RESUMO
BACKGROUND: The Da Vinci robot-assisted surgery technique has been widely used in laparoscopic mesangectomy for rectal cancer. However, the short-term efficacy of these procedures compared to traditional laparoscopic surgery remains controversial. The purpose of this study was to compare and analyze the short- and medium-term efficacy of Da Vinci robot and laparoscopic surgery in total mesangectomy (TME) for rectal cancer, so as to provide guidance and reference for clinical practice. AIM: To investigate the safety and long-term efficacy of robotic and laparoscopic total mesorectal resection for the treatment of rectal cancer. METHODS: The clinicopathologic data of 240 patients who underwent TME for rectal cancer in the Anorectal Department of People's Hospital of Xinjiang Uygur Autonomous Region from August 2018 to March 2023 were retrospectively analyzed. Among them, 112 patients underwent laparoscopic TME (L-TME) group, and 128 patients underwent robotic TME (R-TME) group. The intraoperative, postoperative, and follow-up conditions of the two groups were compared. RESULTS: The conversion rate of the L-TME group was greater than that of the R-TME group (5.4% vs 0.8%, χ 2 = 4.417, P = 0.036). The complication rate of the L-TME group was greater than that of the R-TME group (32.1% vs 17.2%, χ 2 = 7.290, P = 0.007). The percentage of positive annular margins in the L-TME group was greater than that in the R-TME group (7.1% vs 1.6%, χ 2 = 4.658, P = 0.031). The 3-year disease-free survival (DFS) rate and overall survival (OS) rate of the L-TME group were lower than those of the R-TME group (74.1% vs 85.2%, χ 2 = 4.962, P = 0.026; 81.3% vs 91.4%, χ 2 = 5.494, P = 0.019); in patients with American Joint Committee on Cancer stage III DFS rate and OS rate in the L-TME group were significantly lower than those in the R-TME group (52.5% vs 76.1%, χ 2 = 5.799, P = 0.016; 65.0% vs 84.8%, χ 2 = 4.787, P = 0.029). CONCLUSION: Compared with the L-TME group, the R-TME group had a better tumor prognosis and was more favorable for patients with rectal cancer, especially for patients with stage III rectal cancer.
RESUMO
Rationale: Macrophages play a central role in the development and progression of nonalcoholic fatty liver disease (NAFLD). Studies have shown that Notch signaling mediated by transcription factor recombination signal binding protein for immunoglobulin kappa J region (RBP-J), is implicated in macrophage activation and plasticity. Naturally, we asked whether Notch signaling in macrophages plays a role in NAFLD, whether regulating Notch signaling in macrophages could serve as a therapeutic strategy to treat NAFLD. Methods: Immunofluorescence staining was used to detect the changes of macrophage Notch signaling in the livers of human patients with NAFLD and choline deficient amino acid-defined (CDAA) diet-fed mice. Lyz2-Cre RBP-Jflox or wild-type C57BL/6 male mice were fed with CDAA or high fat diet (HFD) to induce experimental steatohepatitis or steatosis, respectively. Liver histology examinations were performed using hematoxylin-eosin (H&E), Oil Red O staining, Sirius red staining and immunohistochemistry staining for F4/80, Col1α1 and αSMA. The expression of inflammatory factors, fibrosis or lipid metabolism associated genes were evaluated by quantitative reverse transcription (qRT)-PCR, Western blot or enzyme-linked immunosorbent assay (ELISA). The mRNA expression of liver samples was profiled by using RNA-seq. A hairpin-type decoy oligodeoxynucleotides (ODNs) for transcription factor RBP-J was loaded into bEnd.3-derived exosomes by electroporating. Mice with experimental NAFLD were treated with exosomes loading RBP-J decoy ODNs via tail vein injection. In vivo distribution of exosomes was analyzed by fluorescence labeling and imaging. Results: The results showed that Notch signaling was activated in hepatic macrophages in human with NAFLD or in CDAA-fed mice. Myeloid-specific RBP-J deficiency decreased the expression of inflammatory factors interleukin-1 beta (IL1ß) and tumor necrosis factor alpha (TNFα), attenuated experimental steatohepatitis in mice. Furthermore, we found that Notch blockade attenuated lipid accumulation in hepatocytes by inhibiting the expression of IL1ß and TNFα in macrophages in vitro. Meanwhile, we observed that tail vein-injected exosomes were mainly taken up by hepatic macrophages in mice with steatohepatitis. RBP-J decoy ODNs delivered by exosomes could efficiently inhibit Notch signaling in hepatic macrophages in vivo and ameliorate steatohepatitis or steatosis in CDAA or HFD mice, respectively. Conclusions: Combined, macrophage RBP-J promotes the progression of NAFLD at least partially through regulating the expression of pro-inflammatory cytokines IL1ß and TNFα. Infusion of exosomes loaded with RBP-J decoy ODNs might be a promising therapy to treat NAFLD.
Assuntos
Hepatopatia Gordurosa não Alcoólica , Humanos , Masculino , Camundongos , Animais , Hepatopatia Gordurosa não Alcoólica/metabolismo , Fator de Necrose Tumoral alfa/metabolismo , Camundongos Endogâmicos C57BL , Fígado/metabolismo , Dieta Hiperlipídica/efeitos adversos , Fatores de Transcrição/metabolismoRESUMO
Liver transplantation is the optimal treatment for patients with end-stage liver disease, metabolic liver diseases, and hepatic malignancies that are not amenable to resection. Hepatic ischemia-reperfusion injury (IRI) is the main problem in liver transplantation and liver resection, leading to parenchymal cell injury and organ dysfunction. The damage of liver sinusoidal endothelial cells (LSECs) is a critical event in IRI. LSECs work as an important regulating factor of liver regeneration after partial hepatectomy. This review primarily describes the mechanisms of LSECs injury in IRI and explores the roles of LSECs in liver regeneration, and briefly introduces the protective strategies targeting LSECs damaged in IRI.
Assuntos
Hepatopatias , Traumatismo por Reperfusão , Humanos , Células Endoteliais/metabolismo , Células Endoteliais/patologia , Fígado/patologia , Hepatócitos/patologia , Hepatopatias/patologia , Hepatectomia/efeitos adversos , Traumatismo por Reperfusão/etiologia , Traumatismo por Reperfusão/prevenção & controle , Traumatismo por Reperfusão/metabolismoRESUMO
AIMS: Tumour budding (TB) activity, cell nest size (CNS), and desmoplastic reaction (DR) have been confirmed to be significantly correlated with prognosis in oesophageal squamous cell cancer (ESCC) recently. However, there are limited data on the prognostic significance of combined assessment of cellular dissociation and tumour stroma in ESCC. METHODS: In all, 265 cases with resected ESCCs diagnosed between January 2018 and August 2019 were retrospectively reviewed. All slides were reviewed for assessing TB, CNS, and DR. The Cellular Dissociation Grading and our Combined CNS and DR (CNS/DR) Grading systems were adopted to re-grade ESCCs. RESULTS: High TB activity, small CNS, and immature DR had a strong association with shorter overall survival (OS) and progression-free survival (PFS) (P < 0.001, respectively) in ESCC. Combined assessment of CNS and DR in a 4-tiered grading system displayed a prognostic excellence for survival (P < 0.001), and outperformed the Cellular Dissociation Grading for both OS (area under the curve [AUC], 0.728 versus 0.644, P = 0.043) and PFS (AUC, 0.763 versus 0.667, P = 0.018) by receiver operator characteristic curves. Also, Combined CNS/DR Grading showed superiority in recognizing a G4 subgroup with the worst outcome in our cohort, to whom the most urgent attention needs to be called. CONCLUSIONS: This is the first study to propose a novel Combined Grading system based on CNS and DR in ESCC, which has been demonstrated to be relatively superior to Cellular Dissociation Grading in predicting prognosis. The findings shed new light on the histopathological grading of ESCC and facilitates identifying biologically aggressive ESCCs.
Assuntos
Neoplasias Esofágicas , Carcinoma de Células Escamosas do Esôfago , Intervalo Livre de Doença , Neoplasias Esofágicas/patologia , Carcinoma de Células Escamosas do Esôfago/diagnóstico , Carcinoma de Células Escamosas do Esôfago/patologia , Humanos , Gradação de Tumores , Prognóstico , Estudos RetrospectivosRESUMO
Enzymes are very important for biological processes in a living being, performing similar or multiple tasks in and out of cells, tissues and other organisms at a particular location. The abnormal activity of particular enzyme usually caused serious diseases such as Alzheimer's disease, Parkinson's disease, cancers, diabetes, cardiovascular diseases, arthritis etc. Hence, nondestructive and real-time visualization for certain enzyme is very important for understanding the biological issues, as well as the drug administration and drug metabolism. Fluorescent cellular probe-based enzyme detectionin vitroandin vivohas become broad interest for human disease diagnostics and therapeutics. This review highlights the recent findings and designs of highly sensitive and selective fluorescent cellular probes targeting enzymes for quantitative analysis and bioimaging.
Assuntos
Enzimas/metabolismo , Corantes Fluorescentes/química , Sondas Moleculares/química , Animais , Linhagem Celular Tumoral , Enzimas/química , HumanosRESUMO
This study aimed to explore the association of tumor sidedness with the prognosis of patients with colon signet ring cell carcinoma (SRCC). Eligible patients were retrieved from the Surveillance, Epidemiology, and End Results database between 2004 and 2015. Cancer-specific survival (CSS) and overall survival (OS) were compared between patients with left-sided colon SRCC and those with right-sided lesions. A total of 2660 patients were included, among them, 1983 (74.5%) had right-sided colon SRCC. Compared to patients with left-sided colon SRCC, those who had the right-sided colon SRCC showed higher proportion of white race, female, aged ≥ 65 years, receiving total colectomy and ≥ 4 regional lymph node dissection; while had lower proportion of advanced AJCC stage. Besides, right-sided patients exhibited superior 5-year CSS (32.74% vs. 25.89%, P = 0.001) and OS (27.38% vs. 23.02%, P = 0.024) rates compared with left-sided ones. Multivariate analysis revealed that tumor sidedness was an independent prognostic factor. To be specific, patients with right-sided colon SRCC showed better CSS (HR: 0.873; 95% CI 0.777-0.981; P = 0.023) and OS (HR: 0.838; 95% CI 0.753-0.965; P = 0.002). Moreover, subgroup analysis demonstrated superior CSS and OS for right-sided patients in most subgroups. Tumor sidedness was an independent prognostic indicator for colon SRCC. Besides, patients with right-sided colon SRCC have superior prognosis than those with left-sided lesions.
Assuntos
Carcinoma de Células em Anel de Sinete/mortalidade , Carcinoma de Células em Anel de Sinete/cirurgia , Neoplasias do Colo/mortalidade , Neoplasias do Colo/cirurgia , Lateralidade Funcional , Fatores Etários , Idoso , Carcinoma de Células em Anel de Sinete/patologia , Colectomia , Neoplasias do Colo/patologia , Feminino , Humanos , Excisão de Linfonodo , Masculino , Prognóstico , Grupos Raciais , Fatores Sexuais , Taxa de SobrevidaRESUMO
Spinal cord injury (SCI) leads to severe and long-lasting neurological disability. Presently, the lack of effective therapies for SCI is largely attributable to an incomplete understanding of its pathogenesis. F-box and WD repeat domain-containing protein 7 (FBW7, also known as FBXW7) is a type of E3 ubiquitin ligase complex, and plays essential roles in regulating different pathological and physiological processes. In this study, we attempted to explore the effects of FBW7 on SCI progression by the in vivo and in vitro experiments. SCI mice showed significantly reduced expression of FBW7 in spinal cord tissues. Promoting FBW7 expression via intrathecal injection of AAV9/FBW7 effectively improved locomotor function in SCI mice. Neuronal death in spinal cords of SCI mice was obviously ameliorated by FBW7 over-expression, along with greatly decreased expression of cleaved Caspase-3. In addition, microglial activation in spinal cord specimens was detected in SCI mice through increasing Iba-1 expression levels, which was, however, attenuated in SCI mice injected with AAV9/FBW7. Additionally, FBW7 over-expression dramatically restrained inflammatory response in spinal cord tissues of SCI mice, as evidenced by the down-regulated expression of tumor necrosis factor-α (TNF-α) and interleukin 1ß (IL-1ß) through blocking the activation of nuclear factor-κB (NF-κB) signaling. These anti-inflammatory effects of FBW7 were confirmed in LPS-stimulated mouse microglial BV2 cells. Finally, our in vitro studies showed that conditional medium (CM) collected from LPS-incubated BV2 cells markedly induced apoptosis in the isolated primary spinal neurons; However, this effect was overtly ameliorated by CM from LPS-exposed BV2 cells over-expressing FBW7. Thus, FBW7-regulated inflammation in microglial cells was involved in the amelioration of neuronal apoptosis during SCI development. Collectively, these findings illustrated that FBW7 expression was down-regulated in spinal cords of SCI mice, and promoting its expression could effectively mitigate SCI progression by repressing microglial inflammation and neuronal death.
Assuntos
Apoptose , Proteína 7 com Repetições F-Box-WD/metabolismo , Neurônios/citologia , Traumatismos da Medula Espinal/metabolismo , Animais , Linhagem Celular , Células Cultivadas , Feminino , Camundongos , Camundongos Endogâmicos C57BL , Microglia/metabolismo , Mielite/metabolismo , Ratos Sprague-DawleyRESUMO
The aim of the present study was to explore the antitumor effects of sinoporphyrin sodium (DVDMS)mediated photodynamic therapy (PDT) and sonodynamic therapy (SDT) in glioma, and to reveal the underlying mechanisms. The uptake of DVDMS by U118 MG cells was detected by flow cytometry (FCM). A 630nm semiconductor laser and 1MHz ultrasound were used to perform PDT and SDT, respectively. Cell proliferation and apoptosis were evaluated using the Cell Counting Kit8 assay, FCM and Hoechst 33258 staining, respectively. Western blot analysis was used to detect protein expression and phosphorylation levels. BALB/c nude mice were used to establish a xenograft model of U118 MG cells. DVDMS was injected intravenously and PDT and SDT were performed 24 h later. An in vivo imaging system was used to evaluate the fluorescence of DVDMS, to measure tumor sizes, and to evaluate the therapeutic effects. The uptake of DVDMS by U118 MG cells was optimal after 4 h. PDT and SDT following DVDMS injection significantly inhibited the proliferation and increased apoptosis of glioma cells in vitro (P<0.05, P<0.01) respectively. In vivo, the fluorescence intensity of DVDMS was lower in the PDT and SDT groups compared with the DVDMS group, while tumor cell proliferation and weight were lower in the PDT and SDT groups than in the control group (P<0.05, P<0.01). However, there was no significant difference when laser, ultrasound or DVDMS were applied individually, compared with the control group. Hematoxylin and eosin staining suggested that both PDT and SDT induced significant apoptosis and vascular obstruction in cancer tissues. DVDMSmediated PDT and SDT inhibited the expression levels of proliferating cell nuclear antigen (PCNA) and BclxL, increased cleaved caspase 3 levels, and decreased the protein phosphorylation of the PI3K/AKT/mTOR signaling pathway. Changes in the expression of PCNA, and BclxL and in the levels of cleavedcaspase 3 were partly reversed by NacetylLcysteine, a reactive oxygen species (ROS) scavenger. Similar results were obtained with FCM. DVDMSmediated PDT and SDT inhibited glioma cell proliferation and induced cell apoptosis in vitro and in vivo, potentially by increasing the generation of ROS and affecting protein expression and phosphorylation levels.
Assuntos
Glioma/terapia , Fotoquimioterapia , Porfirinas/farmacologia , Terapia por Ultrassom , Animais , Apoptose/efeitos dos fármacos , Apoptose/efeitos da radiação , Linhagem Celular Tumoral , Proliferação de Células/efeitos dos fármacos , Proliferação de Células/efeitos da radiação , Terapia Combinada , Citometria de Fluxo , Glioma/patologia , Humanos , Lasers Semicondutores/uso terapêutico , Camundongos , Espécies Reativas de Oxigênio/metabolismo , Ensaios Antitumorais Modelo de XenoenxertoRESUMO
To compare the clinicopathological characteristics and survival outcomes of children and adult diagnosed with medullary thyroid carcinoma (MTC). MTC patients were extracted from the Surveillance, Epidemiology and End Results (SEER) database from 1998 to 2016, followed by stratification into pediatric (< 20 years) or adult (≥ 20 years) groups. In total, 2,197 patients (110 pediatric and 2087 adult) with MTC were identified. Pediatric patients were more likely to have localized stage (70.0% vs. 51.6%), negative regional nodes (48.2% vs. 30.8%) and receive total/subtotal thyroidectomy surgery (97.3% vs. 85.3%). Moreover, CSS and OS rates were significantly higher in pediatric patients (both P < 0.001). Multivariable Cox regression analysis revealed that adult patients were significantly correlated with worse CSS and OS rates [(CSS: HR 11.60, 95% CI 1.62-83.02, P = 0.015); (OS: HR 5.63, 95% CI 2.08-15.25, P = 0.001)]. Further stratified analysis indicated that pediatric group might have significant better CSS and OS for patients with more advanced stage. Patients in the pediatric group were more likely to have earlier stage. Moreover, the prognosis of pediatric MTC patients was significantly better than that in adult patients.
Assuntos
Carcinoma Neuroendócrino/epidemiologia , Programa de SEER , Neoplasias da Glândula Tireoide/epidemiologia , Adolescente , Adulto , Carcinoma Neuroendócrino/diagnóstico , Carcinoma Neuroendócrino/patologia , Carcinoma Neuroendócrino/terapia , Criança , Pré-Escolar , Feminino , Humanos , Masculino , Análise Multivariada , Análise de Sobrevida , Neoplasias da Glândula Tireoide/diagnóstico , Neoplasias da Glândula Tireoide/patologia , Neoplasias da Glândula Tireoide/terapia , Adulto JovemRESUMO
This study aimed to assess the benefit of postoperative adjuvant chemotherapy in stage II-III colorectal signet ring cell carcinoma (SRCC). Qualified postoperative patients were extracted from Surveillance, Epidemiology, and End Results (SEER) database from 2004 until 2015. We collected 1675 patients in the research, and 936 patients were subjected to adjuvant chemotherapy group. The proportions of married status, male, rectal cancer, grade III/IV, AJCC stage III and radiotherapy were higher; While, the rates of white race, ≥ 65 years old and located in cecum-transverse colon were lower in patients of chemotherapy group compared to no chemotherapy group (all P < 0.05). K-M plots revealed significantly better OS of adjuvant chemotherapy group than no chemotherapy group (P < 0.001). Meanwhile, there was no significantly different in CSS between the two groups (P = 0.93). However, after adjusting for confounding factors by multivariable Cox regression analysis, receipt of postoperative chemotherapy was still associated with better CSS and OS (CSS: hazard ratio [HR] = 0.719, 95% CI 0.612-0.844, P < 0.001) ; (OS: HR = 0.618, 95% CI 0.537-0.713, P < 0.001). Patients with stage II/III colorectal SRCC could receive survival benefit from postoperative adjuvant chemotherapy.
Assuntos
Carcinoma de Células em Anel de Sinete/tratamento farmacológico , Quimioterapia Adjuvante/métodos , Neoplasias Colorretais/tratamento farmacológico , Idoso , Carcinoma de Células em Anel de Sinete/mortalidade , Carcinoma de Células em Anel de Sinete/patologia , Ceco/patologia , Colo Transverso/patologia , Neoplasias Colorretais/mortalidade , Neoplasias Colorretais/patologia , Bases de Dados Factuais , Feminino , Humanos , Masculino , Estadiamento de Neoplasias , Período Pós-Operatório , Prognóstico , Programa de SEER , Análise de SobrevidaRESUMO
OBJECTIVES: The survival benefit of postmastectomy radiotherapy (PMRT) has not been fully proven in inflammatory breast cancer (IBC). Thus, in the present research, we aimed at elucidating the effects of PMRT on the survival of IBC patients. METHODS: Eligible patients were collected from the Surveillance, Epidemiology, and End Results (SEER) dataset between 2010 and 2013. The Kaplan-Meier method along with the log-rank test was utilized for the comparison of both the overall survival (OS) andthe cancer-specific survival (CSS) in patients undergoing PMRT or not. Additionally, multivariate survival analysis of CSS and OS were performed using the Cox proportional hazard model. RESULTS: In total, 293 eligible cases were identified, with the median follow-up time of 27 months (range: 5-59 months). After propensity score matching (PSM), 188 patients (94 for each) were classified intothe No-PMRT and the PMRT group. Consequently, significantly higher OS rates were detected in the PMRT group compared with the No-PMRT group prior to PSM (P = 0.034), and significantly higher CSS (P = 0.013) and OS (P = 0.0063) rates were observed following PSM. Furthermore, multivariate analysis revealed thatPMRT [CSS (HR: 0.519, 95% CI [0.287-0.939], P = 0.030); OS (HR: 0.480, 95% CI [0.269-0.859], P = 0.013)], as well as Her2+/HR+ subtype, was independent favorable prognostic factors.Besides, black ethnicity, AJCC stage IV and triple-negative subtype were independent unfavorable prognostic factors. Further subgroup analysis revealed that most of the study population could benefit from PMRT, no matter OS or CSS. CONCLUSIONS: Our findings support that PMRT could improve the survival of IBC patients.
RESUMO
The overall survival rate of patients with hepatocellular carcinoma (HCC) has remained unchanged over the last several decades. Therefore, novel drugs and therapies are required for HCC treatment. Isoliquiritigenin (ISL), a natural flavonoid predominantly isolated from the traditional Chinese medicine Glycyrrhizae Radix (Licorice), has a high anticancer potential and broad application value in various cancers. Here, we aimed to investigate the anticancer role of ISL in the HCC cell line Hep3B. Functional analysis revealed that ISL inhibited the proliferation of Hep3B cells by causing G1/S cell cycle arrest in vitro. Meanwhile, the inhibitory effect of ISL on proliferation was also observed in vivo. Further analysis revealed that ISL could suppress the migration and metastasis of Hep3B cells in vitro and in vivo. Mechanistic analysis revealed that ISL inhibited cyclin D1 and up-regulated the proteins P21, P27 that negatively regulate the cell cycle. Furthermore, ISL induced apoptosis while inhibiting cell cycle transition. In addition, phosphatidylinositol 3'-kinase/protein kinase B (PI3K/AKT) signal pathway was suppressed by ISL treatment, and the epithelial marker E-cadherin was up-regulated when the mesenchymal markers Vimentin and N-cadherin were down-regulated. In brief, our findings suggest that ISL could be a promising agent for preventing HCC tumorigenesis and metastasis.
Assuntos
Movimento Celular/efeitos dos fármacos , Proliferação de Células/efeitos dos fármacos , Chalconas/farmacologia , Ciclina D1/metabolismo , Fosfatidilinositol 3-Quinases/metabolismo , Proteínas Proto-Oncogênicas c-akt/metabolismo , Transdução de Sinais/efeitos dos fármacos , Animais , Apoptose/efeitos dos fármacos , Carcinoma Hepatocelular/tratamento farmacológico , Carcinoma Hepatocelular/metabolismo , Ciclo Celular/efeitos dos fármacos , Linhagem Celular Tumoral , Regulação para Baixo/efeitos dos fármacos , Feminino , Humanos , Neoplasias Hepáticas/tratamento farmacológico , Neoplasias Hepáticas/metabolismo , Camundongos , Camundongos Endogâmicos BALB C , Camundongos NusRESUMO
BACKGROUND: Pancreatic mixed serous-neuroendocrine neoplasms (MSNNs) are mixed tumors containing two components with different pathologies, namely, pancreatic serous cystic neoplasm (PSCN) and pancreatic neuroendocrine tumor (PanNET). For MSNNs, diffuse PSCN involving the whole pancreas is extremely rare, with only eight previous case reports. CASE SUMMARY: A 45-year-old Chinese woman, with a free previous medical history and no obvious symptoms, was found to have a pancreatic neoplasm and admitted to our hospital for further diagnosis in March 2018. Abdominal palpation revealed a painless, mobile mass in the epigastrium, and no abnormalities were observed in an examination of the nervous system and ocular system. A computed tomography scan showed multiple cystic lesions involving the whole pancreas ranging in diameter from 0.4 to 2 cm and also revealed an enhanced mass, 2.2 cm in diameter, in the head of the pancreas. Moreover, multiple cysts were found in the kidneys bilaterally, and the right lobe of the liver contained a small cyst. A Whipple operation with total pancreatectomy and splenectomy was performed. A diagnosis of pancreatic MSNN was established, consisting of diffuse serous microcystic cystadenoma with a concomitant grade 2 PanNET. Of note, the patient had no personal or family history of Von Hippel-Lindau syndrome or other disease. CONCLUSION: We report the first case of MSNN with a diffuse PSCN component involving the entire pancreas in a Chinese woman. It is important to be aware of its relationship with VHL syndrome, and close clinical follow-up is recommended.
RESUMO
BACKGROUND: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. METHODS: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. RESULTS: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (râ=â0.65869, Pâ=â0.0014) between infectious group and control group was observed. CONCLUSIONS: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.
Assuntos
Meningite Criptocócica/líquido cefalorraquidiano , Meningite Criptocócica/genética , Biologia Computacional , Cryptococcus/patogenicidade , Testes Diagnósticos de Rotina , Feminino , Genótipo , Humanos , Masculino , Meningite Criptocócica/diagnóstico , Análise MultivariadaRESUMO
OBJECTIVE: The study was designed to construct and validate a nomogram for predicting overall survival (OS) of male breast cancer (MBC) patients with infiltrating duct carcinoma (IDC). METHODS: The cohort was selected from the Surveillance, Epidemiology, and End Results (SEER) database between January 1, 2004 and December 31, 2013. Univariate and multivariate Cox proportional hazard (PH) regression models were performed. A nomogram was developed based on the significant prognostic indicators of OS. The discriminatory and predictive capacities of nomogram were assessed by Harrell's concordance index (C-index), calibration plots, area under the curve (AUC) and the decision curve analysis (DCA). RESULTS: The median and maximal survival time of 1862 eligible patients were 49 and 131 months, respectively. Multivariate analysis showed that age (P < 0.0001), marital status (P = 0.002), T stage (P < 0.0001), N stage (P = 0.021), M stage (P < 0.0001), progesterone receptor (PR) (P = 0.046), human epidermal growth factor receptor-2 (HER2) (P = 0.009), and chemotherapy (P = 0.003) were independent prognostic indicators of IDC of MBC. The eight variables were then combined to construct a 3-and 5-year nomogram. The C-indexes of the nomogram were0.740 (95% confidence interval [CI] [0.709-0.771]) and 0.718 (95% CI [0.672-0.764]) for the internal validation and external validation, respectively. A better discriminatory capacity was observed in the nomogram compared with the SEER summary stage (P < 0.001) and AJCC TNM staging systems (6th edition; P < 0.001) with respect to OS prediction. Good consistency was detected between the nomogram prediction and actual findings, as indicated by calibration curves. The AUC for 3-and 5-year OS was 0.739 (95% CI [0.693-0.786]) and 0.764 (95% CI [0.725-0.803]) in the training cohort and 0.737 (95% CI [0.671-0.803]) and 0.735 (95% CI [0.678-0.793]) in the validation cohort, respectively. The DCA demonstrated that the survival nomogram was clinically useful. CONCLUSIONS: The nomogram was able to more accurately predict 3-and 5-year OS of MBC patients with IDC histology than were existing models.
RESUMO
OBJECTIVES: The aim of this analysis was to study the impact of marital status on inflammatory breast cancer (IBC) patients, as the prognostic impact is yet to be studied in detail. METHODS: Data of IBC patients from 2004 to 2010 were sorted out from the database of surveillance, epidemiology, and end results (SEER), and overall survival (OS) rates and breast cancer-specific survival (CSS) rates were compared between a group of married and unmarried patients. The comparison was performed by Kaplan-Meier method with log-rank test, and multivariate survival analysis of CSS and OS was performed using the Cox proportional hazard model. RESULTS: Data of 1342 patients were collected from the SEER database, on an average 52% of married patients (n = 698, 52.01%) and 48% of unmarried patients (n = 644, 47.99%) for this analysis. Married patients were more likely to be more younger (aged ≤ 56) (52.44% vs. 43.94%), white ethnicity (83.24% vs. 71.58%), HoR positive (48.28% vs. 41.61%), more patients received surgery (78.51% vs. 64.60%), chemotherapy (90.69% vs. 80.12%) and radiotherapy (53.44% vs. 44.41%) compared to unmarried group, and less likely to be AJCC stage IV (26.22% vs. 35.40%) (All P Ë 0.05). Married patients had better 5-year CSS (74.90% vs. 65.55%, P < 0.0001) and OS rates (45.43% vs. 33.11%, P < 0.0001). The multivariate analysis revealed that marital status is an independent prognostic factor, whereas the data of unmarried patients showed worse CSS (HR 1.188; 95% CI 1.033-1.367; P = 0.016) and OS rates (HR 1.245; 95% CI 1.090-1.421; P = 0.001).The subgroup analysis further revealed that the OS and CSS rates in the married group were better than the unmarried group, regardless of different AJCC stages. CONCLUSION: Marital status was an independent prognostic indicator in IBC patients. As the study reveals, the CSS and OS rates of the married patients were better than those of the unmarried patients.
Assuntos
Neoplasias Inflamatórias Mamárias/epidemiologia , Estado Civil , Adulto , Idoso , Idoso de 80 Anos ou mais , Animais , Bases de Dados Factuais , Modelos Animais de Doenças , Suscetibilidade a Doenças , Feminino , Humanos , Neoplasias Inflamatórias Mamárias/diagnóstico , Neoplasias Inflamatórias Mamárias/mortalidade , Neoplasias Inflamatórias Mamárias/terapia , Estimativa de Kaplan-Meier , Pessoa de Meia-Idade , Gradação de Tumores , Estadiamento de Neoplasias , Vigilância da População , Prognóstico , Modelos de Riscos Proporcionais , Medição de Risco , Fatores de Risco , Programa de SEER , Adulto JovemRESUMO
BACKGROUND: This study was designed to investigate the clinicopathological characteristics, treatment and survival of patients with pulmonary large cell neuroendocrine carcinoma (LCNEC). METHODS: The Surveillance, Epidemiology and End Results database was utilized to identify patients diagnosed with pulmonary LCNEC between 2004 and 2013. Kaplan-Meier analysis was conducted to determine the overall survival (OS) and cancer-specific survival (CSS) rate. Univariate survival analysis along with log-rank test, and Cox proportional hazards model were employed to detect independent prognostic factors. RESULTS: Pulmonary LCNEC accounted for 0.58% (2972/510607) of the total number of lung and bronchus carcinoma. And a total of 1,530 eligible cases were identified, with the median follow-up time of 11 months. To be specific, the 3-, 5-year OS and CSS rates were 22.8%, 16.8% and 26.5%, 20.8% respectively. Generally, pulmonary LCNEC was commonly detected in the elderly (72.2%), males (55.9%), the upper lobe (62.0%) and advanced AJCC stage (65.5%). Multivariate analysis revealed that elderly [(≥60 and <80 years) HR:1.203, 95% CI [1.053-1.375], P = 0.007; (≥80 years) HR:1.530, 95% CI [1.238-1.891], P < 0.001] and advanced AJCC stage [(stage III) HR:2.606, 95% CI [2.083-3.260], P < 0.001; (stage IV) HR:4.881, 95% CI [3.923-6.072], P < 0.001] were independent unfavorable prognostic factors, and that female (HR:0.845, 95% CI [0.754-0.947], P = 0.004)), surgery [(Segmentectomy/wedge resection) HR:0.526, 95% CI [0.413-0.669], P < 0.001; (Lobectomy/Bilobectomy) HR:0.357, 95% CI [0.290-0.440], P < 0.001;(Pneumonectomy) HR:0.491, 95% CI [0.355-0.679], P < 0.001] , chemotherapy (HR:0.442, 95% CI [0.389-0.503], P < 0.001) and radiation (HR:0.837, 95% CI [0.738-0.949], P = 0.005) were independent favorable prognostic factors. CONCLUSION: To sum up, age at diagnosis, sex, AJCC 8th edition stage, surgery, chemotherapy and radiation were significantly associated with OS of patients with pulmonary LCNEC.
RESUMO
[This corrects the article DOI: 10.18632/oncotarget.19856.].
RESUMO
ETHNOPHARMACOLOGICAL RELEVANCE: For many years, Guangzhou University of Chinese Medicine has been successfully using the empirical Wenyang Huoxue Jiedu formula (WHJF) to treat coronary heart disease. Modern theories of acute coronary syndrome mainly focus on rupture of thin-cap fibroatheromas (TCFAs), which is closely related to the release of vascular endothelial growth factor and its receptor (VEGF/VEGFR). AIM OF STUDY: We investigated the effects of WHJF on the formation of TCFA plaques and the potential mechanism (VEGF/VEGFR signaling pathway). MATERIALS AND METHODS: For the in vivo experiments, WHJF was administered to ApoE-/- mice, as a model of TCFA plaque formation. Aortic sections of the mice were obtained, and the vulnerability index and new vessel density of plaques were calculated by the Movat staining assay and immunohistochemistry kit, respectively. Protein and mRNA expression levels of VEGF/VEGFR in aortas were assayed by capillary electrophoresis immunoassay and quantitative real-time polymerase chain reaction analyses. In vitro, WHJF serum was produced in rats on the fourth day 2â¯h after the first administration of different concentrations of WHJF. Proliferation, migration, and lumen formation ability of human umbilical vein endothelial cells (HUVECs) treated with sera from these rats were assayed by the CKK-8 kit, Transwell plates, and Matrigel assay, respectively. Protein and mRNA expression levels of signaling molecules in the VEGF/VEGFR pathways were also examined. RESULTS: In vivo, the vulnerability index and new vessel density of plaques in the WHJF group were lower than those values in the blank control group (Pâ¯<â¯0.05). No differences were found between the groups in the expression levels of VEGF/VEGFR (Pâ¯>â¯0.05). In vitro, the proliferation, migration, and tube formation of HUVECs in the high-dose WHJF group were reduced compared to the control group (Pâ¯<â¯0.05). This finding was in agreement with the downregulation of VEGFR-2 and pERK (Pâ¯<â¯0.05). The mRNA expression of signaling molecules showed no difference between the groups (Pâ¯>â¯0.05). CONCLUSIONS: WHJF inhibits TCFA formation by influencing the VEGF/VEGFR signaling pathway.
Assuntos
Medicamentos de Ervas Chinesas/uso terapêutico , Placa Aterosclerótica/tratamento farmacológico , Placa Aterosclerótica/patologia , Receptores de Fatores de Crescimento do Endotélio Vascular/antagonistas & inibidores , Transdução de Sinais/efeitos dos fármacos , Fator A de Crescimento do Endotélio Vascular/antagonistas & inibidores , Animais , Medicamentos de Ervas Chinesas/isolamento & purificação , Medicamentos de Ervas Chinesas/farmacologia , Feminino , Células Endoteliais da Veia Umbilical Humana/efeitos dos fármacos , Células Endoteliais da Veia Umbilical Humana/metabolismo , Humanos , Masculino , Camundongos , Camundongos Knockout , Placa Aterosclerótica/metabolismo , Ratos , Ratos Sprague-Dawley , Receptores de Fatores de Crescimento do Endotélio Vascular/metabolismo , Transdução de Sinais/fisiologia , Fator A de Crescimento do Endotélio Vascular/metabolismoRESUMO
Zoledronic acid is used to treat patients with bone metastasis, but the optimal dosing interval remains controversial. We therefore performed a systematic review and meta-analysis to compare the efficacy and safety of a 12-week interval of zoledronic acid with the standard 4-week interval. Three randomized controlled trials comprising 2650 patients were analyzed. Using a random-effects model, pooled risk ratios (RRs) and 95% confidence intervals (CIs) were calculated. No differences in the occurrence of skeletal-related events (SREs: RR = 0.98; 95% CI = 0.86-1.12; P = 0.80) or grade 3/4 adverse events (RR = 0.91; 95% CI = 0.69-1.20; P = 0.52) were observed between the 12-week and 4-week groups. The 12-week group tended to have lower incidences of osteonecrosis of the jaw [13 (0.98%) vs. 23 (1.73%)] and kidney dysfunction [21 (1.68%) vs. 31 (2.45%)] than the 4-week group, though the difference did not reach statistical significance (RR = 0.58, 95% CI: 0.30-1.12; P = 0.11); (RR = 0.67, 95% CI: 0.39-1.15, P = 0.15). These data show that zoledronic acid administered at 12-week intervals instead of 4-week intervals does not increase the risk of SREs, and may reduce the incidence of osteonecrosis of the jaw and kidney dysfunction. This suggests the 12-week interval with zoledronic acid may be an acceptable treatment option.