Isolation, identification, and mechanism analysis of plant growth-promoting rhizobacteria in tobacco.

Plant growth, crop yield, and pest and disease control are enhanced by PGPR (Plant growth promoting rhizobacteria), which are beneficial microorganisms found in a close symbiosis with plant roots. Phytohormones are secreted, nutrient uptake is improved, and soil properties along with the microbiological environment are regulated by these microorganisms, making them a significant focus in agricultural research. In this study, the efficient PGPR strain T1 was isolated and screened from tobacco inter-root soil, and identified and confirmed by ITS sequencing technology. Tobacco growth indicators and soil property changes were observed and recorded through potting experiments. The activities of key enzymes (e.g., sucrase, catalase, urease) in soil were further determined. High-throughput sequencing technology was utilized to sequence the soil microbial community, and combined with macro-genomics analysis, the effects of T1 strain on soil microbial diversity and metabolic pathways were explored. Following the application of T1, significant improvements were observed in the height, leaf length, and width of tobacco plants. Furthermore, the physical and chemical properties of the soil were notably enhanced, including a 26.26% increase in phosphorus availability. Additionally, the activities of key soil enzymes such as sucrase, catalase, and urease were significantly increased, indicating improved soil health and fertility. Comprehensive joint microbiomics and macrogenomics analyses revealed a substantial rise in the populations of beneficial soil microorganisms and an enhancement in metabolic pathways, including amino acid metabolism, synthesis, and production of secondary metabolites. These increase in beneficial microorganisms and the enhancement of their metabolic functions are crucial for plant growth and soil fertility. This study provides valuable references for the development of innovative microbial fertilizers and offers programs for the sustainable development of modern agriculture.

A CD8+ T cell related immune score predicts survival and refines the risk assessment in acute myeloid leukemia.

Although advancements in genomic and epigenetic research have deepened our understanding of acute myeloid leukemia (AML), only one-third of patients can achieve durable remission. Growing evidence suggests that the immune microenvironment in bone marrow influences prognosis and survival in AML. There is a specific association between CD8+ T cells and the prognosis of AML patients. To develop a CD8+ T cell-related immune risk score for AML, we first evaluated the accuracy of CIBERSORTx in predicting the abundance of CD8+ T cells in bulk RNA-seq and found it significantly correlated with observed single-cell RNA sequencing data and the proportions of CD8+ T cells derived from flow cytometry. Next, we constructed the CTCG15, a 15-gene prognostic signature, using univariate and LASSO regression on the differentially expressed genes between CD8+ THigh and CD8+ TLow groups. The CTCG15 was further validated across six datasets in different platforms. The CTCG15 has been shown to be independent of established prognostic markers, and can distill transcriptomic consequences of several genetic abnormalities closely related to prognosis in AML patients. Finally, integrating this model into the 2022 European LeukemiaNet contributed to a higher predictive power for prognosis prediction. Collectively, our study demonstrates that CD8+ T cell-related signature could improve the comprehensive risk stratification and prognosis prediction in AML.

First report of tomato as a natural host of tobacco vein banding mosaic virus (TVBMV) in Yunnan, China.

Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.

Three RNA helicase DDX genes are essential for the development and oocyte maturation in Laodelphax striatellus.

BACKGROUND: DEAD-box protein (DDX) is a member of the DDX RNA helicase family that exerts multiple functions in RNA metabolism, cell cycle, tumorigenesis, signal pathway, and fertility, particularly in mammals. Nevertheless, the biological functions of DDXs in insects have not been fully resolved and attracted increasing attention these years. Laodelphax striatellus (Hemiptera) is a notorious rice pest through feeding on rice sap and transmitting plant viruses. In this study, we aim to elucidate the functional characterization of DDXs in L. striatellus, and to exploit potential target genes for the development of pest control strategies. RESULTS: In this study, we characterized the expression patterns of LsDDX6, LsDDX47, and LsDDX51 in planthoppers and analyzed their conserved motifs. These genes were found to be expressed in all tissues and developmental stages examined, with significantly higher transcript levels observed in the ovary. Knockdown of LsDDX6, LsDDX47, and LsDDX51 resulted in an obvious lethal phenotype in nymphs and abnormal ovarian development in adults. Furthermore, a total of 27 DDXs were identified in L. striatellus, and most DDXs were highly expressed in ovary and structure analysis result revealed that all of the DDXs possessed nine motifs that were unique to the DDX family. CONCLUSION: The three DDX RNA helicases (LsDDX6, LsDDX47, and LsDDX51) are essential for both survivorship and reproduction in L. striatellus. Considering a total number of 27 DDXs identified in L. striatellus, they might serve as promising candidates for application in RNAi-based control of this destructive pest. © 2024 Society of Chemical Industry.

Combination of transcriptomic and proteomic approaches helps unravel the mechanisms of luteolin in inducing liver cancer cell death via targeting AKT1 and SRC.

Introduction: Luteolin, a natural compound commonly used in traditional Chinese medicine, shows clinical potential as an anti-liver cancer agent. The mechanisms underlying the anti-liver cancer effect of luteolin are limited versus those reported for other cancers. Accordingly, this study was conducted to bridge the existing knowledge gap. Methods: Transcriptomic and proteomic analyses of the response of the hepatocellular carcinoma cell line HuH-7 to luteolin were conducted, and a possible pathway was elucidated using confocal laser scanning microscopy (CLSM), flow cytometry, western blotting, qRT-PCR and bio-layer interferometry assay to systematically explore the possible mechanisms underlying the inhibition of the proliferation of liver cancer cells by luteolin. Results and Discussion: Results showed that luteolin significantly inhibited HuH-7 cell proliferation. Transcriptomic and proteomic analyses collectively revealed that luteolin could promote cell cycle arrest and apoptosis in HuH-7 cells through transcription factors p53, nuclear factor kappa B (NF-κB), FOXO, ATF2, and TCF/LEF via AKT1, as well as the KEAP-NRF and SRC-STAT3 pathways. Furthermore, AKT1 and SRC were identified as the 2 targets of luteolin. Nuclear translocation of transcription factors p53 and NF-κB were affected by luteolin administration. Additionally, AKT1 activity affected normal metabolism in HuH-7 cells and resulted in the accumulation of reactive oxygen species, which activated MOMP and further promoted apoptosis. Our results systematically elucidate the mechanism of luteolin in inhibiting the proliferation of liver cancer cells, mainly through cell cycle arrest and apoptosis via targeting AKT1 and SRC.

Genomic data provides insights into the evolutionary history and adaptive differentiation of two tetraploid strawberries.

Over the decades, evolutionists and ecologists have shown intense interest in the role of polyploidization in plant evolution. Without clear knowledge of the diploid ancestor(s) of polyploids, we would not be able to answer fundamental ecological questions such as the evolution of niche differences between them or its underlying genetic basis. Here, we explored the evolutionary history of two Fragaria tetraploids, Fragaria corymbosa and Fragaria moupinensis. We de novo assembled five genomes including these two tetraploids and three diploid relatives. Based on multiple lines of evidence, we found no evidence of subgenomes in either of the two tetraploids, suggesting autopolyploid origins. We determined that Fragaria chinensis was the diploid ancestor of F. corymbosa while either an extinct species affinitive to F. chinensis or an unsampled population of F. chinensis could be the progenitor of F. moupinensis. Meanwhile, we found introgression signals between F. chinensis and Fragaria pentaphylla, leading to the genomic similarity between these two diploids. Compared to F. chinensis, gene families related to high ultraviolet (UV)-B and DNA repair were expanded, while those that responded towards abiotic and biotic stresses (such as salt stress, wounding, and various pathogens) were contracted in both tetraploids. Furthermore, the two tetraploids tended to down-regulate defense response genes but up-regulate UV-B response, DNA repairing, and cell division gene expression compared to F. chinensis. These findings may reflect adaptions toward high-altitude habitats. In summary, our work provides insights into the genome evolution of wild Fragaria tetraploids and opens up an avenue for future works to answer deeper evolutionary and ecological questions regarding the strawberry genus.

First report of potato virus H infecting tomato (Solanum lycopersicum) in China.

Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae, was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato (Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana, and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.

Ivosidenib in Chinese patients with relapsed or refractory isocitrate dehydrogenase 1 mutated acute myeloid leukemia: a registry study.

Ivosidenib, an isocitrate dehydrogenase 1 (IDH1) inhibitor, has demonstrated clinical benefits in a pivotal study (AG120-C-001) in patients with IDH1-mutated (mIDH1) acute myeloid leukemia (AML). A registry study (CS3010-101: NCT04176393) was conducted to assess the pharmacokinetic (PK) characteristics, safety, and efficacy of ivosidenib in Chinese patients with relapsed or refractory (R/R) mIDH1 AML. Patients received ivosidenib 500 mg once daily for 28-day cycles until disease progression. Ten subjects underwent intensive PK/progressive disease (PD) assessments. All subjects had the clinical response assessed at screening, every 28 days through month 12, and then every 56 days. Between November 12, 2019, and April 2, 2021, 30 patients were enrolled; 26 (86.7%) had de novo AML and 18 (60.0%) were transfusion-dependent at baseline. Following single and repeated doses of ivosidenib, median time to maximum plasma concentration (T max) was 4.0 and 2.0 hours, respectively. The inter-individual variability of pharmacokinetic exposure was moderate to high (coefficient of variation [CV], 25%-53%). No obvious accumulation was observed after repeated doses at cycle 2 day 1. Regarding the clinical response, the CR + CRh rate was 36.7% (95% confidence interval [CI]: 19.9%-56.1%), the median duration of CR + CRh was 19.7 months (95% CI: 2.9 months-not reached [NR]), and median duration of response (DoR) was 14.3 months (95% CI: 6.4 months-NR). Consistent clinical benefits and safety of ivosidenib were consistently observed at the final data cutoff with median follow-up time 26.0 months, as compared with primary data cutoff, and the data from Chinese R/R mIDH1 AML patients were also consistent with results from pivotal study.

Diversifying the anthracycline class of anti-cancer drugs identifies aclarubicin for superior survival of acute myeloid leukemia patients.

The efficacy of anthracycline-based chemotherapeutics, which include doxorubicin and its structural relatives daunorubicin and idarubicin, remains almost unmatched in oncology, despite a side effect profile including cumulative dose-dependent cardiotoxicity, therapy-related malignancies and infertility. Detoxifying anthracyclines while preserving their anti-neoplastic effects is arguably a major unmet need in modern oncology, as cardiovascular complications that limit anti-cancer treatment are a leading cause of morbidity and mortality among the 17 million cancer survivors in the U.S. In this study, we examined different clinically relevant anthracycline drugs for a series of features including mode of action (chromatin and DNA damage), bio-distribution, anti-tumor efficacy and cardiotoxicity in pre-clinical models and patients. The different anthracycline drugs have surprisingly individual efficacy and toxicity profiles. In particular, aclarubicin stands out in pre-clinical models and clinical studies, as it potently kills cancer cells, lacks cardiotoxicity, and can be safely administered even after the maximum cumulative dose of either doxorubicin or idarubicin has been reached. Retrospective analysis of aclarubicin used as second-line treatment for relapsed/refractory AML patients showed survival effects similar to its use in first line, leading to a notable 23% increase in 5-year overall survival compared to other intensive chemotherapies. Considering individual anthracyclines as distinct entities unveils new treatment options, such as the identification of aclarubicin, which significantly improves the survival outcomes of AML patients while mitigating the treatment-limiting side-effects. Building upon these findings, an international multicenter Phase III prospective study is prepared, to integrate aclarubicin into the treatment of relapsed/refractory AML patients.

Musashi orchestrates melanism in Laodelphax striatellus.

In insects, melanism, a fundamental pigmentation process, is of significant importance in evolutionary biology due to its complex genetic foundation. We investigated the role of the RNA-binding gene Musashi (msi) in melanism in Laodelphax striatellus, a Hemiptera species. We identified a single L. striatellus msi homolog, Lsmsi, encoding a 357 amino acid protein with 2 RNA recognition motifs. RNA interference-mediated knockdown of LsMsi resulted in complete body melanism and increased cuticular permeability. Additionally, we found the involvement of G protein-coupled receptor A42 and tyrosine hydroxylase (Th) in L. striatellus melanism. Knockdown of LsTh lightened the epidermis, showing dehydration signs, while LsA42 knockdown enhanced LsTh expression, leading to melanism. Surprisingly, Lsmsi knockdown decreased both LsA42 and LsTh expression, which was expected to cause whitening but resulted in melanism. Further, we found that Lsmsi influenced downstream genes like phenoloxidase homolog LsPo and dopa decarboxylase (Ddc) homolog LsDdc in the tyrosine-mediated melanism pathway. Extending to Nilaparvata lugens and Sogatella furcifera, we demonstrated the conserved role of msi in melanism among Delphacidae. Given MSI proteins' roles in cancer and tumors in vertebrates, our study is the first to link msi in insects to Delphacidae body color melanization via the tyrosine-mediated pathway, offering fresh perspectives on the genetic basis of insect melanism and msi functions.

A Cell-Penetrating Peptide Improves Anti-HER2 Single-Chain Variable Fragment Internalization and Antitumor Activity against HER2-Positive Breast Cancer In Vitro and In Vivo.

Cell-penetrating peptides (CPPs) are invaluable tools for delivering various substances into cells by crossing biological membranes. However, the effects of cell-penetrating peptide fusion proteins on the biological activity of antibodies remain to be fully understood. Here, we engineered a recombinant protein, LP-scFv, which combines the single-chain variable region of anti-human epidermal growth factor receptor-2 with a novel and non-oxic cell-penetrating peptide as a leader peptide. The introduction of this leader peptide led to a more than twofold increase in the internalization efficiency of the single-chain antibody, as confirmed using microscopic analysis and flow cytometry. The effects of the single-chain antibodies and LP-scFv on cell viability were evaluated using the MTT assay. Both the single-chain antibodies and LP-scFv reduced the viability of BT474 and NCI-N87 cells in a dose-dependent manner while exhibiting minimal toxicity towards MCF-7 and MCF-10A cells. Further investigation into LP-scFv's mechanism revealed that the induced leader peptide does not alter the MAPK-ERK1/2 and PI3K/AKT pathways of single-chain antibodies. An enhanced antitumor activity was also confirmed in an NCI-N87 tumor xenograft model in mice with a reduction of 45.2% in tumor growth inhibition (vs. 23.1% for scFv) with a 50 mg/kg dose after orthotopic injection administration, which was equivalent to that of trastuzumab (vs. 55.7% for trastuzumab). Overall, these results indicate that LP-scFv exhibits significant permeation activity in HER2-positive cells to enhance the intracellular dose effect on antitumor activity in vitro and in vivo. This research lays the foundation for designing novel antibody-based therapies for cancer.

Molecular Characterization of an Isolate of Bean Common Mosaic Virus First Identified in Gardenia Using Metatranscriptome and Small RNA Sequencing.

Gardenia (Gardenia jasminoides) is a popular and economically vital plant known for its ornamental and medicinal properties. Despite its widespread cultivation, there has been no documentation of plant viruses on gardenia yet. In the present study, gardenia leaves exhibiting symptoms of plant viral diseases were sampled and sequenced by both metatranscriptome and small RNA sequencing. As a consequence, bean common mosaic virus (BCMV) was identified in gardenia for the first time and named BCMV-gardenia. The full genome sequence of BCMV-gardenia is 10,054 nucleotides (nt) in length (excluding the poly (A) at the 3' termini), encoding a large polyprotein of 3,222 amino acids. Sequence analysis showed that the N-termini of the polyprotein encoded by BCMV-gardenia is less conserved when compared to other BCMV isolates, whereas the C-termini is the most conserved. Maximum likelihood phylogenetic analysis showed that BCMV-gardenia was clustered closely with other BCMV isolates identified outside the leguminous plants. Our results indicated that the majority of BCMV-gardenia virus-derived small interfering RNAs (vsiRNAs) were 21 nt and 22 nt, with 21 nt being more abundant. The first nucleotide at the 5' termini of vsiRNAs derived from BCMV-gardenia preferred U and A. The ratio of vsiRNAs derived from sense (51.1%) and antisense (48.9%) strands is approaching, and the distribution of vsiRNAs along the viral genome is generally even, with some hot spots forming in local regions. Our findings could provide new insights into the diversity, evolution, and host expansion of BCMV and contribute to the prevention and treatment of this virus.

Mutant U2AF1-Induced Mis-Splicing of mRNA Translation Genes Confers Resistance to Chemotherapy in Acute Myeloid Leukemia.

Patients with primary refractory acute myeloid leukemia (AML) have a dismal long-term prognosis. Elucidating the resistance mechanisms to induction chemotherapy could help identify strategies to improve AML patient outcomes. Herein, we retrospectively analyzed the multiomics data of more than 1,500 AML cases and found that patients with spliceosome mutations had a higher risk of developing refractory disease. RNA splicing analysis revealed that the mis-spliced genes in refractory patients converged on translation-associated pathways, promoted mainly by U2AF1 mutations. Integrative analyses of binding and splicing in AML cell lines substantiated that the splicing perturbations of mRNA translation genes originated from both the loss and gain of mutant U2AF1 binding. In particular, the U2AF1S34F and U2AF1Q157R mutants orchestrated the inclusion of exon 11 (encoding a premature termination codon) in the eukaryotic translation initiation factor 4A2 (EIF4A2). This aberrant inclusion led to reduced eIF4A2 protein expression via nonsense-mediated mRNA decay. Consequently, U2AF1 mutations caused a net decrease in global mRNA translation that induced the integrated stress response (ISR) in AML cells, which was confirmed by single-cell RNA sequencing. The induction of ISR enhanced the ability of AML cells to respond and adapt to stress, contributing to chemoresistance. A pharmacologic inhibitor of ISR, ISRIB, sensitized U2AF1 mutant cells to chemotherapy. These findings highlight a resistance mechanism by which U2AF1 mutations drive chemoresistance and provide a therapeutic approach for AML through targeting the ISR pathway. SIGNIFICANCE: U2AF1 mutations induce the integrated stress response by disrupting splicing of mRNA translation genes that improves AML cell fitness to enable resistance to chemotherapy, which can be targeted to improve AML treatment.

Cellular hierarchy insights reveal leukemic stem-like cells and early death risk in acute promyelocytic leukemia.

Acute promyelocytic leukemia (APL) represents a paradigm for targeted differentiation therapy, with a minority of patients experiencing treatment failure and even early death. We here report a comprehensive single-cell analysis of 16 APL patients, uncovering cellular compositions and their impact on all-trans retinoic acid (ATRA) response in vivo and early death. We unveil a cellular differentiation hierarchy within APL blasts, rooted in leukemic stem-like cells. The oncogenic PML/RARα fusion protein exerts branch-specific regulation in the APL trajectory, including stem-like cells. APL cohort analysis establishes an association of leukemic stemness with elevated white blood cell counts and FLT3-ITD mutations. Furthermore, we construct an APL-specific stemness score, which proves effective in assessing early death risk. Finally, we show that ATRA induces differentiation of primitive blasts and patients with early death exhibit distinct stemness-associated transcriptional programs. Our work provides a thorough survey of APL cellular hierarchies, offering insights into cellular dynamics during targeted therapy.

Cardiac effects of deferasirox in transfusion-dependent patients with myelodysplastic syndromes: TELESTO study.

Iron overload from repeated transfusions has a negative impact on cardiac function, and iron chelation therapy may help prevent cardiac dysfunction in transfusion-dependent patients with myelodysplastic syndromes (MDS). TELESTO (NCT00940602) was a prospective, placebo-controlled, randomised study to evaluate the iron chelator deferasirox in patients with low- or intermediate-1-risk MDS and iron overload. Echocardiographic parameters were collected at screening and during treatment. Patients receiving deferasirox experienced a significant decrease in the composite risk of hospitalisation for congestive heart failure (CHF) or worsening of cardiac function (HR = 0.23; 95% CI: 0.05, 0.99; nominal p = 0.0322) versus placebo. No significant differences between the arms were found in left ventricular ejection fraction, ventricular diameter and mass or pulmonary artery pressure. The absolute number of events was low, but the enrolled patients were younger than average for patients with MDS, with no serious cardiac comorbidities and a modest cardiovascular risk profile. These results support the effectiveness of deferasirox in preventing cardiac damage caused by iron overload in this patient population. Identification of patients developing CHF is challenging due to the lack of distinctive echocardiographic features. The treatment of iron overload may be important to prevent cardiac dysfunction in these patients, even those with moderate CHF risk.

Co-option of a non-retroviral endogenous viral element in planthoppers.

Non-retroviral endogenous viral elements (nrEVEs) are widely dispersed throughout the genomes of eukaryotes. Although nrEVEs are known to be involved in host antiviral immunity, it remains an open question whether they can be domesticated as functional proteins to serve cellular innovations in arthropods. In this study, we found that endogenous toti-like viral elements (ToEVEs) are ubiquitously integrated into the genomes of three planthopper species, with highly variable distributions and polymorphism levels in planthopper populations. Three ToEVEs display exon‒intron structures and active transcription, suggesting that they might have been domesticated by planthoppers. CRISPR/Cas9 experiments revealed that one ToEVE in Nilaparvata lugens, NlToEVE14, has been co-opted by its host and plays essential roles in planthopper development and fecundity. Large-scale analysis of ToEVEs in arthropod genomes indicated that the number of arthropod nrEVEs is currently underestimated and that they may contribute to the functional diversity of arthropod genes.

Complete genome sequence of Paris polyphylla chlorotic mottle virus infecting Paris polyphylla var. yunnanensis in southwest China.

A novel virus infecting a Paris polyphylla var. yunnanensis plant, tentatively named "Paris polyphylla chlorotic mottle virus" (PpCMV), was discovered in the city of Lijiang, Yunnan Province, China. Its genome consists of 6384 nucleotides (nt), excluding the 3'-terminal poly(A) tail, and contains two open reading frames: ORF1 and ORF2. ORF1 is 6150 nt in length, encoding a large 2050-aa polyprotein with at least two conserved regions encoding a replication-associated protein and a coat protein, the latter of which is located at the 3' end of ORF1. ORF2, consisting of 1185 nt, is located within ORF1 but has a different reading frame. It encodes a 394-aa-long putative movement protein. Phylogenetic analysis based on amino acid sequences revealed that the newly discovered virus exhibited the closest relationship to Hobart betaflexivirus 1 and rhodiola betaflexivirus 1, both of which belong to the genus Capillovirus, sharing 48.8% and 36.5% amino acid sequence identity, respectively, in the structural protein. This is the first report of the complete genome sequence of PpCMV in China.

miR­149­3p suppresses the proliferation and metastasis of glioma cells by targeting the CBX2/Wnt/ß­catenin pathway.

The present study aimed to investigate the role of miR-149-3p/chromobox 2 (CBX2)/Wnt/ß-catenin pathway in the proliferation and metastasis of glioma cells. The expression and clinical significance of miR-149-3p and CBX2 were analyzed using data from public databases. Cell Counting Kit-8 and colony formation assays were performed to measure cell proliferation. Transwell assays were used to assess cell invasion. The results showed that miR-149-3p was downregulated and CBX2 was upregulated in glioma, and that the downregulated expression of miR-149-3p promoted the proliferation and invasion of glioma cells. In addition, downregulated expression of CBX2 suppressed the proliferation and invasion of glioma cells. Dual-luciferase assay indicated that CBX2 is a target gene of miR149-3p. The possible molecular mechanism of CBX2 was probed by western blotting, which showed that it may further affect the Wnt/ß-catenin pathway. These present findings demonstrated that miR-149-3p may function as a tumor suppressor miRNA by directly regulating CBX2 and serve important roles in the malignancy of glioma.

Gene polymorphism and prediction of toxicity to platinum-based chemotherapy in patients with gynecologic cancer.

The relationship between single nucleotide polymorphisms (SNPs) at various loci and adverse drug reactions (ADRs) in patients with gynecologic cancer receiving platinum-based chemotherapy (PPCT) remains unexplored. This research aimed to investigate the correlation between SNPs at several loci (e.g., GSTP1 rs1695, MTHFR rs1801133, XPC rs2228001, TP53 rs1042522, and ERCC1 rs3212986) and ADRs in patients with gynecologic cancer receiving PPCT. A total of 244 patients with gynecologic cancer who received first-line PPCT were included in this retrospective study. Blood fluorescence quantitative polymerase chain reaction was used to detect genotypes. Logistic regression, Pearson's Chi-square test, and Fisher's exact test were used to explore the correlations between these SNPs and the occurrence of ADRs. The logistic regression results showed that different genotypes of the five genes had no statistical significance in the overall grade greater than or equal to 3 ADRs. The results of Pearson's Chi-square test showed the same results. On specific adverse reactions, we found that the rs1042522 GG genotype significantly increased the risk of grade greater than or equal to 3 leucopenia compared with the CG and the CC genotypes (p = 0.002). The rs1695 AG genotype showed higher correlation for grade greater than or equal to 3 neutropenia (p = 0.020). The rs2228001 CC genotype also had a higher risk for grade greater than or equal to 3 neutropenia (p = 0.003). This study found that whereas the overall grade greater than or equal to 3 adverse reactions in patients with gynecologic cancer receiving PPCT were not associated with SNPs, specific SNPs (rs1042522 GG, rs1695 AG, and rs2228001 CC) were linked to higher risks of leucopenia and neutropenia, indicating their potential as predictors of hematotoxicity in PPCT-treated patients with gynecologic cancer.

Horizontally Transferred Salivary Protein Promotes Insect Feeding by Suppressing Ferredoxin-Mediated Plant Defenses.

Herbivorous insects such as whiteflies, planthoppers, and aphids secrete abundant orphan proteins to facilitate feeding. Yet, how these genes are recruited and evolve to mediate plant-insect interaction remains unknown. In this study, we report a horizontal gene transfer (HGT) event from fungi to an ancestor of Aleyrodidae insects approximately 42 to 190 million years ago. BtFTSP1 is a salivary protein that is secreted into host plants during Bemisia tabaci feeding. It targets a defensive ferredoxin 1 in Nicotiana tabacum (NtFD1) and disrupts the NtFD1-NtFD1 interaction in plant cytosol, leading to the degradation of NtFD1 in a ubiquitin-dependent manner. Silencing BtFTSP1 has negative effects on B. tabaci feeding while overexpressing BtFTSP1 in N. tabacum benefits insects and rescues the adverse effect caused by NtFD1 overexpression. The association between BtFTSP1 and NtFD1 is newly evolved after HGT, with the homologous FTSP in its fungal donor failing to interact and destabilize NtFD1. Our study illustrates the important roles of horizontally transferred genes in plant-insect interactions and suggests the potential origin of orphan salivary genes.