Offset-sparsity decomposition for automated enhancement of color microscopic image of stained specimen in histopathology.

We propose an offset-sparsity decomposition method for the enhancement of a color microscopic image of a stained specimen. The method decomposes vectorized spectral images into offset terms and sparse terms. A sparse term represents an enhanced image, and an offset term represents a "shadow." The related optimization problem is solved by computational improvement of the accelerated proximal gradient method used initially to solve the related rank-sparsity decomposition problem. Removal of an image-adapted color offset yields an enhanced image with improved colorimetric differences among the histological structures. This is verified by a no-reference colorfulness measure estimated from 35 specimens of the human liver, 1 specimen of the mouse liver stained with hematoxylin and eosin, 6 specimens of the mouse liver stained with Sudan III, and 3 specimens of the human liver stained with the anti-CD34 monoclonal antibody. The colorimetric difference improves on average by 43.86% with a 99% confidence interval (CI) of [35.35%, 51.62%]. Furthermore, according to the mean opinion score, estimated on the basis of the evaluations of five pathologists, images enhanced by the proposed method exhibit an average quality improvement of 16.60% with a 99% CI of [10.46%, 22.73%].

Unsupervised segmentation of low-contrast multichannel images: discrimination of tissue components in microscopic images of unstained specimens.

Low-contrast images, such as color microscopic images of unstained histological specimens, are composed of objects with highly correlated spectral profiles. Such images are very hard to segment. Here, we present a method that nonlinearly maps low-contrast color image into an image with an increased number of non-physical channels and a decreased correlation between spectral profiles. The method is a proof-of-concept validated on the unsupervised segmentation of color images of unstained specimens, in which case the tissue components appear colorless when viewed under the light microscope. Specimens of human hepatocellular carcinoma, human liver with metastasis from colon and gastric cancer and mouse fatty liver were used for validation. The average correlation between the spectral profiles of the tissue components was greater than 0.9985, and the worst case correlation was greater than 0.9997. The proposed method can potentially be applied to the segmentation of low-contrast multichannel images with high spatial resolution that arise in other imaging modalities.

Genetic evaluation of the TNF-α -238G>A and -308G>A promoter polymorphisms in Croatian patients with type I diabetes.

A case-control study was performed to establish a potential association of two TNF-α gene promoter SNPs (-238G>A and -308G>A) with occurrence of type 1 Diabetes mellitus (T1DM) in Croatian population (174 patients and 193 healthy controls). Genotypes (obtained by polymerase chain reaction-restriction fragment length polymorphism), and the clinical parameters of T1DM patients were statistically evaluated by SPSS 13 and Arlequin software, G*Power 3.0.10 program, and calculator for Hardy-Weinberg equilibrium. The frequency of the risk (A) allele, as well as the distribution of high-expression (GA, AA) genotypes were significantly higher (p < 0.0001) in T1DM patients only at locus -308. The distribution of the -238G/-308A haplotype was also significantly higher in patients compared with controls (27.6% vs 9.6%, p < 0.0001). Gender-dependent analysis revealed that female T1DM -308GA genotype carriers exhibit considerably stronger association with T1DM (odds ratio = 6.37, 95% confidence interval = 3.16-12.85) than male -308GA patients (odds ratio = 2.71, 95% confidence interval = 1.31-5.59). Clinical parameter analysis of T1DM patients revealed significantly decreased level of hemoglobin A(1)c (HbA(1)c) in -238A allele carriers compared with -238G allele carriers (6.55% vs 7.17%, p = 0.022), as well as the tendency of the risk allele carriers at -238 or -308 locus to develop T1DM earlier in life compared with non-risk allele carriers. In conclusion, susceptibility to T1DM in the Croatian population is strongly associated with the TNF-α -308G>A polymorphism, especially in women. In addition, significantly lower HbA(1c) levels found in T1DM -238A allele carriers might indicate better glycemic control in these patients.

K-ras and Dpc4 mutations in chronic pancreatitis: case series.

AIM: To assess whether alterations in the K-ras, p53, and DPC4 genes are present in pancreatitis, a potential precancerous condition that can progress to pancreatic adenocarcinoma. To investigate the alterations occurring at hot spots of K-ras (exon 1), p53 (exons 5 and 7), and DPC4 (exons 8, 10 and 11). METHODS: In 10 patients with acute and 22 with chronic pancreatitis, without pancreatic intraepithelial neoplasia (PanIN), DNA was isolated from paraffin embedded tissue samples. The extracted DNA was analyzed by polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP) analysis, single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. RESULTS: In acute pancreatitis samples no mutations were found in any of the investigated genes. In 7 out of 22 samples of chronic pancreatitis nucleotide substitution at exon 1 of K-ras (five at codon 12 and two at codon 13) were found. No mutations in p53 (exons 5 and 7) were detected. Two samples had nucleotide substitutions at exons 8 and 11 of DPC4, introducing STOP signal and change in the amino acid sequence, respectively. One chronic pancreatitis sample displayed simultaneous mutations in K-ras (exon 1, codon 12) and DPC4 (exon 8, codon 358). CONCLUSION: Mutations of K-ras and Dpc4 genes can accumulate already in non-malignant, inflammatory pancreatic tissue, suggesting its applicability in monitoring of further destruction of pancreatic tissue and progression into malignancy.

Infrequent alteration of the DPC4 tumor suppressor gene in renal cell carcinoma.

The aim of this study was to investigate the alterations in the DPC4 tumor suppressor gene in renal cell carcinoma (RCC). The study included 32 tumor specimens from Croatian patients with a diagnosis of RCC. Loss of heterozygosity (LOH) was investigated using three specific oligonucleotide primers for the three DPC4 polymorphic markers. Our investigation of mutations in the DPC4 gene was focused on exons 2, 8, 10 and 11. These exons belong to the mad homology domains 1 (exon 2) and 2 (exons 8-11). The presence of previously documented mutation in exons 2 (codon 100), 8 (codon 358), 10 (codon 412), and 11 (codon 493) was investigated by restriction fragment length polymorphism (RFLP) analysis, as a first screening method. Finally, the study was extended to search for any other type of mutation in the four selected exons by single strand conformation polymorphism (SSCP) assay. To increase heterozygosity, all 32 tumor specimens were tested with primers for three polymorphic markers. A total of 30 (94%) were heterozygous (informative). LOH at any of these markers was only revealed in four (13%) of the 30 informative samples. No tumor samples were positive for mutation in the four investigated exons analyzed by RFLP. In addition, no samples showed other types of mutation in denaturing conditions. Genetic alterations were shown only in a minority of patients, probably because mutation analysis of the DPC4 gene has only been partially covered by our work. It seems that exon 2 (belonging to the MH1 domain) and exons 8, 10, 11 (belonging to the MH2 domain) are not altered in RCC. This investigation must be extended on other exons of DPC4 for a better understanding a role of this gene in renal cell carcinoma.

Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation.

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.

Differing effects of two iron compounds on experimental arthritis, TNF-alpha levels and immune response in mice.

The effects of ferric-sorbitol-citrate and ferric-citrate on the severity of experimental arthritis, TNF-alpha secretion and the immune status were examined in mice. Arthritis was induced by footpad injection of methylated BSA and intraperitoneal injection of Bordetella pertussis. Joint and footpad swelling were measured weekly by a caliper. TNF-alpha serum levels were measured by ELISA. The immune status was determined by the response of mouse lymphocytes to ConA in vitro and by the antigen-presenting cell assay. Experimental arthritis was aggravated by ferric-citrate, whereas ferric-sorbitol-citrate did not promote it. If applied to normal (non-arthritic) mice three times a week for 4 weeks, ferric-sorbitol-citrate stimulated isolated splenocytes to increase production of TNF-alpha, the function of antigen-presenting cells and lymphocyte proliferation in response to ConA in vitro. TNF-alpha production by cultured splenocytes was also stimulated. In mice with antigen-induced arthritis, iron compounds did not additionally stimulate TNF-alpha production. Thus, we have shown that ferric-sorbitol-citrate stimulated TNF-alpha production, antigen-presenting cell activity and cellular immune response. Development of antigen-induced arthritis and TNF-alpha production in arthritic mice were not stimulated.

Amylin-induced cytotoxicity is associated with activation of caspase-3 and MAP kinases.

Nanomolar concentrations of human amylin promote death of RINm5F cells in a time- and concentrationdependent manner. Morphological changes of chromatin integrity suggest that cells are predominantly undergoing apoptosis. Human amylin induces significant activation of caspase-3 and strong and sustained phosphorylation of stress-activated protein kinases, c-Jun N-terminal kinase (JNK) and p38, that precedes cell death. Extracellular signal-regulated kinase (ERK) activation was not concomitant with JNK and/or p38 activation. Activation of caspase-3 and mitogen-activated protein kinases (MAPKs) was detected by Western blot analysis. Addition of the MEK1 inhibitor PD 98059 had no effect on amylin-induced apoptosis, suggesting that ERK activation does not play a role in this apoptotic scenario. A correlative inhibition of JNK activation by the immunosuppressive drug FK506, as well as a selective inhibition of p38 MAPK activation by SB 203580, significantly suppressed procaspase-3 processing and the extent of amylin-induced cell death. Moreover, simultaneous pretreatment with both FK506 and SB 203580, or with the caspase-3 inhibitor Ac-DEVD-CHO alone, almost completely abolished procaspase-3 processing and cell death. Thus, our results suggest that amylin-induced apoptosis proceeds through sustained activation of JNK and p38 MAPK followed by caspase-3 activation.