55)) were associated to declines in CD4+ cell count to < 350/microL. CONCLUSION: Both the number (CD4+ nadir) and the functional activity of CD4+ (lymphoproliferative response to PPD) predict the CD4+ decrease associated with discontinuation of ART in patients with controlled viremia.

HIV-1 envelope glycoprotein 120 induces cyclooxygenase-2 expression in astrocytoma cells through a nuclear factor-kappaB-dependent mechanism.

Human immunodeficiency virus-1 gp120 alters astroglial function, which compromises the function of the nearby of neuronal cells contributing to the cognitive impairment in human immunodeficiency virus-1 infection. Cyclooxygenase (COX)-2 has been involved in this process, although the intracellular pathways and second messengers involved are yet unknown. We have investigated the role of gp120-induced COX-2 in the astrocytoma human cell line U-87, and the different pathways involved in this activation. COX-2 mRNA and protein expression were detected in gp120-stimulated cells. Moreover, gp120 induces COX-2 promoter transcription. The effect of gp120 was abrogated by a neutralizing antibody against the chemokine receptor CXCR4 neutralizing antibody. Analysis of the promoter show that deletion or mutation of a proximal nuclear factor (NF)-kappaB site completely abrogated gp120-dependent transcription. NF-kappaB but neither Activating protein-1 nor nuclear factor of activated T-cells-dependent transcription was induced by gp120, as shown by reporter and electrophoretic mobility shift assays. In addition, transfection assays with the NF-kappaB inhibitor, IkappaBalpha, prevented gp120-mediated COX-2 induction. In contrast, there was no inhibition of COX-2 promoter transcription by expressing a dominant negative c-Jun, or nuclear factor of activated T-cells constructs. The antioxidant pyrrolidine dithiocarbamate inhibited COX-2 protein expression and COX-2 transcriptional activity induced by gp120. Thus, our results indicate that gp120 induced COX-2 transcription through NF-kappaB activation in astrocytoma cells.

Analysis of interaction between dendriplexes and bovine serum albumin.

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.

A new possible mechanism of human immunodeficiency virus type 1 infection of neural cells.

To study the mechanism by which HIV-1 infects neurons we have used human neuroblastoma cell lines (NB). NB (SK-N-SH and SK-N-MC) were found to be susceptible to productive infection by X4 or R5 HIV-1, as detected by viral load and Ag-p24. To identify the putative receptor, we tested the cell surface expression of previously described receptors such as CD4, nucleolin, galactosylceramide, and CCR1, CCR5, and CXCR4 by cytometry and RT-PCR. NB express no CD4 and low levels of galactosylceramide or nucleolin. Furthermore, antibodies to any of these molecules did not affect NB infection. NB express variable levels of CCR5, CCR1, and CXCR4. Interestingly, exogenous heparan sulfate alone was able to substantially inhibit HIV-1 infection, an effect which was potentiated by RANTES or SDF-1 in the HIV-1-infection with R5 or X4 isolates. Besides, anti-CCR5 and anti-CXCR4 significantly blocked HIV-1 infection of R5 and X4 isolates. Our results suggest that HIV-1 entry involves a chemokine-receptor-dependent but CD4-independent entry in neural cells.