The genomic trajectory of ovarian high-grade serous carcinoma can be observed in STIC lesions.

Ovarian high-grade serous carcinoma (HGSC) originates in the fallopian tube, with secretory cells carrying a TP53 mutation, known as p53 signatures, identified as potential precursors. p53 signatures evolve into serous tubal intraepithelial carcinoma (STIC) lesions, which in turn progress into invasive HGSC, which readily spreads to the ovary and disseminates around the peritoneal cavity. We recently investigated the genomic landscape of early- and late-stage HGSC and found higher ploidy in late-stage (median 3.1) than early-stage (median 2.0) samples. Here, to explore whether the high ploidy and possible whole-genome duplication (WGD) observed in late-stage disease were determined early in the evolution of HGSC, we analysed archival formalin-fixed paraffin-embedded (FFPE) samples from five HGSC patients. p53 signatures and STIC lesions were laser-capture microdissected and sequenced using shallow whole-genome sequencing (sWGS), while invasive ovarian/fallopian tube and metastatic carcinoma samples underwent macrodissection and were profiled using both sWGS and targeted next-generation sequencing. Results showed highly similar patterns of global copy number change between STIC lesions and invasive carcinoma samples within each patient. Ploidy changes were evident in STIC lesions, but not p53 signatures, and there was a strong correlation between ploidy in STIC lesions and invasive ovarian/fallopian tube and metastatic samples in each patient. The reconstruction of sample phylogeny for each patient from relative copy number indicated that high ploidy, when present, occurred early in the evolution of HGSC, which was further validated by copy number signatures in ovarian and metastatic tumours. These findings suggest that aberrant ploidy, suggestive of WGD, arises early in HGSC and is detected in STIC lesions, implying that the trajectory of HGSC may be determined at the earliest stages of tumour development. © 2024 The Author(s). The Journal of Pathology published by John Wiley & Sons Ltd on behalf of The Pathological Society of Great Britain and Ireland.

Expert Pathology for Gestational Trophoblastic Disease: Towards an International Multidisciplinary Team Meeting.

BACKGROUND: Gestational trophoblastic disease (GTD), comprising hydatidiform moles and gestational trophoblastic tumours, is extremely rare. Exact diagnosis is crucial to indicate the appropriate treatment and to prevent complications. The scarcity and variability in the number of cases available for reporting, lack of specialised training in GTD, and non-existence of refresher courses implies that the pathologist dealing with these rare and, at times, extremely challenging cases is not completely confident in their diagnosis. OBJECTIVES: The objective of this study was to explore the benefits of implementation of an international multidisciplinary conference (virtual) to aid diagnosis of difficult cases and support clinical management of GTD. METHODS: A short survey was circulated to all 46 members of the EOTTD pathology and genetics working party and further spread to other colleagues who practice GTD. This showed that the pathologists and geneticists working with GTD patients do not feel adequately supported and equipped with dealing with these rare diseases. OUTCOME: Virtual cross-border multidisciplinary team meetings (MDTs) were initiated in April 2022, bringing together participants from 11 European countries on a bi-yearly basis. Mean numbers of 3 patients are discussed during the MDTs followed by 3-4 quality assessment cases. A participant survey was conducted at the end of virtual meeting with an average satisfaction rate of 9.5. The pathologists felt supported and benefited from networking and clinical collaboration. CONCLUSIONS AND OUTLOOK: This international MDT continues to provide support in managing the uncertainty with difficult and rare cases and enhances the pathologists training and experience. The frequency of meetings and the number of cases discussed per meeting will be increased in 2023 given the positive response. This will empower individuals and organisations to work together and improve diagnosis and the prognosis for these young patients.

Practical guidelines of the EOTTD for pathological and genetic diagnosis of hydatidiform moles.

Hydatidiform moles are rare and thus most pathologists and geneticists have little experience with their diagnosis. It is important to promptly and correctly identify hydatidiform moles given that they are premalignant disorders associated with a risk of persistent gestational trophoblastic disease and gestational trophoblastic neoplasia. Improvement in diagnosis can be achieved with uniformization of diagnostic criteria and establishment of algorithms. To this aim, the Pathology and Genetics Working Party of the European Organisation for Treatment of Trophoblastic Diseases has developed guidelines that describe the pathological criteria and ancillary techniques that can be used in the differential diagnosis of hydatidiform moles. These guidelines are based on the best available evidence in the literature, professional experience and consensus of the experts' group involved in its development.

Fertility outcomes following surgery and multiagent chemotherapy in malignant ovarian germ cell tumor survivors: a survey study.

OBJECTIVE: To assess fertility outcomes in long-term survivors of malignant ovarian germ cell tumors treated with fertility-sparing surgery with or without additional chemotherapy. METHODS: Women diagnosed and treated for malignant ovarian germ cell tumors at Charing Cross Hospital or Mount Vernon Cancer Centre between 1977 and 2015 were included. Questionnaires assessing fertility issues were sent to patients treated with fertility-sparing surgery. Fertility outcomes were evaluated according to the treatment received. The effect of the mean total dose of cyclophosphamide and cisplatin was assessed. RESULTS: A total of 146 patients were sent the questionnaire; 77 (56.5%) patients were included in the analysis. A total of 49 (64%) patients received platinum-based chemotherapy after surgery, 39 (79.6%) of these with cisplatin, vincristine, methotrexate, bleomycin, actinomycin D, cyclophosphamide, and etoposide, while 10 (20.4%) with bleomycin, etoposide, and cisplatin. After any treatment, 39/46 patients (85%) became pregnant: the conception rate was not different between those receiving surgery only and those receiving also chemotherapy (85.7% vs 84.4%, p=1.0). Live birth rate was 80.4% (37/46), with no statistically significant difference between the treatment groups (p=0.42). Median age of women achieving conception was 29 years (IQR 26-33). The probability of live birth at 5 years was 48% and 40% for patients in the surgery only and chemotherapy group, respectively (p=0.55). Infertility and miscarriage rates did not differ significantly between the two treatment groups (p=0.30 and p=0.32). The mean doses of cisplatin and cyclophosphamide received by patients failing and achieving conception were not different (p=0.10, p=0.47). CONCLUSIONS: Our results suggest that fertility may not be hampered in patients with malignant ovarian germ cell tumor treated with fertility-sparing surgery or receiving additional chemotherapy.

iIL13Pred: improved prediction of IL-13 inducing peptides using popular machine learning classifiers.

BACKGROUND: Inflammatory mediators play havoc in several diseases including the novel Coronavirus disease 2019 (COVID-19) and generally correlate with the severity of the disease. Interleukin-13 (IL-13), is a pleiotropic cytokine that is known to be associated with airway inflammation in asthma and reactive airway diseases, in neoplastic and autoimmune diseases. Interestingly, the recent association of IL-13 with COVID-19 severity has sparked interest in this cytokine. Therefore characterization of new molecules which can regulate IL-13 induction might lead to novel therapeutics. RESULTS: Here, we present an improved prediction of IL-13-inducing peptides. The positive and negative datasets were obtained from a recent study (IL13Pred) and the Pfeature algorithm was used to compute features for the peptides. As compared to the state-of-the-art which used the regularization based feature selection technique (linear support vector classifier with the L1 penalty), we used a multivariate feature selection technique (minimum redundancy maximum relevance) to obtain non-redundant and highly relevant features. In the proposed study (improved IL-13 prediction (iIL13Pred)), the use of the mRMR feature selection method is instrumental in choosing the most discriminatory features of IL-13-inducing peptides with improved performance. We investigated seven common machine learning classifiers including Decision Tree, Gaussian Naïve Bayes, k-Nearest Neighbour, Logistic Regression, Support Vector Machine, Random Forest, and extreme gradient boosting to efficiently classify IL-13-inducing peptides. We report improved AUC, and MCC scores of 0.83 and 0.33 on validation data as compared to the current method. CONCLUSIONS: Extensive benchmarking experiments suggest that the proposed method (iIL13Pred) could provide improved performance metrics in terms of sensitivity, specificity, accuracy, the area under the curve - receiver operating characteristics (AUCROC) and Matthews correlation coefficient (MCC) than the existing state-of-the-art approach (IL13Pred) on the validation dataset and an external dataset comprising of experimentally validated IL-13-inducing peptides. Additionally, the experiments were performed with an increased number of experimentally validated training datasets to obtain a more robust model. A user-friendly web server ( www.soodlab.com/iil13pred ) is also designed to facilitate rapid screening of IL-13-inducing peptides.

Epithelioid trophoblastic tumor with antecedent molar pregnancy in an HIV-positive patient.

Epithelioid trophoblastic tumor (ETT) is a rare malignancy arising from neoplastic proliferation of chorionic-type intermediate trophoblasts. ETT poses significant challenges to clinicians in the diagnosis and treatment and can hence lead to a poor prognosis. We report a unique case of metastatic ETT in a HIV-positive patient.

Minor millets: a review on nutritional composition, starch extraction/modification, product formulation, and health benefits.

Minor millet grains are the abode of healthy constituents of human concern that contribute to healthy longevity. Additionally, they are excellent in nutritional value including macronutrients namely, protein (7-13%), carbohydrates (60-70%), fat (1.5-5%), fiber (2-7%) and for micronutrients as well namely; iron, calcium, phosphorus, and magnesium, etc. All these beneficial traits along with the availability of bioactive constituents (polyphenols and antioxidants) prove them to be therapeutic in action and also uplift the immunity among users. Employed isolation tactics for starch also govern yield characteristics and is usually preferred by way of wet method. Minor millets are abundant in starch (50-70%) thus application broadness is another attribute which could be addressed in vivid food segments. In case, native starches somehow possess least application credentials in food and non-food sectors thus modification is the only alternative to eliminate shortcomings. As in trend, modification using physical, chemical, and enzymatic ways have a wide impact on the properties of millet starch. The present review summarizes the nutritional, bioactive and therapeutic potential of minor millets, along with ways of starch modification and product development through millet involvement. © 2023 Society of Chemical Industry.

PREDICT-GTN 1: Can we improve the FIGO scoring system in gestational trophoblastic neoplasia?

Gestational trophoblastic neoplasia (GTN) patients are treated according to the eight-variable International Federation of Gynaecology and Obstetrics (FIGO) scoring system, that aims to predict first-line single-agent chemotherapy resistance. FIGO is imperfect with one-third of low-risk patients developing disease resistance to first-line single-agent chemotherapy. We aimed to generate simplified models that improve upon FIGO. Logistic regression (LR) and multilayer perceptron (MLP) modelling (n = 4191) generated six models (M1-6). M1, all eight FIGO variables (scored data); M2, all eight FIGO variables (scored and raw data); M3, nonimaging variables (scored data); M4, nonimaging variables (scored and raw data); M5, imaging variables (scored data); and M6, pretreatment hCG (raw data) + imaging variables (scored data). Performance was compared to FIGO using true and false positive rates, positive and negative predictive values, diagnostic odds ratio, receiver operating characteristic (ROC) curves, Bland-Altman calibration plots, decision curve analysis and contingency tables. M1-6 were calibrated and outperformed FIGO on true positive rate and positive predictive value. Using LR and MLP, M1, M2 and M4 generated small improvements to the ROC curve and decision curve analysis. M3, M5 and M6 matched FIGO or performed less well. Compared to FIGO, most (excluding LR M4 and MLP M5) had significant discordance in patient classification (McNemar's test P < .05); 55-112 undertreated, 46-206 overtreated. Statistical modelling yielded only small gains over FIGO performance, arising through recategorisation of treatment-resistant patients, with a significant proportion of under/overtreatment as the available data have been used a priori to allocate primary chemotherapy. Streamlining FIGO should now be the focus.

First report of Tobacco rattle virus infecting Brassica oleracea var. botrytis (cauliflower) in India.

The Brassica oleracea var. botrytis (cauliflower) is an important annual vegetable crop in the Brassicaceae family and is extensively grown worldwide (Singh et al. 2018). In the early summer of 2022, the cauliflower plants grown at the Indian Agricultural Research Institute (IARI), New Delhi, India, showed virus-like symptoms. Symptoms comprised chlorosis, stunted growth, mottling, necrosis, and mosaic. Additionally, the infected plants had deformed, curled leaves and reduced growth. The symptomatic plant leaf samples were collected and examined under the transmission electron microscope (TEM), which showed rigid, rod-shaped particles with tubular morphology resembling tobacco rattle virus (TRV, genus Tobravirus) infection (Basavaraj et al. 2020). TRV has a vast host range and is reported to infect many vegetable crops (beans, beets, peppers, potatoes, and spinach) and ornamental plants (lily, marigold, and tulip) (Adams et al. 2012; Katoch et al. 2004; MacFarlane, 1999). The reverse transcription (RT)-PCR also tested infected samples. Total RNA was extracted with Plant RNeasy Mini Kit (Qiagen, Germany). The cDNA was prepared using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, US). A 600-bp-long coat protein gene of TRV was PCR amplified using coat protein gene (CPG)-specific primers (TRVCPF: ATGGGAGATATGTACGATGAATC and TRVCPR: CTAGGGATTAGGACGTATCGGA). The PCR reaction contained 5.0µl of 5× Go-Taq Flexi buffer, 2.5µl of 25mM MgCl2, 1.0µl of 10mM dNTPs, 0.75µl each of 10µm forward and reverse primers of TRVCP, 1.0µl of cDNA, 13.8µl of nuclease-free water, and 0.2µl of Go-Taq polymerase (Promega, US). No template control was run with this PCR. The PCR (Gradient thermocycler, C-1000TM, BIORAD) was carried out under the following conditions: 94°C for 2 min, followed by 35 cycles of 94°C for 1 min, 50°C for 30 sec, and 72°C for 1 min, and final elongation at 72°C for 10 min. TRV was amplified in three cauliflower samples at IARI, New Delhi (Lat 28.08° N and Long 77.12°E). The amplicon of partial CPG was sequenced by Sanger sequencing (AgriGenome Labs Pvt. Ltd., India). The BLASTN analysis of the CPG revealed 100% nucleotide homology with TRV isolates (Accession No. Z36974) (Hernandez et al. 1995). Three isolates were sequenced and submitted to the GenBank database (Accession Nos. ON983976, ON983977, and ON983978). The sap from the TRV-infected cauliflower leaves were used to confirm the infection of TRV in healthy cauliflower plants grown in the greenhouse condition. TRV may be a new threat to cauliflower production and needs further research to elaborate more about the virus-host interactions and disease resistance. As per our knowledge, this is the first report of TRV infecting cauliflower in India.

Dataset for the Reporting of Gestational Trophoblastic Neoplasia: Recommendations From the International Collaboration on Cancer Reporting (ICCR).

Comprehensive pathology reporting of cancers is important for patient management, tumor staging, and prognostication. Standardized cancer datasets are essential in guiding pathology reporting in a consistent and concise manner and this facilitates effective global cancer information exchange and comparison. The International Collaboration on Cancer Reporting (ICCR) is an alliance of several national and international pathology societies in many countries as well as bodies which are involved in tumor classification and staging. One function of the ICCR is to develop evidence-based, standardized reporting datasets for each cancer site. Herein, we report the development of an evidence-based cancer dataset by an ICCR panel of international experts for the reporting of primary uterine gestational trophoblastic neoplasia. We present the core elements that should be included and noncore elements that are recommended for inclusion in pathology reports. Lists of the response values are provided for each element, along with explanatory commentaries. The dataset also discusses controversial issues in the reporting of gestational trophoblastic neoplasia. Such evidence-based and structured pathology datasets developed through an international effort will facilitate consistent and accurate exchange and comparison of epidemiological and pathologic parameters among different populations and countries. This will ultimately improve gestational trophoblastic neoplasia patient care and facilitate future research.

The Genomic Landscape of Early-Stage Ovarian High-Grade Serous Carcinoma.

PURPOSE: Ovarian high-grade serous carcinoma (HGSC) is usually diagnosed at late stage. We investigated whether late-stage HGSC has unique genomic characteristics consistent with acquisition of evolutionary advantage compared with early-stage tumors. EXPERIMENTAL DESIGN: We performed targeted next-generation sequencing and shallow whole-genome sequencing (sWGS) on pretreatment samples from 43 patients with FIGO stage I-IIA HGSC to investigate somatic mutations and copy-number (CN) alterations (SCNA). We compared results to pretreatment samples from 52 patients with stage IIIC/IV HGSC from the BriTROC-1 study. RESULTS: Age of diagnosis did not differ between early-stage and late-stage patients (median 61.3 years vs. 62.3 years, respectively). TP53 mutations were near-universal in both cohorts (89% early-stage, 100% late-stage), and there were no significant differences in the rates of other somatic mutations, including BRCA1 and BRCA2. We also did not observe cohort-specific focal SCNA that could explain biological behavior. However, ploidy was higher in late-stage (median, 3.0) than early-stage (median, 1.9) samples. CN signature exposures were significantly different between cohorts, with greater relative signature 3 exposure in early-stage and greater signature 4 in late-stage. Unsupervised clustering based on CN signatures identified three clusters that were prognostic. CONCLUSIONS: Early-stage and late-stage HGSCs have highly similar patterns of mutation and focal SCNA. However, CN signature analysis showed that late-stage disease has distinct signature exposures consistent with whole-genome duplication. Further analyses will be required to ascertain whether these differences reflect genuine biological differences between early-stage and late-stage or simply time-related markers of evolutionary fitness. See related commentary by Yang et al., p. 2730.

Sensitive screening of single nucleotide polymorphisms in cell free DNA for diagnosis of gestational tumours.

Tumours expressing human chorionic gonadotropin (hCG), the majority of which are difficult to biopsy due to their vascularity, have disparate prognoses depending on their origin. As optimal management relies on accurate diagnosis, we aimed to develop a sensitive cell free DNA (cfDNA) assay to non-invasively distinguish between cases of gestational and non-gestational origin. Deep error-corrected Illumina sequencing of 195 common single nucleotide polymorphisms (SNPs) in cfDNA and matched genomic DNA from 36 patients with hCG-secreting tumours (serum hCG 5 to 3,042,881 IU/L) and 7 controls with normal hCG levels (≤4 IU/L) was performed. cfDNA from confirmed gestational tumours with hCG levels ranging from 1497 to 700,855 IU/L had multiple (n ≥ 12) 'non-host' alleles (i.e. alleles of paternal origin). In such cases the non-host fraction of cfDNA ranged from 0.3 to 40.4% and correlated with serum hCG levels. At lower hCG levels the ability to detect non-host cfDNA was variable, with the detection limit dependent on the type of causative pregnancy. Patients with non-gestational tumours were identifiable by the absence of non-host cfDNA, with copy number alterations detectable in the majority of cases. Following validation in a larger cohort, our sensitive assay will enable clinicians to better inform patients, for whom biopsy is inappropriate, of their prognosis and provide optimum management.

Extrauterine Mesonephric-like Neoplasms: Expanding the Morphologic Spectrum.

Mesonephric-like adenocarcinomas (MLA) are rare neoplasms arising in the uterine corpus and ovary which have been added to the recent 2020 World Health Organization Classification of Female Genital Tumors. They have similar morphology and immunophenotype and exhibit molecular aberrations similar to cervical mesonephric adenocarcinomas. It is debated as to whether they are of mesonephric or Mullerian origin. We describe the clinical, pathologic, immunohistochemical, and molecular features of 5 cases of extrauterine mesonephric-like proliferations (4 ovary, 1 extraovarian), all with novel and hitherto unreported features. These include an origin of MLA in extraovarian endometriosis, an association of ovarian MLA with high-grade serous carcinoma, mixed germ cell tumor and mature teratoma, and a borderline ovarian endometrioid tumor exhibiting mesonephric differentiation. Four of the cases exhibited a KRAS variant and 3 also a PIK3CA variant. In reporting these cases, we expand on the published tumor types associated with MLA and report for the first time a borderline tumor exhibiting mesonephric differentiation. We show the value of molecular testing in helping to confirm a mesonephric-like lesion and in determining the relationship between the different neoplastic components. We provide further evidence for a Mullerian origin, rather than a true mesonephric origin, in some of these cases. We also speculate that in the 2 cases associated with germ cell neoplasms, the MLA arose out of the germ cell tumor.

Pathology of gestational trophoblastic disease (GTD).

Gestational trophoblastic disease (GTD) is subclassified into hydatidiform mole (HM), gestational trophoblastic tumours (GTT) and non-neoplastic trophoblastic lesions. HM, partial and complete, originate from villous trophoblast and are considered as preneoplastic conditions. The risk for the development of persistent GTD, mostly as invasive HM, ranges from 0.5% to 20%, which depends on the type of molar pregnancy. The risk of development of trophoblastic tumour after PHM is <0.5% and 2%-3% after CHM. GTT represent a spectrum of neoplasms that originates from the intermediate, largely extravillous, trophoblast and these include choriocarcinoma (CC), placental site trophoblastic tumour (PSTT), epithelioid trophoblastic tumour (ETT) and mixed trophoblastic tumour. Among tumour like conditions, exaggerated placental site reaction (EPSR) and placental site nodule (PSN) (s)/plaque (s) are included. The morphological appearances of HM can be mimicked by abnormal (non-molar) villous lesions, and similarly, GTT can be mimicked both by non-malignant tumour-like conditions and non-gestational tumours with trophoblastic differentiation, which add to the diagnostic dilemma of these rare conditions. GTT have a favourable prognosis and better response to specific chemotherapeutic regimens when compared with non-gestational malignant genital tract neoplasms. The correct diagnosis and classification of these rare conditions are therefore important. This article focusses on the morphological appearances, immunocytochemistry as an aid in the diagnosis and the changes in current WHO classification of GTDs (WHO 2020).

Predictors for single-agent resistance in FIGO score 5 or 6 gestational trophoblastic neoplasia: a multicentre, retrospective, cohort study.

BACKGROUND: Patients with gestational trophoblastic neoplasia who have an International Federation of Gynaecology and Obstetrics (FIGO) risk score of 5 or 6 usually receive non-toxic single-agent chemotherapy as a first-line treatment. Previous studies suggest that only a third of patients have complete remission, with the remaining patients requiring toxic multiagent chemotherapy to attain remission. As stratification factors are unknown, some centres offer multiagent therapy upfront, resulting in overtreatment of many patients. We aimed to identify predictive factors for resistance to single-agent therapy to inform clinicians on which patients presenting with a FIGO score of 5 or 6 are likely to benefit from upfront multiagent chemotherapy. METHODS: We did a multicentre, retrospective, cohort study of patients with gestational trophoblastic neoplasia presenting with a FIGO score of 5 or 6, who received treatment at three gestational trophoblastic neoplasia reference centres in the UK, Brazil, and the USA between Jan 1, 1964, and Dec 31, 2018. All patients who had been followed up for at least 12 months after remission were included. Patients were excluded if they had received a non-standard single-agent treatment (eg, etoposide); had been given a previously established first-line multiagent chemotherapy regimen; or had incomplete data for our analyses. Patient data were retrieved from medical records. The primary outcome was the incidence of chemoresistance after first-line or second-line single-agent chemotherapy. Variables associated with chemoresistance to single-agent therapies were identified by logistic regression analysis. In patient subgroups defined by choriocarcinoma histology and metastatic disease status, we did bootstrap modelling to define thresholds of pretreatment human chorionic gonadotropin concentrations and identify groups of patients with a greater than 80% risk (ie, a positive predictive value [PPV] of 0·8) of resistance to single-agent chemotherapy. FINDINGS: Of 5025 patients with low-risk gestational trophoblastic neoplasia, we identified 431 patients with gestational trophoblastic neoplasia presenting with a FIGO risk score of 5 or 6. All patients were followed up for a minimum of 2 years. 141 (40%) of 351 patients developed resistance to single-agent treatments and required multiagent chemotherapy to achieve remission. Univariable and multivariable logistic regression revealed metastatic disease status (multivariable logistic regression analysis, odds ratio [OR] 1·9 [95% CI 1·1-3·2], p=0·018), choriocarcinoma histology (3·7 [1·9-7·4], p=0·0002), and pretreatment human chorionic gonadotropin concentration (2·8 [1·9-4·1], p<0·0001) as significant predictors of resistance to single-agent therapies. In patients with no metastatic disease and without choriocarcinoma, a pretreatment human chorionic gonadotropin concentration of 411 000 IU/L or higher yielded a PPV of 0·8, whereas in patients with either metastases or choriocarcinoma, a pretreatment human chorionic gonadotropin concentration of 149 000 IU/L or higher yielded the same PPV for resistance to single-agent therapy. INTERPRETATION: Approximately 60% of women with gestational trophoblastic neoplasia presenting with a FIGO risk score of 5 or 6 achieve remission with single-agent therapy; almost all remaining patients have complete remission with subsequent multiagent chemotherapy. Primary multiagent chemotherapy should only be given to patients with metastatic disease and choriocarcinoma, regardless of pretreatment human chorionic gonadotropin concentration, or to those defined by our new predictors. FUNDING: None. TRANSLATION: For the Portuguese translation of the abstract see Supplementary Materials section.

Deciphering Cadmium (Cd) Tolerance in Newly Isolated Bacterial Strain, Ochrobactrum intermedium BB12, and Its Role in Alleviation of Cd Stress in Spinach Plant (Spinacia oleracea L.).

A cadmium (Cd)-tolerant bacterium Ochrobactrum intermedium BB12 was isolated from sewage waste collected from the municipal sewage dumping site of Bhopal, India. The bacterium showed multiple heavy metal tolerance ability and had the highest minimum inhibitory concentration of 150 mg L-1 of Cd. Growth kinetics, biosorption, scanning electron microscopy (SEM), transmission electron microscopy (TEM), and Fourier transform infrared (FTIR) spectroscopy studies on BB12 in the presence of Cd suggested biosorption as primary mode of interaction. SEM and TEM studies revealed surface deposition of Cd. FTIR spectra indicated nitrogen atom in exopolysaccharides secreted by BB12 to be the main site for Cd attachment. The potential of BB12 to alleviate the impact of Cd toxicity in spinach plants (Spinacia oleracea L.) var. F1-MULAYAM grown in the soil containing Cd at 25, 50, and 75 mg kg-1 was evaluated. Without bacterial inoculation, plants showed delayed germination, decrease in the chlorophyll content, and stunted growth at 50 and 75 mg kg-1 Cd content. Bacterial inoculation, however, resulted in the early germination, increased chlorophyll, and increase in shoot (28.33%) and root fresh weight (72.60%) at 50 mg kg-1 of Cd concentration after 75 days of sowing. Due to bacterial inoculation, elevated proline accumulation and lowered down superoxide dismutase (SOD) enzyme activity was observed in the Cd-stressed plants. The isolate BB12 was capable of alleviating Cd from the soil by biosorption as evident from significant reduction in the uptake/translocation and bioaccumulation of Cd in bacteria itself and in the plant parts of treated spinach. Potential PGP prospects and heavy metal bioremediation capability of BB12 can make the environmental application of the organism a promising approach to reduce Cd toxicity in the crops grown in metal-contaminated soils.

Optimization and Development of Methotrexate- and Resveratrol-Loaded Nanoemulsion Formulation Using Box-Behnken Design for Rheumatoid Arthritis.

Methotrexate (MTX) is the first line of choice for the management of rheumatoid arthritis (RA) and has been reported for its low bioavailability and side effects. Combination therapy has been widely investigated to overcome bioavailability issues and to reduce adverse effects associated with monotherapy. Various phytoconstituents such as resveratrol (RSV) and curcumin have been found to possess potent anti-inflammatory activity via downregulating the signaling of cytokines (interleukin [IL]-1, IL-6, and tumor necrosis factor alpha) and nuclear factor kappa B signaling. The prime objective of this study was to develop transdermal gel containing MTX-RSV loaded nanoemulsions (NEs) to overcome bioavailability issues and adverse effects of RA monotherapy. The NEs optimized by using Box-Behnken Design were incorporated within gel, and an in vitro skin permeation study performed on rat skin by using vertical Franz diffusion cells exhibited controlled drug release up to 48 h. Subsequently, anti-inflammatory and potential anti-arthritic activities of the combination in nanocarrier were assessed in rats and showed 78.76 ± 4.16% inhibition in inflammation and better anti-arthritic effects. Consequently, integration of dual delivery with nanotechnology can hopefully produce successful therapeutic options for rheumatic diseases.

Can we replace adjuvant chemotherapy with surveillance for stage IA-C immature ovarian teratomas of any grade? an international multicenter analysis.

BACKGROUND: The role of surveillance after surgery for stage IA-C grade 2 (G2) or grade 3 (G3) immature teratomas (ITs) is controversial with many guidelines advocating adjuvant chemotherapy. Here, we investigate the safety of surveillance in stage IA-C G1-3 ITs. METHODS: Clinicopathological data were analysed on postpubertal patients with stage I pure ITs in Multicenter Italian Trials in Ovarian Cancer centres and at Charing Cross Hospital, UK, between January 1985 and January 2018. RESULTS: Of 108 stage I patients, 66 (61.1%), 3 (2.8%) and 39 (36.1%) were International Federation of Gynecology and Obstetrics IA, IB, IC, respectively, with 31 (28.7%), 41 (38%) and 36 (33.3%) having grade 1 (G1), 2 and 3 disease, respectively. After surgery, 27 patients (25%) had adjuvant chemotherapy and 81 (75%) surveillance. There was no significant increase in the risk of malignant (G2-3 IT) relapse (9/81 vs 2/27; p = 0.72) or in disease-free survival (DFS) or overall survival in the surveillance vs chemotherapy groups. The median time to relapse was 17.8 months (range: 3-47) with no significant difference between surveillance or chemotherapy groups. The median follow-up was 64.3 months (Interquartile range (IQR) 22.2-101.7). Chemotherapy induced cures in all except for one patient who did not follow the surveillance protocol due to pregnancy and died of disease. Univariate and multivariate analyses revealed that only tumour grade (hazard ratio [HR] = 3.11; p = 0.02) and complete surgical staging (HR = 0.2; p = 0.01) were independent prognostic factors for decreased DFS. CONCLUSION: The present study suggests that in the adult setting careful surveillance appears to be an acceptable alternative to adjuvant chemotherapy for stage IA-C ITs of any grade, properly staged and with negative postoperative tumour markers.