RESUMO
In this paper, we investigate the structural and biological features of G-quadruplex (G4) aptamers as promising antiproliferative compounds affecting the STAT3 signalling pathway. Targeting the STAT3 protein through high-affinity ligands to reduce its levels or activity in cancer has noteworthy therapeutic potential. T40214 (STAT) [(G3C)4] is a G4 aptamer that can influence STAT3 biological outcomes in an efficient manner in several cancer cells. To explore the effects of an extra cytidine in second position and/or of single site-specific replacements of loop residues in generating aptamers that can affect the STAT3 biochemical pathway, a series of STAT and STATB [GCG2(CG3)3C] analogues containing a thymidine residue instead of cytidines was prepared. NMR, CD, UV, and PAGE data suggested that all derivatives adopt dimeric G4 structures like that of unmodified T40214 endowed with higher thermal stability, keeping the resistance in biological environments substantially unchanged, as shown by the nuclease stability assay. The antiproliferative activity of these ODNs was tested on both human prostate (DU145) and breast (MDA-MB-231) cancer cells. All derivatives showed similar antiproliferative activities on both cell lines, revealing a marked inhibition of proliferation, particularly at 72 h at 30 µM. Transcriptomic analysis aimed to evaluate STAT's and STATB's influence on the expression of many genes in MDA-MB-231 cells, suggested their potential involvement in STAT3 pathway modulation, and thus their interference in different biological processes. These data provide new tools to affect an interesting biochemical pathway and to develop novel anticancer and anti-inflammatory drugs.
Assuntos
Aptâmeros de Nucleotídeos , Quadruplex G , Neoplasias , Humanos , Masculino , Aptâmeros de Nucleotídeos/química , Linhagem Celular , Transdução de Sinais , Fator de Transcrição STAT3/metabolismo , FemininoRESUMO
In this paper, we study the biological properties of two TBA analogs containing one and two extra G-tetrads, namely TBAG3 and TBAG4, respectively, and two further derivatives in which one of the small loops at the bottom (TBAG41S) or the large loop at the top (TBAG4GS) of the TBAG4 structure has been completely modified by replacing all loop residues with abasic site mimics. The therapeutical development of the TBA was hindered by its low thermodynamic and nuclease stability, while its potential as an anticancer/antiproliferative molecule is also affected by the anticoagulant activity, being a side effect in this case. In order to obtain suitable TBA analogs and to explore the involvement of specific aptamer regions in biological activity, the antiproliferative capability against DU 145 and MDAMB 231 cancer cell lines (MTT), the anticoagulant properties (PT), the biological degradability (nuclease stability assay) and nucleolin (NCL) binding ability (SPR) of the above described TBA derivatives have been tested. Interestingly, none of the TBA analogs exhibits an anticoagulant activity, while all of them show antiproliferative properties to the same extent. Furthermore, TBAG4 displays extraordinary nuclease stability and promising antiproliferative properties against breast cancer cells binding NCL efficiently. These results expand the range of G4-structures targeting NCL and the possibility of developing novel anticancer and antiviral drugs.
Assuntos
Aptâmeros de Nucleotídeos , Quadruplex G , Neoplasias , Humanos , Aptâmeros de Nucleotídeos/química , Anticoagulantes/química , Trombina/metabolismoRESUMO
In this paper, we study the T30923 antiproliferative potential and the contribution of its loop residues in six different human cancer cell lines by preparing five T30923 variants using the single residue replacement approach of loop thymidine with an abasic site mimic (S). G-rich oligonucleotides (GRO) show interesting anticancer properties because of their capability to adopt G-quadruplex structures (G4s), such as the G4 HIV-1 integrase inhibitor T30923. Considering the multi-targeted effects of G4-aptamers and the limited number of cancer cell lines tested, particularly for T30923, it should be important to find a suitable tumor line, in addition to considering that the effects also strictly depend on G4s. CD, NMR and non-denaturating polyacrylamide gel electrophoresis data clearly show that all modified ODNs closely resemble the dimeric structure of parallel G4s' parent aptamer, keeping the resistance in biological environments substantially unchanged, as shown by nuclease stability assay. The antiproliferative effects of T30923 and its variants are tried in vitro by MTT assays, showing interesting cytotoxic activity, depending on time and dose, for all G4s, especially in MDA-MB-231 cells with a reduction in cell viability approximately up to 30%. Among all derivatives, QS12 results are the most promising, showing more pronounced cytotoxic effects both in MDA-MB-231 and Hela cells, with a decrease in cell viability from 70% to 60%. In summary, the single loop residue S substitution approach may be useful for designing antiproliferative G4s, considering that most of them, characterized by single residue loops, may be able to bind different targets in several cancer cell pathways. Generally, this approach could be of benefit by revealing some minimal functional structures, stimulating further studies aimed at the development of novel anticancer drugs.
Assuntos
Antineoplásicos , Aptâmeros de Nucleotídeos , Quadruplex G , Inibidores de Integrase de HIV , Neoplasias , Antineoplásicos/química , Aptâmeros de Nucleotídeos/química , Inibidores de Integrase de HIV/farmacologia , Células HeLa , Humanos , Neoplasias/tratamento farmacológico , TimidinaRESUMO
The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or ß-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.
Assuntos
DNA/química , Desoxiadenosinas/química , Quadruplex G , Oligonucleotídeos/química , Telômero , Catálise , Humanos , EstereoisomerismoRESUMO
In this paper, we report our investigations on five T30175 analogues, prepared by replacing sequence thymidines with abasic sites (S) one at a time, in comparison to their natural counterpart in order to evaluate their antiproliferative potential and the involvement of the residues not belonging to the central core of stacked guanosines in biological activity. The collected NMR (Nuclear Magnetic Resonance), CD (Circular Dichroism), and PAGE (Polyacrylamide Gel Electrophoresis) data strongly suggest that all of them adopt G-quadruplex (G4) structures strictly similar to that of the parent aptamer with the ability to fold into a dimeric structure composed of two identical G-quadruplexes, each characterized by parallel strands, three all-anti-G-tetrads and four one-thymidine loops (one bulge and three propeller loops). Furthermore, their antiproliferative (MTT assay) and anti-motility (wound healing assay) properties against lung and colorectal cancer cells were tested. Although all of the oligodeoxynucleotides (ODNs) investigated here exhibited anti-proliferative activity, the unmodified T30175 aptamer showed the greatest effect on cell growth, suggesting that both its characteristic folding in dimeric form and its presence in the sequence of all thymidines are crucial elements for antiproliferative activity. This straightforward approach is suitable for understanding the critical requirements of the G-quadruplex structures that affect antiproliferative potential and suggests its application as a starting point to facilitate the reasonable development of G-quadruplexes with improved anticancer properties.
Assuntos
Antineoplásicos/química , Aptâmeros de Nucleotídeos/química , Neoplasias Colorretais/genética , Neoplasias Pulmonares/genética , Timidina/genética , Substituição de Aminoácidos , Antineoplásicos/farmacologia , Aptâmeros de Nucleotídeos/genética , Aptâmeros de Nucleotídeos/farmacologia , Linhagem Celular Tumoral , Movimento Celular/efeitos dos fármacos , Proliferação de Células/efeitos dos fármacos , Dicroísmo Circular , Neoplasias Colorretais/tratamento farmacológico , Ensaios de Seleção de Medicamentos Antitumorais , Quadruplex G , Células HCT116 , Humanos , Neoplasias Pulmonares/tratamento farmacológico , Espectroscopia de Ressonância MagnéticaRESUMO
The thrombin binding aptamer (TBA) possesses promising antiproliferative properties. However, its development as an anticancer agent is drastically impaired by its concomitant anticoagulant activity. Therefore, suitable chemical modifications in the TBA sequence would be required in order to preserve its antiproliferative over anticoagulant activity. In this paper, we report structural investigations, based on circular dichroism (CD) and nuclear magnetic resonance spectroscopy (NMR), and biological evaluation of four pairs of enantiomeric heterochiral TBA analogues. The four TBA derivatives of the d-series are composed by d-residues except for one l-thymidine in the small TT loops, while their four enantiomers are composed by l-residues except for one d-thymidine in the same TT loop region. Apart from the left-handedness for the l-series TBA derivatives, CD and NMR measurements have shown that all TBA analogues are able to adopt the antiparallel, monomolecular, 'chair-like' G-quadruplex structure characteristic of the natural D-TBA. However, although all eight TBA derivatives are endowed with remarkable cytotoxic activities against colon and lung cancer cell lines, only TBA derivatives of the l-series show no anticoagulant activity and are considerably resistant in biological environments.
Assuntos
Aptâmeros de Nucleotídeos/genética , Quadruplex G , Ligação Proteica/genética , Trombina/genética , Anticoagulantes/química , Anticoagulantes/uso terapêutico , Dicroísmo Circular , Humanos , Espectroscopia de Ressonância Magnética , Estereoisomerismo , Timidina/genéticaRESUMO
The antiproliferative G-quadruplex aptamers are a promising and challenging subject in the framework of the anticancer therapeutic oligonucleotides research field. Although several antiproliferative G-quadruplex aptamers have been identified and proven to be effective on different cancer cell lines, their mechanism of action is still unexplored. We have recently described the antiproliferative activity of a heterochiral thrombin binding aptamer (TBA) derivative, namely, LQ1. Here, we investigate the molecular mechanisms of LQ1 activity and the structural and antiproliferative properties of two further TBA derivatives, differing from LQ1 only by the small loop base-compositions. We demonstrate that in p53 deleted colon cancer cells, LQ1 causes nucleolar stress, impairs ribosomal RNA processing, leading to the accumulation of pre-ribosomal RNAs, arrests cells in the G2/M phase and induces early apoptosis. Importantly, the depletion of uL3 abrogates all these effects, indicating that uL3 is a crucial player in the mechanism of action of LQ1. Taken together, our findings identify p53-independent and uL3-dependent nucleolar stress as a novel stress response pathway activated by a specific G-quadruplex TBA derivative. To the best of our knowledge, this investigation reveals, for the first time, the involvement of the nucleolar stress pathway in the mechanism of action of antiproliferative G-quadruplex aptamers.
Assuntos
Aptâmeros de Nucleotídeos/farmacologia , Nucléolo Celular/metabolismo , Neoplasias do Colo/metabolismo , Neoplasias do Colo/patologia , Quadruplex G , Proteínas Ribossômicas/metabolismo , Estresse Fisiológico , Apoptose/efeitos dos fármacos , Aptâmeros de Nucleotídeos/química , Ciclo Celular/efeitos dos fármacos , Morte Celular/efeitos dos fármacos , Linhagem Celular Tumoral , Nucléolo Celular/efeitos dos fármacos , Proliferação de Células/efeitos dos fármacos , Humanos , Processamento Pós-Transcricional do RNA/efeitos dos fármacos , RNA Ribossômico/genética , Proteína Ribossômica L3 , Estresse Fisiológico/efeitos dos fármacosRESUMO
In this paper, we report studies concerning thrombin binding aptamer (TBA) dimeric derivatives in which the 3'-ends of two TBA sequences have been joined by means of linkers containing adenosine or thymidine residues and/or a glycerol moiety. CD and electrophoretic investigations indicate that all modified aptamers are able to form G-quadruplex domains resembling that of the parent TBA structure. However, isothermal titration calorimetry measurements of the aptamer/thrombin interaction point to different affinities to the target protein, depending on the type of linker. Consistently, the best ligands for thrombin show anticoagulant activities higher than TBA. Interestingly, two dimeric aptamers with the most promising properties also show far higher resistances in biological environment than TBA.
Assuntos
Antitrombinas/química , Aptâmeros de Nucleotídeos/química , Quadruplex G , Trombina/química , Ligantes , Modelos Moleculares , Ligação ProteicaRESUMO
miR-125b, ubiquitously expressed and frequently dysregulated in several tumors, has gained special interest in the field of cancer research, displaying either oncogenic or oncosuppressor potential based on tumor type. We have previously demonstrated its tumor-suppressive role in multiple myeloma (MM), but the analysis of molecular mechanisms needs additional investigation. The purpose of this study was to explore the effects of miR-125b and its chemically modified analogs in modulating cell viability and cancer-associated molecular pathways, also focusing on the functional aspects of stress adaptation (autophagy and senescence), as well as programmed cell death (apoptosis). Based on the well-known low microRNA (miRNA) stability in therapeutic application, we designed chemically modified miR-125b mimics, laying the bases for their subsequent investigation in in vivo models. Our study clearly confirmed an oncosuppressive function depending on the repression of multiple targets, and it allowed the identification, for the first time, of miR-125b-dependent miR-34a stimulation as a possible consequence of the inhibitory role on the interleukin-6 receptor (IL-6R)/signal transducer and activator of transcription 3 (STAT3)/miR-34a feedback loop. Moreover, we identified a pattern of miR-125b-co-regulated miRNAs, shedding light on possible new players of anti-MM activity. Finally, functional studies also revealed a sequential activation of senescence, autophagy, and apoptosis, thus indicating, for the first two processes, an early cytoprotective and inhibitory role from apoptosis activation.
RESUMO
Loss of telomeres stability is a hallmark of cancer cells. Exposed telomeres are prone to aberrant end-joining reactions leading to chromosomal fusions and translocations. Human telomeres contain repeated TTAGGG elements, in which the 3' exposed strand may adopt a G-quadruplex (G4) structure. The guanine-rich regions of telomeres are hotspots for oxidation forming 8-oxoguanine, a lesion that is handled by the base excision repair (BER) pathway. One key player of this pathway is Ape1, the main human endonuclease processing abasic sites. Recent evidences showed an important role for Ape1 in telomeric physiology, but the molecular details regulating Ape1 enzymatic activities on G4-telomeric sequences are lacking. Through a combination of in vitro assays, we demonstrate that Ape1 can bind and process different G4 structures and that this interaction involves specific acetylatable lysine residues (i.e. K27/31/32/35) present in the unstructured N-terminal sequence of the protein. The cleavage of an abasic site located in a G4 structure by Ape1 depends on the DNA conformation or the position of the lesion and on electrostatic interactions between the protein and the nucleic acids. Moreover, Ape1 mutants mimicking the acetylated protein display increased cleavage activity for abasic sites. We found that nucleophosmin (NPM1), which binds the N-terminal sequence of Ape1, plays a role in modulating telomere length and Ape1 activity at abasic G4 structures. Thus, the Ape1 N-terminal sequence is an important relay site for regulating the enzyme's activity on G4-telomeric sequences, and specific acetylatable lysine residues constitute key regulatory sites of Ape1 enzymatic activity dynamics at telomeres.
Assuntos
DNA Liase (Sítios Apurínicos ou Apirimidínicos)/química , DNA Liase (Sítios Apurínicos ou Apirimidínicos)/metabolismo , Quadruplex G , Lisina/metabolismo , Telômero/química , Telômero/metabolismo , Acetilação , Linhagem Celular Tumoral , Humanos , Nucleofosmina , Concentração OsmolarRESUMO
BACKGROUND: Although the thrombin binding aptamer (TBA) is endowed with both anticoagulant and antiproliferative properties, it is possible to reduce the first and enhance the second one by suitable chemical modifications. METHODS: Two oligonucleotides (TBA353 and TBA535) based on the TBA sequence (GGTTGGTGTGGTTGG) and containing inversion of polarity sites have been investigated by CD, UV and electrophoretic techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay), antiproliferative (MTT assay) and anti-motility (wound healing assay) properties against Calu-6 cells have been tested and compared with TBA. RESULTS: CD, UV and electrophoresis data indicate that both ODNs are able to form G-quadruplex structures. Particularly, results suggest that TBA535 adopts a G-quadruplex structure characterized by a loop arrangement different from that of TBA. Both TBA analogues drop the anticoagulant activity. However, TBA535 is endowed with a significant antiproliferative activity against lung cancer Calu-6 cells. Importantly, both TBA and TBA535 possess a remarkable anti-motility property against the same cell line. CONCLUSIONS: Both TBA analogues TBA353 and TBA535 are able to form G-quadruplex structures with no anticoagulant activity. However only TBA535 is endowed with noteworthy antiproliferative and anti-motility properties against lung cancer Calu-6 cells. GENERAL SIGNIFICANCE: The switching from the anticoagulant to antiproliferative property can be obtained also in TBA derivatives not adopting the "chair-like" G-quadruplex structure typical of TBA. Furthermore, results have highlighted an unprecedented anti-cell-motility property of TBA and TBA535 reinforcing the potential of these ODNs as anticancer drugs.
Assuntos
Aptâmeros de Nucleotídeos/metabolismo , Movimento Celular/efeitos dos fármacos , Proliferação de Células/efeitos dos fármacos , Antineoplásicos/química , Antineoplásicos/metabolismo , Antineoplásicos/farmacologia , Linhagem Celular Tumoral , Dicroísmo Circular , Eletroforese em Gel de Poliacrilamida , Quadruplex G , Humanos , Espectroscopia de Ressonância Magnética , Estrutura Molecular , Ligação Proteica , Espectrofotometria Ultravioleta , Difração de Raios XRESUMO
Genetic modifications during development of paediatric groups 3 and 4 medulloblastoma are responsible for their highly metastatic properties and poor patient survival rates. PRUNE1 is highly expressed in metastatic medulloblastoma group 3, which is characterized by TGF-ß signalling activation, c-MYC amplification, and OTX2 expression. We describe the process of activation of the PRUNE1 signalling pathway that includes its binding to NME1, TGF-ß activation, OTX2 upregulation, SNAIL (SNAI1) upregulation, and PTEN inhibition. The newly identified small molecule pyrimido-pyrimidine derivative AA7.1 enhances PRUNE1 degradation, inhibits this activation network, and augments PTEN expression. Both AA7.1 and a competitive permeable peptide that impairs PRUNE1/NME1 complex formation, impair tumour growth and metastatic dissemination in orthotopic xenograft models with a metastatic medulloblastoma group 3 cell line (D425-Med cells). Using whole exome sequencing technology in metastatic medulloblastoma primary tumour cells, we also define 23 common 'non-synonymous homozygous' deleterious gene variants as part of the protein molecular network of relevance for metastatic processes. This PRUNE1/TGF-ß/OTX2/PTEN axis, together with the medulloblastoma-driver mutations, is of relevance for future rational and targeted therapies for metastatic medulloblastoma group 3.10.1093/brain/awy039_video1awy039media15742053534001.
Assuntos
Proteínas de Transporte/metabolismo , Neoplasias Cerebelares/metabolismo , Regulação Neoplásica da Expressão Gênica/fisiologia , Meduloblastoma/metabolismo , Metástase Neoplásica/fisiopatologia , PTEN Fosfo-Hidrolase/metabolismo , Adolescente , Animais , Proteínas de Transporte/genética , Linhagem Celular Tumoral , Movimento Celular/efeitos dos fármacos , Proliferação de Células/efeitos dos fármacos , Neoplasias Cerebelares/patologia , Criança , Pré-Escolar , Feminino , Regulação Neoplásica da Expressão Gênica/efeitos dos fármacos , Redes Reguladoras de Genes , Humanos , Lactente , Masculino , Meduloblastoma/patologia , Camundongos , Camundongos Endogâmicos BALB C , Modelos Moleculares , Metástase Neoplásica/genética , PTEN Fosfo-Hidrolase/genética , Monoéster Fosfórico Hidrolases , Pirimidinonas/química , Pirimidinonas/farmacologia , Transdução de Sinais/efeitos dos fármacos , Transdução de Sinais/genética , Fatores de Transcrição da Família Snail/metabolismo , Fator de Crescimento Transformador beta/metabolismoRESUMO
BACKGROUND: The thrombin binding aptamer (TBA) is endowed with both anticoagulant and antiproliferative activities. Its chemico-physical and/or biological properties can be tuned by the site-specific replacement of selected residues. METHODS: Four oligodeoxynucleotides (ODNs) based on the TBA sequence (5'-GGTTGGTGTGGTTGG-3') and containing 2'-deoxyuridine (U) or 5-bromo-2'-deoxyuridine (B) residues at positions 4 or 13 have been investigated by NMR and CD techniques. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay) have been tested and compared with two further ODNs containing 5-hydroxymethyl-2'-deoxyuridine (H) residues in the same positions, previously investigated. RESULTS: The CD and NMR data suggest that all the investigated ODNs are able to form G-quadruplexes strictly resembling that of TBA. The introduction of B residues in positions 4 or 13 increases the melting temperature of the modified aptamers by 7⯰C. The replacement of thymidines with U in the same positions results in an enhanced anticoagulant activity compared to TBA, also at low ODN concentration. Although all ODNs show antiproliferative properties, only TBA derivatives containing H in the positions 4 and 13 lose the anticoagulant activity and remarkably preserve the antiproliferative one. CONCLUSIONS: All ODNs have shown antiproliferative activities against two cancer cell lines but only those with U and B are endowed with anticoagulant activities similar or improved compared to TBA. GENERAL SIGNIFICANCE: The appropriate site-specific replacement of the residues in the TT loops of TBA with commercially available thymine analogues is a useful strategy either to improve the anticoagulant activity or to preserve the antiproliferative properties by quenching the anticoagulant ones.
Assuntos
Anticoagulantes/farmacologia , Antineoplásicos/farmacologia , Aptâmeros de Nucleotídeos/farmacologia , Anticoagulantes/síntese química , Anticoagulantes/metabolismo , Antineoplásicos/síntese química , Antineoplásicos/metabolismo , Aptâmeros de Nucleotídeos/síntese química , Aptâmeros de Nucleotídeos/genética , Aptâmeros de Nucleotídeos/metabolismo , Linhagem Celular Tumoral , Dicroísmo Circular , Estabilidade de Medicamentos , Quadruplex G , Humanos , Temperatura de TransiçãoRESUMO
In this paper, we report investigations, based on circular dichroism, nuclear magnetic resonance spectroscopy and electrophoresis methods, on three oligonucleotide sequences, each containing one 3'-3' and two 5'-5' inversion of polarity sites, and four G-runs with a variable number of residues, namely two, three and four (mTG2T, mTG3T and mTG4T with sequence 3'-TGnT-5'-5'-TGnT-3'-3'-TGnT-5'-5'-TGnT-3' in which n = 2, 3 and 4, respectively), in comparison with their canonical counterparts (TGnT)4 (n = 2, 3 and 4). Oligonucleotides mTG3T and mTG4T have been proven to form very stable unprecedented monomolecular parallel G-quadruplex structures, characterized by three side loops containing the inversion of polarity sites. Both G-quadruplexes have shown an all-syn G-tetrad, while the other guanosines adopt anti glycosidic conformations. All oligonucleotides investigated have shown a noteworthy antiproliferative activity against lung cancer cell line Calu 6 and colorectal cancer cell line HCT-116 p53-/-. Interestingly, mTG3T and mTG4T have proven to be mostly resistant to nucleases in a fetal bovine serum assay. The whole of the data suggest the involvement of specific pathways and targets for the biological activity.
Assuntos
Quadruplex G , Conformação de Ácido Nucleico , Desnaturação de Ácido Nucleico , Oligonucleotídeos/química , Linhagem Celular , Linhagem Celular Tumoral , Proliferação de Células/efeitos dos fármacos , Sobrevivência Celular/efeitos dos fármacos , Dicroísmo Circular , Eletroforese em Gel de Poliacrilamida , Células HCT116 , Humanos , Espectroscopia de Ressonância Magnética , Oligonucleotídeos/genética , Oligonucleotídeos/farmacologia , TemperaturaRESUMO
BACKGROUND: The thrombin binding aptamer (TBA) is endowed with antiproliferative properties but its potential development is counteracted by the concomitant anticoagulant activity. METHODS: Five oligonucleotides (ODNs) based on TBA sequence (GGTTGGTGTGGTTGG) and containing l-residues or both l-residues and inversion of polarity sites have been investigated by NMR and CD techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay), and their resistance in fetal bovine serum have been tested. RESULTS: CD and NMR data suggest that the investigated ODNs are able to form right- and left-handed G-quadruplex structures. All ODNs do not retain the anticoagulant activity characteristic of TBA but are endowed with a significant antiproliferative activity against two cancerous cell lines. Their resistance in biological environment after six days is variable, depending on the ODN. CONCLUSIONS: A comparison between results and literature data suggests that the antiproliferative activity of the TBA analogues investigated could depends on two factors: a) biological pathways and targets different from those already identified or proposed for other antiproliferative G-quadruplex aptamers, and b) the contribution of the guanine-based degradation products. GENERAL SIGNIFICANCE: Modified TBA analogues containing l-residues and inversion of polarity sites lose the anticoagulant activity but gain antiproliferative properties against two cancer cell lines. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio.
Assuntos
Antineoplásicos/farmacologia , Aptâmeros de Nucleotídeos/farmacologia , Proliferação de Células/efeitos dos fármacos , Neoplasias/tratamento farmacológico , Trombina/farmacologia , Anticoagulantes/química , Anticoagulantes/metabolismo , Anticoagulantes/farmacologia , Antineoplásicos/química , Antineoplásicos/metabolismo , Aptâmeros de Nucleotídeos/química , Aptâmeros de Nucleotídeos/metabolismo , Sequência de Bases , Coagulação Sanguínea/efeitos dos fármacos , Dicroísmo Circular , Estabilidade de Medicamentos , Esterases/química , Quadruplex G , Células HCT116 , Humanos , Espectroscopia de Ressonância Magnética , Modelos Moleculares , Neoplasias/patologia , Ligação Proteica , Relação Estrutura-Atividade , Trombina/análogos & derivados , Trombina/química , Trombina/metabolismo , Fatores de TempoRESUMO
Many antiproliferative G-quadruplexes (G4s) arise from the folding of GT-rich strands. Among these, the Thrombin Binding Aptamer (TBA), as a rare example, adopts a monomolecular well-defined G4 structure. Nevertheless, the potential anticancer properties of TBA are severely hampered by its anticoagulant action and, consequently, no related studies have appeared so far in the literature. We wish to report here that suitable chemical modifications in the TBA sequence can preserve its antiproliferative over anticoagulant activity. Particularly, we replaced one residue of the TT or TGT loops with a dibenzyl linker to develop seven new quadruplex-forming TBA based sequences (TBA-bs), which were studied for their structural (CD, CD melting, 1D NMR) and biological (fibrinogen, PT and MTT assays) properties. The three-dimensional structures of the TBA-bs modified at T13 (TBA-bs13) or T12 (TBA-bs12), the former endowed with selective antiproliferative activity, and the latter acting as potently as TBA in both coagulation and MTT assays, were further studied by 2D NMR restrained molecular mechanics. The comparative structural analyses indicated that neither the stability, nor the topology of the G4s, but the different localization of the two benzene rings of the linker was responsible for the loss of the antithrombin activity for TBA-bs13.
Assuntos
Anticoagulantes/química , Antineoplásicos/química , Aptâmeros de Nucleotídeos/química , Anticoagulantes/farmacologia , Antineoplásicos/farmacologia , Aptâmeros de Nucleotídeos/farmacologia , Compostos de Benzil/química , Testes de Coagulação Sanguínea , Proliferação de Células/efeitos dos fármacos , Fibrinogênio , Quadruplex G , Células HeLa , Humanos , Modelos Moleculares , Desnaturação de Ácido Nucleico , Oligonucleotídeos/síntese química , Tempo de ProtrombinaRESUMO
Bracken fern (Pteridium aquilinum) is a worldwide plant containing toxic substances, which represent an important chemical hazard for animals, including humans. Ptaquiloside, 1, a norsesquiterpenoid glucoside, is the major carcinogen of bracken detected in the food chain, particularly in the milk from farm animals. To date, ptaquiloside has been shown in the milk of cows feeding on a diet containing bracken fern. This is the first study that shows the systematic detection of ptaquiloside, 1, and reports its direct quantitation in pooled raw milk of healthy sheep and goats grazing on bracken. Ptaquiloside, 1, was detected by a sensitive method based on the chemical conversion of ptaquiloside, 1, into bromopterosine, 4, following gas chromatography-mass spectrometry (GC-MS) analysis. The presence of ptaquiloside, 1, possibly carcinogenic to humans, in the milk of healthy animals is an unknown potential health risk, thus representing a harmful and potential global concern of food safety.
Assuntos
Cabras/metabolismo , Indanos/análise , Leite/química , Pteridium/metabolismo , Sesquiterpenos/análise , Ovinos/metabolismo , Animais , Carcinógenos/análise , Inocuidade dos Alimentos , Indanos/metabolismo , Pteridium/química , Sesquiterpenos/metabolismoRESUMO
Stable nucleic acid lipid vesicles (SNALPs) encapsulating miR-34a to treat multiple myeloma (MM) were developed. Wild type or completely 2'-O-methylated (OMet) MiR-34a was used in this study. Moreover, SNALPs were conjugated with transferrin (Tf) in order to target MM cells overexpressing transferrin receptors (TfRs). The type of miR-34a chemical backbone did not significantly affect the characteristics of SNALPs in terms of mean size, polydispersity index, and zeta potential, while the encapsulation of an OMet miR-34a resulted in a significant increase of miRNA encapsulation into the SNALPs. On the other hand, the chemical conjugation of SNALPs with Tf resulted in a significant decrease of the zeta potential, while size characteristics and miR-34a encapsulation into SNALPs were not significantly affected. In an experimental model of MM, all the animals treated with SNALPs encapsulating miR-34a showed a significant inhibition of the tumor growth. However, the use of SNALPs conjugated with Tf and encapsulating OMet miR-34a resulted in the highest increase of mice survival. These results may represent the proof of concept for the use of SNALPs encapsulating miR-34a for the treatment of MM.
Assuntos
Lipídeos/química , MicroRNAs/metabolismo , Mieloma Múltiplo/terapia , Ácidos Nucleicos/química , Transferrina/metabolismo , Lipossomas Unilamelares/química , Animais , Proliferação de Células , Citometria de Fluxo , Humanos , Masculino , Metilação , Camundongos SCID , Tamanho da Partícula , Receptores da Transferrina/metabolismo , Eletricidade EstáticaRESUMO
MicroRNA (miR)-199b-5p has been shown to regulate Hes-1, a downstream effector of the canonical Notch and noncanonical SHH pathways, whereby it impairs medulloblastoma (MB) cancer stem cells (CSCs) through a decrease in the CD133+/CD15+ cell population. Here, we have developed stable nucleic acid lipid particles (SNALPs) that encapsulate miR-199b-5p. The efficacy of the miR-199b-5p delivery by these SNALPs is demonstrated by significant impairment of Hes-1 levels and CSC markers in a range of different tumorigenic cell lines: colon (HT-29, CaCo-2, and SW480), breast (MDA-MB231T and MCF-7), prostate (PC-3), glioblastoma (U-87), and MB (Daoy, ONS-76, and UW-228). After treatment with SNALP miR-199b-5p, there is also impairment of cell proliferation and no signs of apoptosis, as measured by caspases 3/7 activity and annexin V fluorescence cell sorter analyses. These data strengthen the importance of such carriers for miRNA delivery, which show no cytotoxic effects and provide optimal uptake into cells. Thus, efficient target downregulation in different tumorigenic cell lines will be the basis for future preclinical studies.
Assuntos
Lipídeos/química , MicroRNAs/administração & dosagem , Apoptose , Caspase 3/metabolismo , Caspase 7/metabolismo , Linhagem Celular Tumoral , Proliferação de Células , Células HEK293 , Humanos , Lipossomos , MicroRNAs/químicaRESUMO
The human (h)-prune protein is a member of the DHH protein superfamily and it has a cAMP phosphodiesterase activity. Its overexpression in breast, colorectal and gastric cancers correlates with depth of invasion and a high degree of lymph-node metastasis. One mechanism by which h-prune stimulates cell motility and metastasis processes is through its phosphodiesterase activity, which can be suppressed by dipyridamole, a pyrimido[5,4-d]pyrimidine analogue. To obtain new and more potent agents that have high specificity towards inhibition of this h-prune activity, we followed structure-activity-relationship methodologies starting from dipyridamole and synthesised eight new pyrimido-pyrimidine derivatives. We analysed these newly generated compounds for specificity towards h-prune activities in vitro in cellular models using scintillation proximity assay for cAMP-PDE activity, cell index in cell proliferation assays and transwell methodology for two-dimensional cell migration in a top-down strategy of selection. Our findings show that two pyrimido[5,4-d]pyrimidine compounds are more effective than dipyridamole in two highly metastatic cellular models of breast cancer in vitro. Future studies will assess their therapeutic effectiveness against breast and other cancers where there is over-expression of h-prune, and in ad-hoc, proof of concept, animal models.