RESUMO
Human Apo2-ligand/TRAIL is a member of the TNF cytokine superfamily capable of inducing apoptosis on tumor cells while sparing normal cells. Besides its antitumor activity, Apo2L/TRAIL is also implicated in immune regulation. Apo2L/TRAIL is stored inside activated T cells in cytoplasmic multivesicular bodies and is physiologically released to the extracellular medium inserted in the internal membrane vesicles, known as exosomes. In this study we have generated artificial lipid vesicles coated with bioactive Apo2L/TRAIL, which resemble natural exosomes, to analyze their apoptosis-inducing ability on cell lines from hematological tumors. We have tethered Apo2L/TRAIL to lipid vesicles by using a novel Ni(2+)-(N-5-amino-1-carboxylpentyl)-iminodiacetic acid, NTA)-containing liposomal system. This lipidic framework (LUVs-Apo2L/TRAIL) greatly improves Apo2L/TRAIL activity, decreasing by around 14-fold the LC50 on the T-cell leukemia Jurkat. This increase in bioactivity correlated with the greater ability of LUVs-Apo2L/TRAIL to induce caspase-3 activation and is probably due to the increase in local concentration of Apo2L/TRAIL, improving its receptor cross-linking efficiency. More important, liposome-bound Apo2L/TRAIL overcame the resistance to soluble recombinant Apo2L/TRAIL exhibited by tumor cell mutants overexpressing Bcl-xL or by a Bax and Bak-defective Jurkat cell mutant (Jurkat-shBak) and are also effective against other hematologic tumor cells. Jurkat-Bcl-xL and Jurkat-shBak cells are resistant to most chemotherapeutic drugs currently used in cancer treatment, and their sensitivity to LUVs-Apo2L/TRAIL could have potential clinical applications.
Assuntos
Neoplasias Hematológicas/tratamento farmacológico , Lipossomos/química , Apoptose/efeitos dos fármacos , Linhagem Celular Tumoral , Células Cultivadas , Resistencia a Medicamentos Antineoplásicos , Citometria de Fluxo , Humanos , Leucócitos Mononucleares , Lipossomos/administração & dosagem , Ligante Indutor de Apoptose Relacionado a TNF/química , Ligante Indutor de Apoptose Relacionado a TNF/farmacologiaRESUMO
Mesenchymal stem cells (MSCs) are self-renewing, multipotent cells that could potentially be used to repair injured cartilage in diseases such as osteoarthritis (OA). In this study we used bone marrow, adipose tissue from articular and subcutaneous locations, and synovial fluid samples from 18 patients with knee OA to find a suitable alternative source for the isolation of MSCs with high chondrogenic potential. MSCs from all tissues analysed had a fibroblastic morphology, but their rates of proliferation varied. Subcutaneous fat-derived MSCs proliferated faster than bone marrow- and Hoffa's fat pad-derived MSCs, while synovial fluid-derived MSCs grew more slowly. CD36 and CD54 expression was similar across all groups of MSCs with several minor differences. High expression of these surface markers in subcutaneous fat-derived MSCs was correlated with poor differentiation into hyaline cartilage. Synovial fluid-derived MSCs presented a relatively small chondrogenic differentiation capacity while Hoffa's fat pad-derived MSCs had strong chondrogenic potential. In conclusion, MSCs from elderly patients with OA may still display significant chondrogenic potential, depending on their origin.
Assuntos
Antígenos CD36/metabolismo , Condrogênese/fisiologia , Molécula 1 de Adesão Intercelular/metabolismo , Células-Tronco Mesenquimais/patologia , Osteoartrite do Joelho/patologia , Adipócitos/citologia , Adipócitos/fisiologia , Idoso , Antígenos de Superfície/metabolismo , Biomarcadores/metabolismo , Cartilagem Articular/citologia , Cartilagem Articular/fisiologia , Diferenciação Celular , Proliferação de Células , Células Cultivadas , Feminino , Citometria de Fluxo , Humanos , Masculino , Células-Tronco Mesenquimais/metabolismo , Pessoa de Meia-Idade , Osteoartrite do Joelho/cirurgia , Líquido Sinovial/citologiaRESUMO
It has been suggested that interleukin-17 (IL-17) plays a crucial role in the development of several autoimmune diseases. However, there are no data about the relationship between myasthenia gravis and IL-17. The aim of this study was to measure the concentration of IL-17 and determine whether levels depend on the severity of MG. Serum IL-17 concentrations were measured in 25 patients. IL-17 concentrations were higher in generalized MG compared with controls and correlated with anti-acetylcholinesterase receptor antibody titers.
Assuntos
Interleucina-17/sangue , Miastenia Gravis/sangue , Adulto , Idoso , Idoso de 80 Anos ou mais , Feminino , Humanos , Interleucina-6/sangue , Masculino , Pessoa de Meia-IdadeRESUMO
This study analyzed the phenotype and the chondrogenic differentiation of bone marrow-derived MSCs from old patients undergoing knee osteoarthritis or femoral fracture surgery. Twenty patients (12 females), with a mean age of 77.35±8.76 years, were studied. Ten patients suffered of knee osteoarthritis (OA) pathology and underwent surgery for arthroplasty, and the other 10 patients suffered femoral fracture. A comparative study of bone marrow-derived cultured human MSCs was carried out, and the main morphological parameters, proliferative activity and expression of surface markers were characterized. Bone marrow was obtained from the femur in all cases. The χ2-test, Mann-Whitney U-test, correlation coefficient and the Spearman test were applied. Bone marrow MSCs from old patients were able to differentiate into chondrocytic lineages. Proliferation and flow cytometry data showed no difference associated to the gender. No significant differences between the knee arthroplasty group or the femoral fracture group were found, except for higher CD49d % in MSC from fracture, and higher CD49f % in MSC from knee OA patients at passage one. MSCs from old patients suffering knee OA can be differentiated into chondrocytic lineages, and these present no differences with MSCs from femoral fracture patients.
Assuntos
Células da Medula Óssea/citologia , Diferenciação Celular , Condrócitos/citologia , Células-Tronco Mesenquimais/citologia , Idoso , Idoso de 80 Anos ou mais , Medula Óssea , Diferenciação Celular/genética , Linhagem da Célula , Células Cultivadas , Condrogênese/genética , Feminino , Fraturas do Fêmur/patologia , Citometria de Fluxo , Humanos , Masculino , Pessoa de Meia-Idade , Osteoartrite do Joelho/patologia , FenótipoRESUMO
OBJECTIVE: We previously observed that T lymphocytes present in synovial fluid (SF) from patients with rheumatoid arthritis (RA) were sensitive to APO2L/TRAIL. In addition, there was a drastic decrease in the amount of bioactive APO2L/TRAIL associated with exosomes in SF from RA patients. This study was undertaken to evaluate the effectiveness of bioactive APO2L/TRAIL conjugated with artificial lipid vesicles resembling natural exosomes as a treatment in a rabbit model of antigen-induced arthritis (AIA). METHODS: We used a novel Ni(2+)-(N-5-amino-1-carboxypentyl)-iminodiacetic acid)-containing liposomal system. APO2L/TRAIL bound to liposomes was intraarticularly injected into the knees of animals with AIA. One week after treatment, rabbits were killed, and arthritic synovial tissue was analyzed. RESULTS: Tethering APO2L/TRAIL to the liposome membrane increased its bioactivity and resulted in more effective treatment of AIA compared with soluble, unconjugated APO2L/TRAIL, with substantially reduced synovial hyperplasia and inflammation in rabbit knee joints. The results of biophysical studies suggested that the increased bioactivity of APO2L/TRAIL associated with liposomes was due to the increase in the local concentration of the recombinant protein, augmenting its receptor crosslinking potential, and not to conformational changes in the protein. In spite of this increase in bioactivity, the treatment lacked systemic toxicity and was not hepatotoxic. CONCLUSION: Our findings indicate that binding APO2L/TRAIL to the liposome membrane increases its bioactivity and results in effective treatment of AIA.
Assuntos
Artrite Experimental/terapia , Artrite Reumatoide/terapia , Ligante Indutor de Apoptose Relacionado a TNF/uso terapêutico , Animais , Artrite Experimental/metabolismo , Artrite Reumatoide/metabolismo , Citometria de Fluxo , Hiperplasia/metabolismo , Hiperplasia/terapia , Inflamação/metabolismo , Inflamação/terapia , Lipossomos/uso terapêutico , Coelhos , Membrana Sinovial/metabolismo , Resultado do TratamentoRESUMO
Mesenchymal stem cells (MSCs) are multipotent cells capable of differentiating into several mesoderm lineages. They have been isolated from different tissues, such as bone marrow, adult peripheral blood, umbilical cord blood, and adipose tissue. The aim of this study was to analyze the differences in proliferation and phenotype of adipose tissue-derived MSCs from three different species, and to evaluate their capacity to differentiate into chondrocytes in vitro. A comparative study of cultured human, rabbit, and sheep mesenchymal cells from adipose tissue was carried out, and the main morphological parameters, proliferative activity, and expression of surface markers were characterized. Proliferation and flow cytometry data showed species-related differences between animal and human MSCs. Histological staining suggested that rabbit and sheep mesenchymal cells were able to differentiate into chondrocytic lineages. Human mesenchymal cells, though they could also differentiate, accomplished it with more difficulty than animal MSCs. These results could help to explain the differences in the chondrogenic capacity of sheep and rabbit MSCs when they are used as animal models compared to human mesenchymal cells in a clinical assay.
Assuntos
Diferenciação Celular , Condrócitos/citologia , Células-Tronco Mesenquimais/citologia , Tecido Adiposo/citologia , Animais , Antígenos CD/biossíntese , Linhagem da Célula , Células Cultivadas , Humanos , Fenótipo , Coelhos , OvinosRESUMO
OBJECTIVES: The utility of many molecules as tumor markers in melanoma has been investigated with different results. The aims of this study was to compare the value of tyrosinase mRNA by reverse transcription polymerase chain reaction (RT-PCR) in peripheral blood and of serum S-100 protein in patients with melanoma at different stages of disease. METHODS: We have studied 90 peripheral blood samples corresponding to 90 patients that had been diagnosed with melanoma. The clinical staging at the time of blood sampling was performed according to the American Join Committee on Cancer guidelines. S-100 protein in serum was measured by enzyme-linked immunosorbent assay (normal range: 0-0.150 microg) and the presence of tyrosinase mRNA was assessed by RT-PCR. RESULTS: Median progression-free survival was 281 days for tyrosinase positive patients and it has not been reached for tyrosinase negative patients (P = 0.03). Median progression free survival was 213 days for patients with elevated serum S-100 and it has not been reached for patients with normal level of serum S-100 (P < 0.001). Median overall survival (OS) was 396 days for tyrosinase positive patients and it has not been reached for negative patients (P = 0.0096). Median OS was 282 days for patients with elevated serum S-100 and it has not been reached for patients with normal level of serum S-100 (P < 0.001). In a multivariate analysis, both markers have significant prognostic value for time to progression and for survival (chi(2) test). CONCLUSIONS: RT-PCR for tyrosinase mRNA and S-100 are significant prognostic factors for progression-free survival and OS in melanoma. S-100 has higher sensitivity and specificity than tyrosinase.
Assuntos
Biomarcadores Tumorais/metabolismo , Melanoma/metabolismo , Monofenol Mono-Oxigenase/metabolismo , Proteínas S100/metabolismo , Neoplasias Cutâneas/metabolismo , Adolescente , Adulto , Idoso , Idoso de 80 Anos ou mais , Criança , Pré-Escolar , Ensaio de Imunoadsorção Enzimática , Feminino , Humanos , Masculino , Melanoma/sangue , Melanoma/genética , Pessoa de Meia-Idade , Monofenol Mono-Oxigenase/genética , Estadiamento de Neoplasias , Valor Preditivo dos Testes , Prognóstico , Estudos Prospectivos , RNA Mensageiro/genética , RNA Mensageiro/metabolismo , RNA Neoplásico/genética , RNA Neoplásico/metabolismo , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Sensibilidade e Especificidade , Neoplasias Cutâneas/sangue , Neoplasias Cutâneas/genética , Taxa de SobrevidaRESUMO
A need for factors predictive of prognosis is present in patients who are diagnosed with malignant melanoma. The detection of circulating melanoma cells by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA is a possible negative prognostic factor. The aim of this study was to assess the prognostic value of reverse transcriptase-PCR for tyrosinase mRNA in peripheral blood samples. From January 2000 to February 2003, duplicate blood samples were drawn from 114 melanoma patients following surgery and informed consent, and were tested with reverse transcriptase-PCR, for tyrosinase mRNA. Outer primers for the first PCR were R1 (sense): TTGGCAGATTGTCTGTAGCC and R2 (antisense): AGGCATTGTGCATGCTGCT. For the second round of PCR, nested primers were R3 (sense): GTCTTTATGCAATGGAACGC and R4 (antisense): GCTATCCCAGTAAGTGGACT. Threshold for detection of the technique was determined by adding serially diluted MelJuSo cells to healthy volunteer blood samples. Overall, 91 (79.1%) patients tested negative for tyrosinase mRNA and 24 (20.9%) tested positive. The number of patients who tested positive by stage was 3/38 (7.9%) for stage I, 3/22 (13.6%) for stage II, 5/30 (16.7%) for stage III and 13/24 (54.2%) for stage IV (P< 0.0001). 11/90 (12.2%) patients with no evidence of disease (stage I, II and III) tested positive and 13/24 (54.2%) patients with clinically confirmed distant metastases (stage IV) tested positive (P<0.00001). With median follow-up of 372 days or to death (range: 0-1303 days), median progression-free survival has not been reached for tyrosinase-negative patients and was 265 days for tyrosinase-positive patients (P<0.00001, log-rank test=21.07). Median overall survival was 344 days for tyrosinase-positive patients and has not been reached for tyrosinase-negative patients (P=0.0001, log-rank test=21.38). Stage, Breslow thickness and result of RT-PCR were significant prognostic factors for disease-free survival in a multivariate analysis, and stage was the only significant prognostic factor for overall survival. In conclusion, detection of circulating melanoma cells by reverse transcriptase-PCR for tyrosinase mRNA is a significant adverse prognostic factor for disease-free survival in patients with malignant melanoma.
Assuntos
Regulação Neoplásica da Expressão Gênica , Melanoma/sangue , Melanoma/diagnóstico , Melanoma/patologia , Monofenol Mono-Oxigenase/sangue , Células Neoplásicas Circulantes , Neoplasias Cutâneas/sangue , Adulto , Idoso , Idoso de 80 Anos ou mais , Estudos de Casos e Controles , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Monofenol Mono-Oxigenase/biossíntese , Prognóstico , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Neoplasias Cutâneas/diagnósticoRESUMO
AIMS AND BACKGROUND: The purpose of the study was to test the immunological and clinical effects of infusions of dendritic cells pulsed with autologous tumor lysate in patients with advanced cancer. PATIENTS AND METHODS: Peripheral blood mononuclear cells from 15 patients with metastatic cancer (melanoma in 10, lung cancer in 2, renal cell carcinoma in 1, sarcoma in 1, breast cancer in 1) were harvested by leukapheresis after mobilization with GM-CSF (5 microg/kg/day s.c. for 4 days). Mononuclear cells were separated and cultured in GM-CSF (1000 U/ml) and interleukin-4 (1000 U/ml) for 7 days. Phenotype was assessed by 2-color flow cytometry and immunocytochemistry. On day 6, dendritic cells were pulsed with 1 g of fresh autologous tumor lysate for 24 h and infused intravenously. Interleukin-2 (6 million IU), interferon a (4 million IU) and GM-CSF (400 microg) were injected s.c. daily for 10 days beginning on the day of dendritic cell infusion. Treatment was repeated every 21 days for 3 courses. RESULTS: The morphology, immunocytochemistry and phenotype of cultured cells was consistent with dendritic cells: intense positivity for HLA-DR and CD86, with negativity for markers of other lineages, including CD3, CD4, CD8 and CD14. More than 5 x 10(7) dendritic cells were injected in all patients. Nine patients developed >5 mm delayed type cutaneous hypersensitivity reactions to tumor lysate+/-GM-CSF after the first immunization (larger than GM-CSF in all cases). Median delayed type cutaneous hypersensitivity to lysate +/- GM-CSF was 3 cm after the third immunization. One melanoma patient with skin, liver, lung and bone metastases had a partial response lasting 8 months (followed by progression in the brain). Seven patients had stable disease for >3 months, and 7 had progression. CONCLUSIONS: Infusion of tumor lysate-pulsed dendritic cells induces a strong cell-mediated antitumor immune reaction in patients with advanced cancer and has some clinical activity.
Assuntos
Células Dendríticas/imunologia , Células Dendríticas/transplante , Imunoterapia Adotiva , Neoplasias/terapia , Adulto , Idoso , Antígenos CD/metabolismo , Feminino , Citometria de Fluxo , Humanos , Hipersensibilidade Tardia , Imuno-Histoquímica , Imunofenotipagem , Imunoterapia Adotiva/efeitos adversos , Masculino , Pessoa de Meia-Idade , Neoplasias/imunologia , Projetos Piloto , Transplante AutólogoRESUMO
The infiltration and accumulation of T cells in the rheumatoid arthritis (RA) synovial fluid (SF) are hallmarks of disease. We aimed to assess the functional relevance of FasL and of APO2L/TRAIL in the persistence of T cells in the rheumatoid SF. We have analyzed the expression of the activation markers HLA-DR and CD69 and also of the death receptor Fas/CD95 and death ligands FasL or APO2L/TRAIL in CD3+ lymphocytes from SF of 62 RA patients, together with their sensitivity to anti-Fas mAb or to rAPO2L/TRAIL, using as controls T lymphocytes present in SF of 20 patients with traumatic arthritis. T lymphocytes infiltrated in SF of RA patients have a chronically activated phenotype, but they are resistant to Fas-induced toxicity. However, they are more susceptible to rAPO2L/TRAIL than T cells in the SF of traumatic arthritis patients. In addition, we found very low amounts of bioactive FasL and APO2L/TRAIL associated with exosomes in SF from RA patients as compared with SF from traumatic arthritis patients. The observation on the sensitivity of RA SF T cells to rAPO2L could have therapeutic implications because bioactive APO2L/TRAIL could be beneficial as a RA treatment.
Assuntos
Artrite Reumatoide/imunologia , Líquido Sinovial/citologia , Linfócitos T/imunologia , Ligante Indutor de Apoptose Relacionado a TNF/imunologia , Antígenos CD/imunologia , Antígenos CD/metabolismo , Antígenos de Diferenciação de Linfócitos T/imunologia , Antígenos de Diferenciação de Linfócitos T/metabolismo , Complexo CD3/imunologia , Complexo CD3/metabolismo , Células Cultivadas , Proteína Ligante Fas/antagonistas & inibidores , Proteína Ligante Fas/imunologia , Proteína Ligante Fas/metabolismo , Feminino , Citometria de Fluxo , Antígenos HLA-DR/imunologia , Antígenos HLA-DR/metabolismo , Humanos , Células Jurkat , Lectinas Tipo C , Masculino , Pessoa de Meia-Idade , Fenótipo , Líquido Sinovial/imunologia , Linfócitos T/metabolismo , Ligante Indutor de Apoptose Relacionado a TNF/antagonistas & inibidores , Ligante Indutor de Apoptose Relacionado a TNF/metabolismo , Receptor fas/imunologia , Receptor fas/metabolismoRESUMO
Apo2L/TRAIL is a member of the TNF family, with its receptors DR4 and DR5 containing a death domain. Multiple tumors are sensitive to Apo2L/TRAIL-induced apoptosis, while normal cells are not, so it constitutes a promising new antitumoral therapy. In this review we deal rather with the physiological role of Apo2L/TRAIL, which, in one hand, is clearly related with immune antitumoral surveillance. However, a role of Apo2L/TRAIL as a fine-tuning regulator of the immune system, especially in the regulation of CD8+ T cell activation and memory, has been also demonstrated. In fact, Apo2L/TRAIL can be considered as an additional mechanism needed to prevent the development of autoimmune disease. Indeed, recent developments indicate that Apo2L/TRAIL can be also useful as a treatment against certain chronic autoimmune diseases.
Assuntos
Linfócitos T/imunologia , Ligante Indutor de Apoptose Relacionado a TNF/fisiologia , Animais , Apoptose , Doenças Autoimunes/imunologia , Humanos , Tolerância Imunológica , Ativação Linfocitária , CamundongosRESUMO
The mechanisms responsible for the down-modulation of the activation of separated CD4(+) or CD8(+) human T cell blasts were studied using cells obtained from healthy donors. In the presence of IL-2, human CD8(+) T cell blasts were more sensitive than CD4(+) T cell blasts to regulation by APO2 ligand/TNF-related apoptosis-inducing ligand (APO2L/TRAIL), while both T cell subsets were equally sensitive to Fas/CD95 regulation. This regulation was defined as inhibition of IL-2-dependent T cell growth in the absence of cell death induction, characterized by cell cycle arrest in G(2)/M. The physiological validity of these observations was corroborated by the demonstration of intracellular FasL and APO2L/TRAIL expression in CD4(+) and CD8(+) T cell blasts, which were secreted in their bioactive form into the supernatant upon PHA, CD3 or CD59 reactivation. Additionally, the inhibition of IL-2-dependent CD4(+) or CD8(+) T cell blast growth upon CD3 or CD59 ligation was dependent, at least partially, on FasL and/or APO2L/TRAIL. These data precisely define the role of APO2L/TRAIL in the regulation of human T cell activation.
Assuntos
Linfócitos T CD4-Positivos/imunologia , Linfócitos T CD8-Positivos/imunologia , Ativação Linfocitária , Glicoproteínas de Membrana/fisiologia , Fator de Necrose Tumoral alfa/fisiologia , Proteínas Reguladoras de Apoptose , Complexo CD3/fisiologia , Antígenos CD59/fisiologia , Divisão Celular , Células Cultivadas , Proteína Ligante Fas , Fase G2 , Humanos , Interleucina-2/farmacologia , Glicoproteínas de Membrana/análise , Ligante Indutor de Apoptose Relacionado a TNF , Fator de Necrose Tumoral alfa/análiseRESUMO
Tumor cells have developed multiple mechanisms to evade control by the immune system. Tumoral cells expressing Fas ligand (FasL) have been proposed to "counterattack" against activated antitumoral effector immune cells, although some authors have indicated that FasL is not expressed on the surface of the same tumors, such in the case of melanoma cells. However, other factors could be implicated, such as the balance of soluble versus membrane-bound forms or the secretion of death ligands on the surface of microvesicles, as described previously by our group in human T cells. In the present study, we analyzed the expression and secretion of FasL and APO2 ligand (APO2L)/TRAIL in the human melanoma cell line MelJuSo. We have observed the expression of preformed FasL and APO2L/TRAIL in these cells, their secretion associated with microvesicles upon melanoma activation with PHA or with alpha-melanocyte stimulating hormone (alpha-MSH), and the toxicity of these microvesicles against normal human T cell blasts. We have also observed that the mechanism of secretion of FasL and APO2L/TRAIL from melanoma cells is depending both on microtubules and actin filaments. From these data, it can be concluded that the MelJuSo melanoma cell line has the possibility to "counterattack" against activated immune effector cells. However, the in vivo outcome seems more complex since it has been also described that FasL expressed in tumors has a proinflammatory effect.
Assuntos
Melanoma/metabolismo , Glicoproteínas de Membrana/metabolismo , Vesículas Secretórias/metabolismo , Linfócitos T/citologia , Fator de Necrose Tumoral alfa/metabolismo , Receptor fas/metabolismo , Actinas/metabolismo , Proteínas Reguladoras de Apoptose , Divisão Celular , Linhagem Celular Tumoral , Sobrevivência Celular , Técnicas de Cocultura , Testes Imunológicos de Citotoxicidade , Humanos , Membranas Intracelulares/fisiologia , Células Jurkat , Ligantes , Ativação Linfocitária , Melanoma/imunologia , Melanoma/patologia , Potenciais da Membrana/efeitos dos fármacos , Microtúbulos/metabolismo , Mitocôndrias/fisiologia , Fito-Hemaglutininas/farmacologia , Vesículas Secretórias/efeitos dos fármacos , Vesículas Secretórias/imunologia , Vesículas Secretórias/ultraestrutura , Linfócitos T/imunologia , Ligante Indutor de Apoptose Relacionado a TNF , alfa-MSH/farmacologia , Receptor fas/imunologiaRESUMO
Fas/CD95 is a type-I membrane glycoprotein, which inducesapoptotic cell death when ligated by its physiological ligand. We generated previously hyperproliferative sublines derived from the human T-cell leukemia Jurkat, Jurkat-ws and Jurkat-hp, which lost Fas/CD95 surface expression. We have now observed that the total amount of Fas protein is similar in the sublines and in the parental cells, indicating that in the sublines Fas remains in an intracellular compartment. We have found that the protein is directed toward lysosomes in the sublines, where it is degraded. This defect in the secretory pathway correlates with loss of polyunsaturated fatty acids from cellular lipids, and with the lack of expression of endophilin-I and CtBP/BARS, enzymes that regulate vesicle fission by catalyzing the acylation of arachidonate into lysophosphatidic acid. In addition, great multillamer bodies, which contained acid phosphatase activity, absent in the parental Jurkat cells, were observed by transmission electron microscopy in the sublines.