Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL.

The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells.

Microwave hydrothermal synthesis of calcium antimony oxide hydroxide with high photocatalytic activity toward benzene.

A nanocrystalline CaSb2O5(OH)2 photocatalyst synthesized from CaCl2 and K2H2Sb2O7 was used to degrade benzene in the gas phase for the first time. The obtained sample was characterized by X-ray diffraction, N2 sorption-desorption, UV-vis diffuse reflectance spectroscopy, transmission electron microscopy, electron spin resonance, and X-ray photoelectron spectroscopy. The CaSb2O5(OH)2 sample had an average particle size of approximately 8 nm, a specific surface area of 101.8 m2 g(-1), and a band gap of 4.6 eV. Photocatalytic activity of the sample was mainly evaluated by the degradation of benzene in an O2 gas stream under ultraviolet light irradiation. The results demonstrated that the photoactivity of CaSb2O5(OH)2 was higher than that of commercial TiO2 (P25, Degussa Co.). In the photocatalytic degradation of benzene, it finally reached a steady conversion ratio of 29%. CaSb2O5(OH)2 has also exhibited activity toward other aromatic organic compounds. A possible mechanism of photocatalysis over CaSb2O5(OH)2 nanocrystals was proposed.

Efficient degradation of benzene over LaVO4/TiO2 nanocrystalline heterojunction photocatalyst under visible light irradiation.

A nanocrystal heterojunction LaVO4TiO2 visible light photocatalyst has been successfully prepared by a simple coupled method. The catalyst was characterized by powder X-ray diffraction, nitrogen adsorption-desorption, transmission electron microscopy, UV-vis diffuse reflectance spectroscopy, X-ray photoelectron spectra, photoluminescence, and electrochemistry technology.The results showed that the prepared nanocomposite catalysts exhibited strong photocatalytic activity for decomposition of benzene under visible light irradiation with high photochemical stability. The enhanced photocatalytic performance of LaVO4/TiO2 may be attributed to not only the matched band potentials but also interconnected heterojunction of LaVO4 and TiO2 nanoparticles.

H2-O2 atmosphere increases the activity of Pt/TiO2 for benzene photocatalytic oxidation by two orders of magnitude.

Unprecedented photocatalytic activity and durability of Pt/TiO(2) for decomposing persistent organic pollutants (e.g. benzene) have been obtained by adding trace H(2) into an O(2)-rich photooxidation system.