Nitrile Substituents at the Conjugated Dipyridophenazine Moiety as Infrared Redox Markers in Electrochemically Reduced Heteroleptic Ru(II) Polypyridyl Complexes.

Ruthenium(II) complexes [Ru(tap)2(NN)]2+ (tap = 1,4,5,8-tetraazaphenanthrene, NN = 11-cyano-dipyrido[3,2-a:2',3'-c]phenazine (11-CN-dppz) and 11,12-dicyano-dipyrido[3,2-a:2',3'-c]phenazine (11,12-CN-dppz)) feature the C≡N groups as infrared (IR)-active redox markers. They were studied by cyclic voltammetry, UV-vis, and IR spectroelectrochemistry (SEC), and density functional theory calculations to assign the four 1e- reduction waves R1-R4 observed in dichloromethane. Generally, the NN ligands are reduced first (R1). For [Ru(tap)2(11,12-CN-dppz)]2+, R1 is sufficiently separated from R2 and delocalized over both tap ligands. Accordingly, IR SEC conducted at R1 shows a large red shift of the νs,as(C≡N) modes by -18/-28 cm-1, accompanied by a 4-fold enhancement of the νs(C≡N) intensity, comparably with reference data for free 11,12-CN-dppz. The first tap-based reduction of spin-doublet [Ru(tap)2(11,12-CN-dppz)]+ to spin-triplet [Ru(tap)2(11,12-CN-dppz)] at R2 decreased ν(C≡N) by merely -2 cm-1, while the intensity enhancement reached an overall factor of 8. Comparably, a red shift of ν(C≡N) by -27 cm-1 resulted from the 1e- reduction of [Ru(tap)2(11-CN-dppz)]2+ at R1 (poorly resolved from R2), and the intensity enhancement was roughly 3-fold. Concomitant 1e- reductions of the tap ligands (R2 and R3) caused only minor ν(C≡N) shifts of -3 cm-1 and increased the absorbance by overall factors of 6.5 and 8, respectively.

Probing a Major DNA Weakness: Resolving the Groove and Sequence Selectivity of the Diimine Complex Λ-[Ru(phen)2 phi]2.

The grooves of DNA provide recognition sites for many nucleic acid binding proteins and anticancer drugs such as the covalently binding cisplatin. Here we report a crystal structure showing, for the first time, groove selectivity by an intercalating ruthenium complex. The complex Λ-[Ru(phen)2 phi]2+ , where phi=9,10-phenanthrenediimine, is bound to the DNA decamer duplex d(CCGGTACCGG)2 . The structure shows that the metal complex is symmetrically bound in the major groove at the central TA/TA step, and asymmetrically bound in the minor groove at the adjacent GG/CC steps. A third type of binding links the strands, in which each terminal cytosine base stacks with one phen ligand. The overall binding stoichiometry is four Ru complexes per duplex. Complementary biophysical measurements confirm the binding preference for the Λ-enantiomer and show a high affinity for TA/TA steps and, more generally, TA-rich sequences. A striking enantiospecific elevation of melting temperatures is found for oligonucleotides which include the TATA box sequence.

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

Leading article: how can I optimise my role as a leader within the surgical team?

Leadership is uncommonly taught formally at any level in surgical training, and is not often evaluated formally either within assessment programmes or during appraisal. Good leadership skills in oral and maxillofacial surgery (OMFS) include professionalism, technical competence, motivation, innovation, ability to communicate, resilience, and effective teaching. They also include the recognition of when and how to "follow" when appropriate. Such skills can be developed through experience, observation, and education using a framework that can include mentoring, coaching, and feedback. This review provides some guidance in how to improve leadership skills in OMFS, which we hope will to improve the quality of training and care of patients.

Experience with endoscopy and endoscopy-assisted management of pediatric surgical problems: results and lessons.

Minimally invasive surgical techniques are becoming increasingly popular within the pediatric population. Flexible endoscopy may enhance or replace existing techniques in the future. Many of the reported benefits of laparoscopy and thoracoscopy may apply to endoscopy and endoscopy-assisted procedures; however, no reports exist as to the application, results, and outcomes for these procedures in children. It was hypothesized that endoscopy is a useful and safe adjunct for pediatric surgical patients. Retrospective review of medical records for patients who underwent endoscopy or endoscopy-assisted operations at two children's hospitals over 3 years (August 31, 2007-August 31, 2010) was completed. During this time period, 30 procedures were performed on 28 patients. Indications for procedure, age, operative technique, operative times, surgical outcomes, complications, and length of stay for each patient were reviewed. Patient age ranged from 3 days to 20 years. Indications for operation included esophageal pathology (13), gastroduodenal pathology (14), pancreatic pseudocyst (2), and displaced sigmoid Chait® (Cook, Inc., Bloomington, IN, USA) tube. Although endoscopy was intended only as an adjunct in all cases, the planned procedure was satisfactorily completed with a purely endoscopic approach in six cases. There were no intraoperative complications, and minor postoperative complications including one stricture requiring dilation, postoperative stridor, and esophageal leak, were each successfully managed conservatively. Endoscopy offers a promising adjunct to more traditional minimally invasive techniques in children. In some cases, endoscopy may offer an alternative to more invasive procedures or eliminate the need for tube thoracostomy or post-procedural contrast studies in some esophageal cases.

Predictive value of positron emission tomography-computed tomography image fusion in the diagnosis of head and neck cancer: does it really improve staging and management?

AIMS: To determine (1) the accuracy of positron emission tomography - computed tomography in the diagnosis of head and neck cancer, (2) the learning curve involved, and (3) whether its use alters patient management. MATERIALS AND METHODS: A retrospective study including 80 patients with head and neck cancer who underwent positron emission tomography - computed tomography image fusion at Blackpool Victoria Hospital. RESULTS: Fifty-three patients underwent positron emission tomography - computed tomography for staging (32 for detection of a primary tumour and 21 for detection of distant metastasis) and 27 for detection of loco-regional recurrence. Ten primary tumours and 20 recurrences were accurately diagnosed by this method. Eighteen patients had their tumour stage and management modified as a result of this method of imaging. The effect of the learning curve resulted in better true positive detection rates, one year after introduction (81 versus 61 per cent). The sensitivity and specificity of this method in detecting head and neck cancer were 70 and 42 per cent, respectively, whereas those of conventional imaging were 73 and 51 per cent, respectively. CONCLUSION: Compared with magnetic resonance imaging, the benefits of positron emission tomography - computed tomography may be limited to diagnosis of recurrence, as it is less hindered by tissue fibrosis, radiotherapy-related oedema, scarring and inflammation.

Somnolence in adult craniopharyngioma patients is a common, heterogeneous condition that is potentially treatable.

CONTEXT AND OBJECTIVE: Somnolence and obesity are prevalent in craniopharyngioma patients. We hypothesized that somnolence was because of obstructive sleep apnoea in craniopharyngioma patients. DESIGN, PATIENTS AND MEASUREMENTS: We assessed prevalence of somnolence and sleep apnoea in 28 craniopharyngioma and 23 obese controls attending a tertiary referral centre, by means of the Epworth Sleepiness Score (ESS) and polysomnography. All subjects with sleep apnoea were offered continuous positive airway pressure therapy (CPAP) or modafinil. All craniopharyngioma patients, with unexplained somnolence, were offered modafinil. RESULTS: Somnolence was reported by 20/28 (71·5%) craniopharyngioma patients and 4/23 (17%) obese subjects (P < 0·001). Median ESS was 7·5 (IQR 6, 10·7) in craniopharyngioma patients and 4·0 (4,8) in controls, P < 0·01. Eleven somnolent craniopharyngioma patients had obstructive sleep apnoea, in whom treatment led to a reduction in ESS by 6·4 ± 1·4, P = 0·01. Among the remaining nine patients, five were offered modafinil therapy, of whom four had benefit, three were not compliant with hormone replacement, and one died before intervention. There was no difference in the prevalence of obstructive sleep apnoea between craniopharyngioma (n = 13, 46%) and obese subjects (n = 14, 61%, P = 0·4). Body mass index (BMI) does not correlate with apnoea hypopnoea index [apnoea - hypopnoea index (AHI), r = 0·25, P = 0·08], which suggests that obesity alone does not explain the prevalence of sleep apnoea in craniopharyngioma patients. CONCLUSIONS: Somnolence is common in craniopharyngioma patients and in the majority is because of obstructive sleep apnoea. An additional group of somnolent craniopharyngioma patients benefits from modafinil.

Laparoscopic Nissen fundoplication.

UNLABELLED: This article will focus on a review of the history and current status of laparoscopic Nissen fundoplication for gastroesophageal reflux disease in infants and children. METHODS: Review of the available current literature concerning laparoscopic Nissen fundoplication in infants and children. Information regarding the current approach for gastroesophageal reflux disease (GERD) in children will be reviewed in addition to the indications for surgical antireflux operation; application and safety of laparoscopy; and the outcomes of laparoscopic Nissen fundoplication in both normal and neurologically impaired children. Finally, the reported data regarding the learning curve in performing the procedure and short-term and long-term complications of laparoscopic Nissen procedure will be discussed. Compared to open antireflux operations, the laparoscopic Nissen approach in infants and children is safe; durable; provides better cosmetic results; and allows for earlier institution of feedings. The established ''learning curve'' for safe and competent performance of laparoscopic Nissen fundoplication is from 25-50 cases. Neurologically impaired patients may indeed benefit from a minimally invasive approach to GERD and enteral access related to improvement of quality of life. Better nutrition and decreased complications related to malnutrition and a decreased incidence of aspiration pneumonia may be realized for these patients. The laparoscopic Nissen approach to GERD is well accepted and widely utilized in infants and children. Prospective randomized multi-institutional studies will be necessary to accurately determine whether this therapeutic approach to GERD in both neurologically impaired and neurologically normal children is the superior option compared to continued medical therapy or gastrojejunal feeding tube approaches to GERD.

Efficacy and safety of nurse-administered propofol sedation during emergency upper endoscopy for gastrointestinal bleeding: a prospective study.

BACKGROUND AND STUDY AIMS: Recent studies have documented the safety of propofol sedation for endoscopic procedures, but many endoscopists are reluctant to use propofol for high-risk patients because of adverse effects. The aim of this study was to demonstrate the safety and efficacy of nurse-administered propofol sedation during emergency upper endoscopy for patients with gastrointestinal bleeding. PATIENTS AND METHODS: Over a period of 18 months, 120 patients suffering from acute upper gastrointestinal bleeding received propofol sedation administered by a registered nurse. Among these, 15 patients were classified into American Society of Anesthesiologists (ASA) class IV, 84 were ASA class III, and 21 were ASA class II. Patients without gastrointestinal bleeding, who also received propofol during the same period and were matched for age, gender, and ASA class, served as controls. RESULTS: Endoscopic hemostasis was achieved in 98.3 % of patients, and 97.5 % were satisfied with the procedure. In patients with gastrointestinal bleeding, the rates of hypotension (systolic blood pressure < 90 mmHg) and hypoxemia (peripheral oxygen saturation < 90 %) were 8.3 % and 6.7 % respectively, values higher than those in the control group. However, neither mask ventilation nor endotracheal intubation was necessary. Although two patients with gastrointestinal bleeding developed pneumonia, most likely due to aspiration during the procedure, they recovered within 5 days of treatment. There were no sedation-associated severe complications or mortalities. CONCLUSION: Using a strict protocol designed to protect the patient's airway and cardiovascular function, nurse-administered propofol sedation during emergency upper gastrointestinal endoscopy is safe and appropriate in cases of acute gastrointestinal bleeding.

Propofol sedation during endoscopic procedures: safe and effective administration by registered nurses supervised by endoscopists.

BACKGROUND AND STUDY AIMS: Propofol has several attractive properties, including a rapid onset of action and rapid recovery. However, the administration of propofol sedation in the absence of anesthesiologists remains controversial. This report describes the safety profile of propofol sedation for endoscopy when administered by registered nurses under the supervision of endoscopists. PATIENTS AND METHODS: The study was conducted in the endoscopic center of a Japanese private hospital. With assistance from an anesthesiologist, a protocol for administration of propofol by registered nurses was developed. Over the past 6 years, 27,500 patients received nurse-administered propofol sedation. The safety and patient satisfaction with this sedation procedure were evaluated. RESULTS: Among the participating patients, 6.7% developed hypoxemia (Sp(O2) < 90%); 6.2% required oxygen administration via a nasal cannula. Severe hypoxemia (Sp(O2) < 85%) occurred in 121 patients (0.62%) during upper gastrointestinal endoscopy and 20 patients (0.25%) during colonoscopy, but neither mask ventilation nor endotracheal intubation was necessary. A decline in blood pressure (systolic blood pressure < 90 mm Hg) was seen in 3.5% of the colonoscopy patients and 1.2% of the upper endoscopy patients. However, hypotension was corrected immediately using an intravenous saline solution. Patients who received propofol sedation expressed overall satisfaction on a 10-point visual analogue scale (with an average of 9.4 points). Among patients who had previously received a combination of midazolam and pethidine for colonoscopy, 85% preferred propofol sedation. The mean time from the end of the procedure to full recovery was 14.6 min. CONCLUSIONS: Administration of propofol by registered nurses under the supervision of endoscopists was safe, and resulted in high rates of patient satisfaction.

Pyruvate modulates hepatic mitochondrial functions and reduces apoptosis indicators during hemorrhagic shock in rats.

BACKGROUND: Dysfunctional mitochondria have been widely accepted as one of the key targets and a mediator of secondary cell injury and organ failure during hemorrhagic shock (HS). The liver is known to be the first organ to display the signs of injury during HS. This report describes experiments to determine whether modulation of hepatic mitochondrial dysfunctions by pharmacologic agents could prevent liver injury in rats subjected to HS. METHODS: In this study, Sprague-Dawley rats were either treated as controls or subjected to computer-controlled arterial hemorrhage (40 mmHg) for 60 min followed by resuscitation with hypertonic saline, hypertonic beta-hydroxybutyrate, or hypertonic sodium pyruvate for the next 60 min before death. During the course of the experiment, animals were continuously monitored for hemodynamic and metabolic parameters. At the end of the experiment, the liver was excised and examined for oxidative injury, mitochondrial functions, expression of nitric oxide synthase, and indicators of apoptosis. RESULTS: In comparison to hypertonic saline and hypertonic beta-hydroxybutyrate, pyruvate significantly protected the liver from oxidative injury, prevented the up-regulation of nitric oxide synthase, inhibited pyruvate dehydrogenase deactivation, and improved cellular energy charge and mitochondrial functions. In addition, pyruvate also reduced cleavage of poly-adenosine diphosphate ribose polymerase by preventing leakage of mitochondrial cytochrome c in the liver of HS animals. CONCLUSIONS: These data suggest that modulation of mitochondrial metabolic functions is likely to be one of the important mechanisms by which pyruvate exerts its protective effects on the liver during HS and resuscitation in rats.

Condyloma acuminatum-like lesion of the urinary bladder progressing to invasive spindle cell carcinoma.

Condyloma acuminata of the urinary bladder is a rare finding, particularly in the absence of similar lesions of the external genitalia. We present a case in which an isolated condyloma acuminatum-like lesion rapidly progressed to a poorly differentiated spindle cell carcinoma, underlying the need for careful endoscopic follow-up of patients with such lesions.

Polyurethane-covered Nitinol Strecker stents as primary palliative treatment of malignant biliary obstruction.

PURPOSE: To evaluate the clinical efficacy of the polyurethane-covered Nitinol Strecker stent in the treatment of patients with malignant biliary obstruction. METHODS: Twenty-three covered stents produced by us were placed in 18 patients with malignant biliary obstruction. Jaundice was caused by cholangiocarcinoma (n = 5), pancreatic cancer (n = 6), gallbladder cancer (n = 4), metastatic lymph nodes (n = 2), and tumor of the papilla (n = 1). RESULTS: The mean patency period of the stents was 37.5 weeks (5-106 weeks). Recurrent obstructive jaundice occurred in two patients (11%). Adequate biliary drainage over 50 weeks or until death was achieved in 17 of 18 patients (94.4%). Late cholangitis was observed in two patients whose stents bridged the ampulla of Vater. Other late severe complications were not encountered. CONCLUSION: Although more study is necessary, our results suggest the clinical efficacy of our covered Nitinol Strecker stent in the management of obstructive jaundice caused by malignant diseases.

[Arterial infusion therapy with implantable port for inoperable hepatobiliary tumors].

PURPOSE: To assess the clinical utility of arterial infusion therapy with implantable port for inoperable malignant hepatobiliary tumors. MATERIALS AND METHODS: Twenty-seven patients with advanced hepatobiliary tumors (M:F = 14:13, mean age 63.6, 11 cases with metastases from colon cancer, 4 cases from gastric cancer, 5 cases with gallbladder cancer, 3 cases with cholangiocarcinoma, 2 cases with cholangiocellularcarcinoma, 1 case with hepatocellular carcinoma and 1 with pancreatic cancer) were treated with arterial infusion ports which were placed via left subclavian artery or femoral artery. The regimens used were FEM for 5 cases, EEP for 2 cases and FP for 20 cases. RESULTS: Overall mean survival date was 241.8 days. The numbers of cases with CR, PR, NC and PD were 1, 6, 10 and 10, respectively, and the effective rate was 25.9%. Mean survivals of cases with cholangiocellularcarcinoma, metastases from gastric cancer and colon cancer were 715 days, 324.3 days and 245.9 days, respectively. Severe gastrointestinal side effects (> grade 3) were not observed. Serious bone marrow suppressions were frequently observed with FEM and EEP, but were rare with FP (10%). DISCUSSION: Arterial infusion therapy with implantable port is clinically useful for advanced cholangiocancer and metastases from the gastrointestinal system. This system contributes to the quality of life of patients, since the infusion procedure is simple and can be archived in the outpatient clinics.

CEP-1347 (KT7515), an inhibitor of JNK activation, rescues sympathetic neurons and neuronally differentiated PC12 cells from death evoked by three distinct insults.

The c-Jun N-terminal kinase signaling cascade appears to play a role in some cases of cell death, including neuronal apoptosis. CEP-1347 (KT7515), an indolocarbazole of the K252a family, blocks this stress signaling cascade and promotes survival. Here, we used CEP-1347 to probe whether neuronal death pathways activated by distinct insults also possess elements in common. Cultured rat sympathetic neurons and neuronally differentiated PC12 cells were induced to die by withdrawal of nerve growth factor, exposure to ultraviolet irradiation, or subjection to oxidative stress. In each case, death was prevented by 100-200 nM CEP-1347. Moreover, in each of these death paradigms, c-Jun N-terminal kinase 1 activity in neuronally differentiated PC12 cells was elevated by two- or threefold, and this increase was totally blocked by CEP-1347 at concentrations that promoted survival. In contrast, 200 nM CEP-1347 did not block death due to serum withdrawal from undifferentiated PC12 cells or to activation of Fas in Jurkat T cell cultures, even though in each case c-Jun N-terminal kinase 1 activation occurred and was inhibited by CEP-1347. These observations suggest that some but not all death pathways triggered by different insults can include a common mechanistic component, a likely candidate for which is activation of the c-Jun N-terminal kinase signaling cascade.

Health screening for people with learning disabilities by a community learning disability nursing service in Northern Ireland.

Over the last 30 years there has been a considerable increase in the life expectancy of people with learning disabilities. This has resulted in changing patterns of morbidity and mortality and an increasing recognition of the health needs of people with learning disabilities. Major strides forward have been made in the reduction of preventable illnesses among the general population. However, among people with learning disabilities such illnesses have received only limited health promotion attention until recently. In the last decade major gaps have been identified in the ability of current primary health services to respond to the needs of people with learning disabilities. The need to respond effectively to this situation has been identified as a priority by the current United Kingdom Government. Following an overview of the literature in relation to the changing health profile of people with learning disabilities and the need for health screening, consideration is given to some of the key difficulties which may be encountered when attempting to utilize current primary health services. The analysis of data derived from the health screening of 373 people with learning disabilities by a community nursing service in Down and Lisburn Health and Social Services Trust reveals the need for further action in relation to cardiovascular status, sensory deficits, mobility and aspects of sexual health.

Yeast mutants affecting possible quality control of plasma membrane proteins.

Mutations gef1, stp22, STP26, and STP27 in Saccharomyces cerevisiae were identified as suppressors of the temperature-sensitive alpha-factor receptor (mutation ste2-3) and arginine permease (mutation can1(ts)). These suppressors inhibited the elimination of misfolded receptors (synthesized at 34 degrees C) as well as damaged surface receptors (shifted from 22 to 34 degrees C). The stp22 mutation (allelic to vps23 [M. Babst and S. Emr, personal communication] and the STP26 mutation also caused missorting of carboxypeptidase Y, and ste2-3 was suppressed by mutations vps1, vps8, vps10, and vps28 but not by mutation vps3. In the stp22 mutant, both the mutant and the wild-type receptors (tagged with green fluorescent protein [GFP]) accumulated within an endosome-like compartment and were excluded from the vacuole. GFP-tagged Stp22p also accumulated in this compartment. Upon reaching the vacuole, cytoplasmic domains of both mutant and wild-type receptors appeared within the vacuolar lumen. Stp22p and Gef1p are similar to tumor susceptibility protein TSG101 and voltage-gated chloride channel, respectively. These results identify potential elements of plasma membrane quality control and indicate that cytoplasmic domains of membrane proteins are translocated into the vacuolar lumen.

Exploration of the importance of the P2-P3-NHCO-moiety in a potent di- or tripeptide inhibitor of calpain I: insights into the development of nonpeptidic inhibitors of calpain I.

Calpain I, an intracellular cysteine protease, has been implicated in the neurodegeneration following an episode of cerebral ischemia. In this paper, we report on a series of peptidomimetic ketomethylene and carbamethylene inhibitors of recombinant human calpain I (rh calpain I). Our study reveals that the -NHCO-moiety (possible hydrogen-bonding site) at the P2-P3 region of a potent tripeptide or a dipeptide inhibitor of calpain I is not a strict requirement for enzyme recognition. Compounds 7d ((R)-2-isobutyl-4-oxo-4-(9-xanthenyl)butanoic acid ((S)-1-formyl-3-methyl)butyl amide), 31 ((R)-2-isobutyl-4-(2-sulfonylnaphthyl)butyric acid ((S)1-formyl-3-methyl)butyl amide) and 34 ((R)-2-isobutyl-4-(2-sulfoxylnaphthyl)butyric acid ((S)-1-formyl-3-methyl)butyl amide) which exhibited good activity in the enzyme assay, also inhibited calpain I in a human cell line.

The detection of microbial DNA in the blood: a sensitive method for diagnosing bacteremia and/or bacterial translocation in surgical patients.

OBJECTIVE: The purpose was to determine the sensitivity of detecting microbial DNA in the blood of surgical patients as a measure for diagnosing systemic infection and/or translocation from the gut. SUMMARY BACKGROUND DATA: Microbial infections and translocation of intestinal bacteria are thought to contribute to multiple system organ failure, but bacterial cultures are often negative in patients with this complication. METHODS: DNA was extracted from the blood of 40 surgical patients and 20 healthy controls. Polymerase chain reaction (PCR) techniques were used to amplify genes from Escherichia coli, Bacteroides fragilis, and a region of 16S ribosomal RNA found in many gram-positive and -negative bacteria. RESULTS: Bacterial DNA genes were not detected in healthy volunteers but were found in all patients with positive blood cultures. All eight transplant patients receiving OKT3 therapy had microbial DNA in their blood, possibly indicating translocation from the gut. Sixty-four percent of critically ill patients had microbial DNA detected in their blood, but only 3 (14%) had positive blood cultures. CONCLUSIONS: The PCR method is more sensitive than blood cultures for detecting bacterial components in the blood of critically ill surgical patients and may detect microbial translocation from the intestine.