Structure of pre-miR-31 reveals an active role in Dicer-TRBP complex processing.

As an essential posttranscriptional regulator of gene expression, microRNA (miRNA) levels must be strictly maintained. The biogenesis of many miRNAs is mediated by trans-acting protein partners through a variety of mechanisms, including remodeling of the RNA structure. miR-31 functions as an oncogene in numerous cancers, and interestingly, its biogenesis is not known to be regulated by protein-binding partners. Therefore, the intrinsic structural properties of the precursor element of miR-31 (pre-miR-31) can provide a mechanism by which its biogenesis is regulated. We determined the solution structure of pre-miR-31 to investigate the role of distinct structural elements in regulating processing by the Dicer-TRBP complex. We found that the presence or absence of mismatches within the helical stem does not strongly influence Dicer-TRBP processing of the pre-miRNAs. However, both the apical loop size and structure at the Dicing site are key elements for discrimination by the Dicer-TRBP complex. Interestingly, our NMR-derived structure reveals the presence of a triplet of base pairs that link the Dicer cleavage site and the apical loop. Mutational analysis in this region suggests that the stability of the junction region strongly influences processing by the Dicer-TRBP complex. Our results enrich our understanding of the active role that RNA structure plays in regulating miRNA biogenesis, which has direct implications for the control of gene expression.

Structure of pre-miR-31 reveals an active role in Dicer processing.

As an essential post-transcriptional regulator of gene expression, microRNA (miR) levels must be strictly maintained. The biogenesis of many, but not all, miRs is mediated by trans-acting protein partners through a variety of mechanisms, including remodeling of the RNA structure. miR-31 functions as an oncogene in numerous cancers and interestingly, its biogenesis is not known to be regulated by protein binding partners. Therefore, the intrinsic structural properties of pre-miR-31 can provide a mechanism by which its biogenesis is regulated. We determined the solution structure of the precursor element of miR-31 (pre-miR-31) to investigate the role of distinct structural elements in regulating Dicer processing. We found that the presence or absence of mismatches within the helical stem do not strongly influence Dicer processing of the pre-miR. However, both the apical loop size and structure at the Dicing site are key elements for discrimination by Dicer. Interestingly, our NMR-derived structure reveals the presence of a triplet of base pairs that link the Dicer cleavage site and the apical loop. Mutational analysis in this region suggests that the stability of the junction region strongly influence both Dicer binding and processing. Our results enrich our understanding of the active role that RNA structure plays in regulating Dicer processing which has direct implications for control of gene expression.

Chemical Modulation of DNA Replication along G-Quadruplex Based on Topology-Dependent Ligand Binding.

Ligands that bind to and stabilize guanine-quadruplex (G4) structures to regulate DNA replication have therapeutic potential for cancer and neurodegenerative diseases. Because there are several G4 topologies, ligands that bind to their specific types may have the ability to preferentially regulate the replication of only certain genes. Here, we demonstrated that binding ligands stalled the replication of template DNA at G4, depending on different topologies. For example, naphthalene diimide derivatives bound to the G-quartet of G4 with an additional interaction between the ligand and the loop region of a hybrid G4 type from human telomeres, which efficiently repressed the replication of the G4. Thus, these inhibitory effects were not only stability-dependent but also topology-selective based on the manner in which G4 structures interacted with G4 ligands. Our original method, referred to as a quantitative study of topology-dependent replication (QSTR), was developed to evaluate correlations between replication rate and G4 stability. QSTR enabled the systematic categorization of ligands based on topology-dependent binding. It also demonstrated accuracy in determining quantitatively how G4 ligands control the intermediate state of replication and the kinetics of G4 unwinding. Hence, the QSTR index would facilitate the design of new drugs capable of controlling the topology-dependent regulation of gene expression.

Nep1-like proteins as a target for plant pathogen control.

The lack of efficient methods to control the major diseases of crops most important to agriculture leads to huge economic losses and seriously threatens global food security. Many of the most important microbial plant pathogens, including bacteria, fungi, and oomycetes, secrete necrosis- and ethylene-inducing peptide 1 (Nep1)-like proteins (NLPs), which critically contribute to the virulence and spread of the disease. NLPs are cytotoxic to eudicot plants, as they disturb the plant plasma membrane by binding to specific plant membrane sphingolipid receptors. Their pivotal role in plant infection and broad taxonomic distribution makes NLPs a promising target for the development of novel phytopharmaceutical compounds. To identify compounds that bind to NLPs from the oomycetes Pythium aphanidermatum and Phytophthora parasitica, a library of 587 small molecules, most of which are commercially unavailable, was screened by surface plasmon resonance. Importantly, compounds that exhibited the highest affinity to NLPs were also found to inhibit NLP-mediated necrosis in tobacco leaves and Phytophthora infestans growth on potato leaves. Saturation transfer difference-nuclear magnetic resonance and molecular modelling of the most promising compound, anthranilic acid derivative, confirmed stable binding to the NLP protein, which resulted in decreased necrotic activity and reduced ion leakage from tobacco leaves. We, therefore, confirmed that NLPs are an appealing target for the development of novel phytopharmaceutical agents and strategies, which aim to directly interfere with the function of these major microbial virulence factors. The compounds identified in this study represent lead structures for further optimization and antimicrobial product development.

Methylation of selenocysteine catalysed by thiopurine S-methyltransferase.

BACKGROUND: Methylation driven by thiopurine S-methylatransferase (TPMT) is crucial for deactivation of cytostatic and immunosuppressant thiopurines. Despite its remarkable integration into clinical practice, the endogenous function of TPMT is unknown. METHODS: To address the role of TPMT in methylation of selenium compounds, we established the research on saturation transfer difference (STD) and 77Se NMR spectroscopy, fluorescence measurements, as well as computational molecular docking simulations. RESULTS: Using STD NMR spectroscopy and fluorescence measurements of tryptophan residues in TPMT, we determined the binding of selenocysteine (Sec) to human recombinant TPMT. By comparing binding characteristics of Sec in the absence and in the presence of methyl donor, we confirmed S-adenosylmethionine (SAM)-induced conformational changes in TPMT. Molecular docking analysis positioned Sec into the active site of TPMT with orientation relevant for methylation reaction. Se-methylselenocysteine (MeSec), produced in the enzymatic reaction, was detected by 77Se NMR spectroscopy. A direct interaction between Sec and SAM in the active site of rTPMT and the formation of both products, MeSec and S-adenosylhomocysteine, was demonstrated using NMR spectroscopy. CONCLUSIONS: The present study provides evidence on in vitro methylation of Sec by rTPMT in a SAM-dependant manner. GENERAL SIGNIFICANCE: Our results suggest novel role of TPMT and demonstrate new insights into enzymatic modifications of the 21st amino acid.

Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure.

In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.

Coexistence of two main folded G-quadruplexes within a single G-rich domain in the EGFR promoter.

EGFR is an oncogene which codifies for a tyrosine kinase receptor that represents an important target for anticancer therapy. Indeed, several human cancers showed an upregulation of the activity of this protein. The promoter of this gene contains some G-rich domains, thus representing a yet unexplored point of intervention to potentially silence this gene. Here, we explore the conformational equilibria of a 30-nt long sequence located at position -272 (EGFR-272). By merging spectroscopic and electrophoretic analysis performed on the wild-type sequence as well as on a wide panel of related mutants, we were able to prove that in potassium ion containing solution this sequence folds into two main G-quadruplex structures, one parallel and one hybrid. They show comparable thermal stabilities and affinities for the metal ion and, indeed, they are always co-present in solution. The folding process is driven by a hairpin occurring in the domain corresponding to the terminal loop which works as an important stabilizing element for both the identified G-quadruplex arrangements.

NMR Structure of a Triangulenium-Based Long-Lived Fluorescence Probe Bound to a G-Quadruplex.

An NMR structural study of the interaction between a small-molecule optical probe (DAOTA-M2) and a G-quadruplex from the promoter region of the c-myc oncogene revealed that they interact at 1:2 binding stoichiometry. NMR-restrained structural calculations show that binding of DAOTA-M2 occurs mainly through π-π stacking between the polyaromatic core of the ligand and guanine residues of the outer G-quartets. Interestingly, the binding affinities of DAOTA-M2 differ by a factor of two for the outer G-quartets of the unimolecular parallel G-quadruplex under study. Unrestrained MD calculations indicate that DAOTA-M2 displays significant dynamic behavior when stacked on a G-quartet plane. These studies provide molecular guidelines for the design of triangulenium derivatives that can be used as optical probes for G-quadruplexes.