Creation of an international registry to support discovery in schwannomatosis.

Schwannomatosis is a tumor suppressor syndrome that causes multiple tumors along peripheral nerves. Formal diagnostic criteria were first published in 2005. Variability in clinical presentation and a relative lack of awareness of the syndrome have contributed to difficulty recognizing affected individuals and accurately describing the natural history of the disorder. Many critical questions such as the mutations underlying schwannomatosis, genotype-phenotype correlations, inheritance patterns, pathologic diagnosis of schwannomatosis-associated schwannomas, tumor burden in schwannomatosis, the incidence of malignancy, and the effectiveness of current, or new treatments remain unanswered. A well-curated registry of schwannomatosis patients is needed to facilitate research in field. An international consortium of clinicians and scientists across multiple disciplines with expertise in schwannomatosis was established and charged with the task of designing and populating a schwannomatosis patient registry. The International Schwannomatosis Registry (ISR) was built around key data points that allow confirmation of the diagnosis and identification of potential research subjects to advance research to further the knowledge base for schwannomatosis. A registry with 389 participants enrolled to date has been established. Twenty-three additional subjects are pending review. A formal process has been established for scientific investigators to propose research projects, identify eligible subjects, and seek collaborators from ISR sites. Research collaborations have been created using the information collected by the registry and are currently being conducted. The ISR is a platform from which multiple research endeavors can be launched, facilitating connections between affected individuals interested in participating in research and researchers actively investigating a variety of aspects of schwannomatosis. © 2016 Wiley Periodicals, Inc.

Growth in neurofibromatosis 1 microdeletion patients.

Microdeletions of the entire NF1 gene and surrounding genomic region occur in about 5% of patients with neurofibromatosis 1 (NF1). NF1 microdeletion patients usually have more cutaneous and plexiform neurofibromas and a higher risk of developing malignant peripheral nerve sheath tumors than other people with NF1. Somatic overgrowth has also been observed in NF1 microdeletion patients, an observation that is remarkable because most NF1 patients are smaller than average for age and sex. We studied longitudinal measurements of height, weight, and head circumference in 56 patients with NF1 microdeletions and 226 NF1 patients with other kinds of mutations. Although children with NF1 microdeletions were much taller than non-deletion NF1 patients at all ages after 2 years, the lengths of deletion and nondeletion NF1 patients were similar in early infancy. NF1 microdeletion patients tended to be heavier than other NF1 patients, but height or weight more than 3 standard deviations above the mean for age and sex was infrequent in children with NF1 microdeletions. Head circumference and age of puberty were similar in deletion and non-deletion NF1 patients. The pattern of growth differs substantially in deletion and non-deletion NF1 patients, but the pathogenic basis for this difference is unknown.

Exome sequencing identifies mutations in KIF14 as a novel cause of an autosomal recessive lethal fetal ciliopathy phenotype.

Gene discovery using massively parallel sequencing has focused on phenotypes diagnosed postnatally such as well-characterized syndromes or intellectual disability, but is rarely reported for fetal disorders. We used family-based whole-exome sequencing in order to identify causal variants for a recurrent pattern of an undescribed lethal fetal congenital anomaly syndrome. The clinical signs included intrauterine growth restriction (IUGR), severe microcephaly, renal cystic dysplasia/agenesis and complex brain and genitourinary malformations. The phenotype was compatible with a ciliopathy, but not diagnostic of any known condition. We hypothesized biallelic disruption of a gene leading to a defect related to the primary cilium. We identified novel autosomal recessive truncating mutations in KIF14 that segregated with the phenotype. Mice with autosomal recessive mutations in the same gene have recently been shown to have a strikingly similar phenotype. Genotype-phenotype correlations indicate that the function of KIF14 in cell division and cytokinesis can be linked to a role in primary cilia, supported by previous cellular and model organism studies of proteins that interact with KIF14. We describe the first human phenotype, a novel lethal ciliary disorder, associated with biallelic inactivating mutations in KIF14. KIF14 may also be considered a candidate gene for allelic viable ciliary and/or microcephaly phenotypes.

The generalized bone phenotype in children with neurofibromatosis 1: a sibling matched case-control study.

People with neurofibromatosis 1 (NF1) have low bone mineralization, but the natural history and pathogenesis are poorly understood. We performed a sibling-matched case-control study of bone mineral status, morphology, and metabolism. Eighteen children with NF1 without focal bony lesions were compared to unaffected siblings and local population controls. Bone mineral content at the lumbar spine and proximal femur (dual energy X-ray absorptiometry (DXA)) was lower in children with NF1; this difference persisted after adjusting for height and weight. Peripheral quantitative computed tomography (pQCT) of the distal tibia showed that trabecular density was more severely compromised than cortical. Peripheral QCT-derived estimates of bone strength and resistance to bending and stress were poorer among children with NF1 although there was no difference in fracture frequencies. There were no differences in the size or shape of bones after adjusting for height. Differences in markers of bone turnover between cases and controls were in the directions predicted by animal studies, but did not reach statistical significance. Average serum calcium concentration was higher (although within the normal range) in children with NF1; serum 25-OH vitamin D, and PTH levels did not differ significantly between cases and controls. Children with NF1 were less mature (assessed by pubertal stage) than unaffected siblings or population controls. Children with NF1 have a generalized difference of bone metabolism that predominantly affects trabecular bone. Effects of decreased neurofibromin on bone turnover, calcium homeostasis, and pubertal development may contribute to the differences in bone mineral content observed among people with NF1.

Hospitalizations among people with Down syndrome: a nationwide population-based study in Denmark.

Most persons with Down syndrome (DS) now survive to adulthood, but their health care needs beyond childhood are not well described. We followed a national cohort of 3,212 persons with DS and a reference cohort of persons without DS through the Danish National Hospital Register from January 1, 1977, to May 31, 2008. Poisson regression was used to calculate rate ratios for numbers of overnight hospital admissions and hospital days. During the study period, persons with DS had more than twice the rate of hospital admissions and nearly three times as many bed-days as the population as a whole. Malformations, diseases of the respiratory system, and diseases of the nervous system or sensory organs were the principal indications for hospital admissions. The higher rate ratios for hospital admissions were seen especially among persons less than 20 years of age. Hospitalizations for neoplasms or for diseases of the musculoskeletal system or connective tissue were much less frequent among adults with DS. As survival among persons with DS continues to improve, these findings are likely to be useful for health care planning, although the potential utility may be different for different health care systems.

Cardiac characterization of 16 patients with large NF1 gene deletions.

The aim of this study was to characterize cardiac features of patients with neurofibromatosis 1 (NF1) and large deletions of the NF1 gene region. The study participants were 16 patients with large NF1 deletions and 16 age- and sex-matched NF1 patients without such deletions. All the patients were comprehensively characterized clinically and by echocardiography. Six of 16 NF1 deletion patients but none of 16 non-deletion NF1 patients have major cardiac abnormalities (p = 0.041). Congenital heart defects (CHDs) include mitral insufficiency in two patients and ventricular septal defect, aortic stenosis, and aortic insufficiency in one patient each. Three deletion patients have hypertrophic cardiomyopathy. Two patients have intracardiac tumors. NF1 patients without large deletions have increased left ventricular (LV) diastolic posterior wall thickness (p < 0.001) and increased intraventricular diastolic septal thickness (p = 0.001) compared with a healthy reference population without NF1, suggestive of eccentric LV hypertrophy. CHDs and other cardiovascular anomalies are more frequent among patients with large NF1 deletion and may cause serious clinical complications. Eccentric LV hypertrophy may occur in NF1 patients without whole gene deletions, but the clinical significance of this finding is uncertain. All patients with clinical suspicion for NF1 should be referred to a cardiologist for evaluation and surveillance.

Valuing gene testing in children with possible neurofibromatosis 1.

With the growing number of clinical guidelines recommending genetics tests in routine clinical care, the value of these tests should be evaluated. We examined the economic value of offering genetic testing to children with possible neurofibromatosis 1 (NF1) in British Columbia. Diagnosis of NF1 is usually made based on diagnostic clinical criteria, but molecular diagnostic testing, currently offered on a case-by-case basis in BC, now reliably diagnoses NF1 in 95% of cases. Children who present with some clinical features but whose findings are insufficient to meet the diagnostic criteria are labelled as having 'possible NF1'. Current guidelines call for these children to be followed as they have NF1, leading to annual ophthalmologic examinations and screening for complications; thus, there are increased costs to health care system. We created a model to account for these costs to the health care system, comparing the current protocol with one that would offer all children diagnosed with possible NF1 with genetic testing. Focusing on the incremental cost allowed us to determine that genetic testing provides good value, and patient interviews provided insight into the qualitative benefits of an earlier firm diagnosis. These findings may be helpful in guiding health policy decision-making.

Cerebrovasculopathy in NF1 associated with ocular and scalp defects.

Vascular lesions are uncommon in children with neurofibromatosis 1 (NF1) but can cause serious complications. We report on a child with NF1 who presented at 18 months of age with symptomatic stenosis of the left middle cerebral artery and its branches, and associated moyamoya disease. She also had bilateral posterior embryotoxon, left corneal opacity (Peters anomaly), and cutis aplasia of the left scalp. All of these defects may have occurred as a result of disruption of the blood supply caused by NF1 vasculopathy prenatally. This constellation of vascular anomalies has not been previously reported in a patient with NF1.

Serum folate and cancer mortality among U.S. adults: findings from the Third National Health and Nutritional Examination Survey linked mortality file.

BACKGROUND: The relation between folate status and cancer is controversial. Several epidemiologic studies have suggested that increased folate intake is associated with reduced risk of various cancers, others have found no such associations, and a few have suggested that high folate intake might increase the risk of certain cancers. METHODS: Using data from the Third National Health and Nutrition Examination Survey (NHANES III) Mortality File, a prospective cohort study of a nationally representative sample of 14,611 U.S. adults, we conducted Cox proportional hazards regression modeling to investigate the association of baseline serum folate concentrations and all-cancer mortality determined from linked death certificate data. RESULTS: Relative to the lowest quintile of serum folate (<3.0 ng/mL), the multivariable-adjusted hazard ratios across quintiles 2 to 5 were: 1.61 [95% confidence interval (95% CI), 1.11-2.32], 1.00 (95% CI, 0.65-1.49), 1.39 (95% CI, 0.96-2.03), and 0.85 (95% CI, 0.59-1.22). These findings did not differ substantially by age or sex, but the higher risk for those in the second quintile appeared limited to non-Hispanic whites. CONCLUSION: These findings suggest that there may be a nonlinear relationship between folate status and the risk of all-cancer mortality such that persons with low, but not grossly deficient, serum blood folate concentrations may be at increased risk. Further study is needed to determine whether these findings are due to chance, and if not, to clarify their biological basis.

Bone health and fracture rate in individuals with neurofibromatosis 1 (NF1).

BACKGROUND: Patients with neurofibromatosis 1 (NF1) are shorter than expected and often have low bone mineral density (BMD), but the pathogenesis of these bony problems is poorly understood. METHODS: We performed an exploratory study of BMD, 18 laboratory measures of bone metabolism, and fracture history in 72 adult NF1 patients. RESULTS: Eight of the 18 clinical biochemical measures of bone health had at least 10% of NF1 patients outside the standard reference range. Serum 25-hydroxy-vitamin D concentrations were low in 56% of the NF1 patients, serum parathyroid hormone (PTH) concentrations were high in 34%, and urine deoxypyridinoline cross-link concentrations were high in 50%. Mean serum 25-hydroxy-vitamin D concentrations were significantly lower in people with NF1 than in season matched controls in both summer (p = 0.008) and winter (p<0.001). 36 (50%) of the 72 people with NF1 studied had BMD consistent with osteopenia, and 14 (19%) had BMD consistent with osteoporosis. High serum PTH concentration, high serum bone tartrate resistant acid phosphatase concentration, and high serum calcium concentration were associated with lower BMD among the NF1 patients. Males were more likely than females to have low BMD. The reported frequency of fractures in individuals with NF1 was much higher than in their unaffected siblings and spouses (p<0.001), and pathological fractures were reported only in NF1 patients. CONCLUSION: People with NF1 often have a generalised abnormality of bone metabolism. Further studies are needed to determine the biochemical and molecular basis of this abnormality.

Longitudinal study of neurofibromatosis 1 associated plexiform neurofibromas.

BACKGROUND: Plexiform neurofibromas are benign tumours that occur in more than half of people with neurofibromatosis 1 (NF1). These tumours can cause serious complications and can also progress to malignant peripheral nerve sheath tumours (MPNSTs), one of the leading causes of death among NF1 patients. Plexiform neurofibromas are clinically heterogeneous, and knowledge of their natural history is limited. In order to characterise the growth of plexiform neurofibromas better, we performed serial magnetic resonance imaging (MRI) in NF1 patients with such tumours. METHODS: MRI was done on 44 plexiform neurofibromas in 34 NF1 patients (median age 10 years; range 1-47 years). Each tumour was measured in two dimensions from the MRI scan, and the area and growth rate were calculated. The median length of follow-up was 6 years, with an average interval of 3 years between scans. RESULTS: 36 tumours remained stable in size throughout the period of follow-up. 8 tumours increased in size; all occurred in patients who were under 21 years of age when first studied. The single exception was a man who developed rapid tumour growth and pain in a plexiform neurofibroma that had been followed for 10 years. Biopsy showed the presence of an MPNST. CONCLUSION: Longitudinal MRI is a valuable means of monitoring the growth of plexiform neurofibromas in individuals with NF1.

Prevalence and effects of gene-gene and gene-nutrient interactions on serum folate and serum total homocysteine concentrations in the United States: findings from the third National Health and Nutrition Examination Survey DNA Bank.

BACKGROUND: Abnormalities of folate and homocysteine metabolism are associated with a number of pediatric and adult disorders. Folate intake and genetic polymorphisms encoding folate-metabolizing enzymes influence blood folate and homocysteine concentrations, but the effects and interactions of these factors have not been studied on a population-wide basis. OBJECTIVE: The objective was to assess the prevalence of these genetic polymorphisms and their relation to serum folate and homocysteine concentrations. DESIGN: DNA samples from 6793 participants in the third National Health and Nutrition Examination Survey (NHANES III) during 1991-1994 were genotyped for polymorphisms of genes coding for folate pathway enzymes 5,10-methylenetetrahydrofolate reductase (MTHFR) 677C-->T and 1298A-->C, methionine synthase reductase (MTRR) 66A-->G, and cystathionine-beta-synthase 844ins68. The influence of these genetic variants on serum folate and homocysteine concentrations was analyzed by age, sex, and folate intake in 3 race-ethnicity groups. RESULTS: For all race-ethnicity groups, serum folate and homocysteine concentrations were significantly related to the MTHFR 677C-->T genotype but not to the other polymorphisms. Persons with the MTHFR 677 TT genotype had a 22.1% (95% CI: 14.6%, 28.9%) lower serum folate and a 25.7% (95% CI: 18.6%, 33.2%) higher homocysteine concentration than did persons with the CC genotype. Moderate daily folic acid intake (mean: 150 microg/d; 95% CI: 138, 162) significantly reduced the difference in mean homocysteine concentrations between those with the MTHFR 677 CC and TT genotypes. We found a significant interaction between MTHFR 677C-->T and MTRR 66A-->G on serum homocysteine concentrations among non-Hispanic whites. CONCLUSIONS: The MTHFR 677C-->T polymorphism was associated with significant differences in serum folate and homocysteine concentrations in the US population before folic acid fortification. The effect of MTHFR 677C-->T on homocysteine concentrations was reduced by moderate daily folic acid intake.

Increased dental caries in people with neurofibromatosis 1.

Neurofibromatosis 1 (NF1) is an autosomal dominant disease that is associated with multiple café-au-lait spots and neurofibromas. Low bone mineral density is frequent in people with NF1, and focal bony abnormalities are characteristic but uncommon features. Dental abnormalities can occur in association with oral neurofibromas but have not otherwise been described in people with NF1. Questionnaires regarding dental caries were sent to families that included at least one individual with NF1. Siblings with NF1 reported significantly more dental caries (mean +/- SD, 8.1 +/- 6.6) than siblings without NF1 in these families (5.5 +/- 5.8, p = 0.019). Our findings suggest that dental caries occur more frequently than expected among people with NF1 and that individuals with this condition may require a modified dental care program.

Assessment of algorithms for high throughput detection of genomic copy number variation in oligonucleotide microarray data.

BACKGROUND: Genomic deletions and duplications are important in the pathogenesis of diseases, such as cancer and mental retardation, and have recently been shown to occur frequently in unaffected individuals as polymorphisms. Affymetrix GeneChip whole genome sampling analysis (WGSA) combined with 100 K single nucleotide polymorphism (SNP) genotyping arrays is one of several microarray-based approaches that are now being used to detect such structural genomic changes. The popularity of this technology and its associated open source data format have resulted in the development of an increasing number of software packages for the analysis of copy number changes using these SNP arrays. RESULTS: We evaluated four publicly available software packages for high throughput copy number analysis using synthetic and empirical 100 K SNP array data sets, the latter obtained from 107 mental retardation (MR) patients and their unaffected parents and siblings. We evaluated the software with regards to overall suitability for high-throughput 100 K SNP array data analysis, as well as effectiveness of normalization, scaling with various reference sets and feature extraction, as well as true and false positive rates of genomic copy number variant (CNV) detection. CONCLUSION: We observed considerable variation among the numbers and types of candidate CNVs detected by different analysis approaches, and found that multiple programs were needed to find all real aberrations in our test set. The frequency of false positive deletions was substantial, but could be greatly reduced by using the SNP genotype information to confirm loss of heterozygosity.

The use of anterolateral bowing of the lower leg in the diagnostic criteria for neurofibromatosis type 1.

Neurofibromatosis type 1 is diagnosed clinically based on the presence of two of seven criteria developed by a panel of experts in 1987. The sixth criterion focuses on skeletal findings and is as follows: "A distinctive osseous lesion such as sphenoid dysplasia or thinning of long bone cortex, with or without pseudarthrosis." The wording for this criterion is misleading. In particular, "thinning of long bone cortex" is not the characteristic radiographic presentation, and no mention of long bone bowing is included. The distinctive clinical feature of long bone dysplasia in neurofibromatosis type 1 is anterolateral bowing of the lower leg (portion of the body delimited by the knee and ankle). The usual radiographic findings of long bone dysplasia in neurofibromatosis type 1 at first presentation, prior to fracture, are anterolateral bowing with medullary canal narrowing and cortical thickening at the apex of the bowing. We suggest that anterolateral bowing of the lower leg, with or without fracture or pseudarthrosis, is a more appropriate description of the primary finding that a clinician will use to fulfill the sixth diagnostic criterion for neurofibromatosis type 1. Clarification of this diagnostic criterion is important for the clinician and for research protocols. Appropriate interpretation will improve understanding of the natural history and pathophysiology of neurofibromatosis type 1.

Associations of osseous abnormalities in Neurofibromatosis 1.

The characteristic sites of Neurofibromatosis 1-associated osseous manifestations are the long bones (usually the tibia and fibula), vertebrae and sphenoid wing. Although these focal bony lesions may cause profound clinical consequences, a minority of people with NF1 are affected. However, most people with NF1 are shorter than expected for their age, gender and family. The pathogenesis of NF1 focal osteopathy and its relationship, if any, to short stature are unknown. We examined associations between the occurrence of various osseous lesions in 3377 NF1 probands from the Children's Tumor Foundation NF International Database. Using logistic regression analysis among 260 NF1 probands who had undergone radiological examination of both the spine and skull, we found associations between the occurrence of sphenoid wing and long bone osteopathy (conditional odds ratio [OR] = 6.1; 95% confidence interval [CI] = 1.7-22.3; P = 0.006) and between sphenoid wing and vertebral osteopathy (OR = 16.9; 95% CI = 5.3-53.3; P < 0.001) after adjusting for age and gender. Similar findings were observed from all 3377 NF1 probands using a multivariate probit regression model. In a separate analysis, we found lower age- and gender-standardized height in patients who had characteristic vertebral or sphenoid wing lesions than in people who did not (P < 0.05). We found no relationship between height and tibial osteopathy. We conclude that some people with NF1 are more likely to develop osseous manifestations than others and speculate that there may be a common pathogenetic mechanism responsible for the development of osseous abnormalities and that of the vertebrae and long bones.

Race-ethnicity differences in folic acid intake in women of childbearing age in the United States after folic acid fortification: findings from the National Health and Nutrition Examination Survey, 2001-2002.

BACKGROUND: Neural tube defects are serious birth defects of the brain and spinal cord. Up to 70% of neural tube defects can be prevented by the consumption of folic acid by women before and early during pregnancy. OBJECTIVE: The objective was to examine folic acid intake in women of childbearing age in the United States. DESIGN: We analyzed nutrient intake data reported by 1685 nonpregnant women aged 15-49 y who participated in the National Health and Nutritional Examination Survey, 2001-2002. RESULTS: The adjusted geometric mean consumption of folic acid from fortified foods was 128 microg/d (95% CI: 123, 134 microg/d) in nonpregnant women. Eight percent (95% CI: 5.8%, 11.0%) of nonpregnant women reported consuming >or=400 microg folic acid/d from fortified foods. This proportion was lower among non-Hispanic black women (5.0%) than among non-Hispanic white (8.9%) or Hispanic (6.8%) women. A smaller percentage of non-Hispanic black (19.1%) and Hispanic (21%) women than of non-Hispanic white women (40.5%) consumed >or=400 microg folic acid from supplements, fortified foods, or both, in addition to food folate, as recommended by the Institute of Medicine to reduce the frequency of neural tube defects. CONCLUSIONS: Most nonpregnant women of childbearing age in the United States reported consuming less than the recommended amount of folic acid. The proportion with low daily folic acid intake was significantly higher in non-Hispanic black and Hispanic women than in non-Hispanic white women. At the present level of folic acid fortification, most women need to take a folic acid-containing dietary supplement to achieve the Institute of Medicine recommendation.

Vitamin D deficiency associated with number of neurofibromas in neurofibromatosis 1.

Neurofibromatosis 1 (NF1) is a tumour suppressor gene syndrome characterized by multiple cutaneous and plexiform neurofibromas. Focal osseous abnormalities, short stature, and decreased bone mineral density are also frequent in people with NF1. We measured serum 25-hydroxyvitamin D concentrations in 55 patients with NF1 and 58 healthy controls, and correlated the findings in the patients with NF1 with their estimated number of dermal neurofibromas. Geometric mean (SD) serum 25-hydroxyvitamin D concentration was 14.0 (1.6) ng/mL among the patients with NF1 compared with 31.4 (1.7) ng/mL among healthy controls (p<<0.0001). The serum vitamin D concentration and number of dermal neurofibromas reported by patients with NF1 were inversely correlated (Spearman's rho = -0.572, p<0.00001). The occurrence of low serum vitamin D concentrations in people with NF1, especially those with many dermal neurofibromas, may provide new pathogenic insights and have important therapeutic implications.

Increasing the specificity of diagnostic criteria for schwannomatosis.

Diagnostic criteria for schwannomatosis have been proposed in a recent consensus statement. These criteria permit schwannomatosis to be distinguished from neurofibromatosis type 2 (NF2) in most patients, but there is some clinical overlap between the two diseases. In this study, the authors use data from the population-based United Kingdom NF2 Registry to recommend modifications that increase the specificity of the schwannomatosis diagnostic criteria.

Analysis of NF1 transcriptional regulatory elements.

Mutations of the NF1 locus cause neurofibromatosis 1 (NF1), a clinically variable autosomal dominant disease. Expression of neurofibromin, the protein product of the NF1 gene, is regulated in a tissue- and developmentally-specific fashion, but the basis for this regulation is not understood. We used phylogenetic footprinting and other bioinformatic methods to identify potential transcriptional regulatory regions in the 5' upstream region and intron 1 of the NF1 gene from human, mouse, rat, and pufferfish. Three genomic segments that have equal or higher homology than the coding region were found in the NF1 5' upstream region, and four more very highly homologous regions were found in intron 1. Five of these highly homologous regions are confidently predicted to contain transcription factor binding sites. One highly homologous segment in the 5' upstream region spans the transcription start site and contains several potential transcription factor binding sites. This segment includes a novel 24-bp sequence (acttccggtggggtgtcatggcgg) that lies 310-333 bp upstream of the translation initiation site. This sequence, which is identical in human, mouse, and rat and differs by only 1-bp in Fugu, may contain the core promoter element for NF1 transcription.