Ganoderic acids alleviate atherosclerosis by inhibiting macrophage M1 polarization via TLR4/MyD88/NF-κB signaling pathway.

BACKGROUND AND AIMS: Atherosclerosis (AS) is a chronic inflammatory disease characterized by lipid infiltration and plaque formation in blood vessel walls. Ganoderic acids (GA), a class of major bioactive compounds isolated from the Chinese traditional medicine Ganoderma lucidum, have multiple pharmacological activities. This study aimed to determine the anti-atherosclerotic effect of GA and reveal the pharmacological mechanism. METHODS: ApoE-/- mice were fed a high-cholesterol diet and treated with GA for 16 weeks to induce AS and identify the effect of GA. Network pharmacological analysis was performed to predict the anti-atherosclerotic mechanisms. An invitro cell model was used to explore the effect of GA on macrophage polarization and the possible mechanism involved in bone marrow dereived macrophages (BMDMs) and RAW264.7 cells stimulated with lipopolysaccharide or oxidized low-density lipoprotein. RESULTS: It was found that GA at 5 and 25 mg/kg/d significantly inhibited the development of AS and increased plaque stability, as evidenced by decreased plaque in the aorta, reduced necrotic core size and increased collagen/lipid ratio in lesions. GA reduced the proportion of M1 macrophages in plaques, but had no effect on M2 macrophages. In vitro experiments showed that GA (1, 5, 25 µg/mL) significantly decreased the proportion of CD86+ macrophages and the mRNA levels of IL-6, IL-1ß, and MCP-1 in macrophages. Experimental results showed that GA inhibited M1 macrophage polarization by regulating TLR4/MyD88/NF-κB signaling pathway. CONCLUSIONS: This study demonstrated that GA play an important role in plaque stability and macrophage polarization. GA exert the anti-atherosclerotic effect partly by regulating TLR4/MyD88/NF-κB signaling pathways to inhibit M1 polarization of macrophages. Our study provides theoretical basis and experimental data for the pharmacological activity and mechanisms of GA against AS.

Mechanisms of Stem Cells and Their Secreted Exosomes in the Treatment of Autoimmune Diseases.

Stem cells play a therapeutic role in many diseases by virtue of their strong self-renewal and differentiation abilities, especially in the treatment of autoimmune diseases. At present, the mechanism of the stem cell treatment of autoimmune diseases mainly relies on their immune regulation ability, regulating the number and function of auxiliary cells, anti-inflammatory factors and proinflammatory factors in patients to reduce inflammation. On the other hand, the stem cell- derived secretory body has weak immunogenicity and low molecular weight, can target the site of injury, and can extend the length of its active time in the patient after combining it with the composite material. Therefore, the role of secretory bodies in the stem cell treatment of autoimmune diseases is increasingly important.

Cellular and molecular mechanisms of highly active mesenchymal stem cells in the treatment of senescence of rhesus monkey ovary.

BACKGROUND: Recent studies have shown that umbilical cord mesenchymal stem cells have an anti-aging effect in ovaries, but the cellular and molecular mechanisms of HA-MSC ovarian anti-aging remain to be studied. Therefore, we conducted a 10X Genomics single-nucleus transcriptome sequencing experiment on the ovaries of macaque monkeys after HA-MSC treatment. METHODS: The results of cell subgroup classification were visualized by 10X Genomics single nuclear transcriptome sequencing. The aging model of hGCs was established, and the migration ability of the cells was determined after coculture of HA-MSCs and aging hGCs. The genes screened by single nuclear transcriptional sequencing were verified in vitro by qPCR. RESULTS: Compared with the aging model group, the number of cell receptor pairs in each subgroup of the HA-MSC-treated group increased overall. Treatment with 200 µmol/L H2O2 for 48 h was used as the optimum condition for the induction of hGC senescence. After coculture of noncontact HA-MSCs with senescent hGCs, it was found that HA-MSCs can reverse the cell structure, proliferation ability, senescence condition, expression level of senescence-related genes, and expression level of key genes regulating the senescence pathway in normal hGCs. CONCLUSIONS: HA-MSC therapy can improve the tissue structure and secretion function of the ovary through multiple cellular and molecular mechanisms to resist ovarian aging. In vitro validation experiments further supported the results of single-cell sequencing, which provides evidence supporting a new option for stem cell treatment of ovarian senescence.

Increased Expression of Pluripotent Factors in Human Umbilical Cord Mesenchymal Stem Cells Transfected with Three tRF Molecules.

tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.

Ganoderic acid A is the effective ingredient of Ganoderma triterpenes in retarding renal cyst development in polycystic kidney disease.

Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common life-threatening monogenetic diseases characterized by progressive enlargement of fluid-filled renal cysts. Our previous study has shown that Ganoderma triterpenes (GT) retards PKD renal cyst development. In the present study we identified the effective ingredient of GT in suppression of kidney cyst development. Using an in vitro MDCK cystogenesis model, we identified ganoderic acid A (GA-A) as the most promising candidate among the 12 ganoderic acid (GA) monomers. We further showed that GA-A (6.25-100 µM) significantly inhibited cyst growth in MDCK cyst model and embryonic kidney cyst model in vitro, and the inhibitory effect was reversible. In kidney-specific Pkd1 knockout (kPKD) mice displaying severe cystic kidney disease, administration of GA-A (50 mg· kg-1 ·d-1, sc) significantly attenuated renal cyst development. In both MDCK cells and kidney of kPKD mice, we revealed that GA-A dose-dependently downregulated the Ras/MAPK signaling pathway. The expression of proliferating cell nuclear antigen (PCNA) was also suppressed, suggesting a possible effect of GA-A on cell proliferation. These experimental data suggest that GA-A may be the main ingredient of GT as a potential therapeutic reagent for treating ADPKD.

Ganoderic acid hinders renal fibrosis via suppressing the TGF-ß/Smad and MAPK signaling pathways.

Renal fibrosis is considered as the pathway of almost all kinds of chronic kidney diseases (CKD) to the end stage of renal diseases (ESRD). Ganoderic acid (GA) is a group of lanostane triterpenes isolated from Ganoderma lucidum, which has shown a variety of pharmacological activities. In this study we investigated whether GA exerted antirenal fibrosis effect in a unilateral ureteral obstruction (UUO) mouse model. After UUO surgery, the mice were treated with GA (3.125, 12.5, and 50 mg· kg-1 ·d-1, ip) for 7 or 14 days. Then the mice were sacrificed for collecting blood and kidneys. We showed that GA treatment dose-dependently attenuated UUO-induced tubular injury and renal fibrosis; GA (50 mg· kg-1 ·d-1) significantly ameliorated renal disfunction during fibrosis progression. We further revealed that GA treatment inhibited the extracellular matrix (ECM) deposition in the kidney by suppressing the expression of fibronectin, mainly through hindering the over activation of TGF-ß/Smad signaling. On the other hand, GA treatment significantly decreased the expression of mesenchymal cell markers alpha-smooth muscle actin (α-SMA) and vimentin, and upregulated E-cadherin expression in the kidney, suggesting the suppression of tubular epithelial-mesenchymal transition (EMT) partially via inhibiting both TGF-ß/Smad and MAPK (ERK, JNK, p38) signaling pathways. The inhibitory effects of GA on TGF-ß/Smad and MAPK signaling pathways were confirmed in TGF-ß1-stimulated HK-2 cell model. GA-A, a GA monomer, was identified as a potent inhibitor on renal fibrosis in vitro. These data demonstrate that GA or GA-A might be developed as a potential therapeutic agent in the treatment of renal fibrosis.

Protective effects of quercetin on cadmium-induced cytotoxicity in primary cultures of rat proximal tubular cells.

OBJECTIVE: To investigate the protective effects of quercetin on cadmium-induced cytotoxicity in primary cultures of rat proximal tubular (rPT) cells. METHODS: Primary cultures of rPT cells undergoing exponential growth were incubated with 1.0 µg/mL quercetin and/or cadmium (2.5, 5.0 µmol/L), in a serum-free medium at 37 °C at different time intervals. Commercial kits were used and flow cytometric analyses were performed on rPT cell cultures to assay apoptosis and oxidative stress. RESULTS: Exposure of rPT cells to cadmium acetate (2.5, 5.0 µmol/L) induced a decrease in cell viability, caused an increase in apoptotic rate and apoptotic morphological changes. Simultaneously, elevation of intracellular reactive oxygen species, malondialdehyde and calcium levels, depletion of mitochondrial membrane potential and intracellular glutathione, and inhibition of Na+, K+-ATPase, Ca2+-ATPase, glutathione peroxidase (GSH-Px), catalase (CAT), and superoxide dismutase (SOD) activities were revealed during the cadmium exposure of rPT cells. However, simultaneous supplementation with 1 µg/mL quercetin protected rPT cells against cadmium-induced cytotoxicity through inhibiting apoptosis, attenuating lipid peroxidation, renewing mitochondrial function and elevating the intracellular antioxidants (non-enzymatic and enzymic) levels. CONCLUSION: The present study has suggested that quercetin, as a widely distributed dietary antioxidant, contributes potentially to prevent cadmium-induced cytotoxicity in rPT cells.

[Effect of Ganoderma lucidum polysaccharides peptide on invasion of human lung carcinoma cells in vitro].

OBJECTIVE: To find out the effects of Ganoderma lucidum polysaccharides peptide (Gl-PP) on the invasion of the human lung carcinoma cell (PG cell). METHODS: PG cells were pretreated with different concentration Gl-PP in vitro, using cell proliferation assay, cell migration assay, adhesion assay, zymography and RT-PCR, then the effects of Gl-PP on proliferation, motility, adhesion and MMP-9 activity and mRNA expression of PG cells were investigated in vitro. RESULTS: Gl-PP did not directly inhibit PG cell proliferation in vitro. However, pretreated with Gl-PP, PG cells motility was inhibited significantly. PG cells adhesion was also inhibited. The activity of MMP-9 was inhibited in a dose-dependent manner, and the inhibited ratio was 41.53% at a dose of 100 mg/L Gl-PP. The mRNA expression of MMP-9 of pretreated PG cells was inhibited. CONCLUSION: Gl-PP could suppress invasion of human lung carcinoma cells in vitro.

[Comparison of the immunomodulatory effects of spore polysaccharides and broken spore polysaccharides isolated from Ganoderma lucidum on murine splenic lymphocytes and peritoneal macrophages in vitro].

OBJECTIVE: To compare the immunomodulatory effects of spore polysaccharides (Gl-SP) and broken spore polysaccharides (Gl-BSP) isolated from Ganoderma lucidum(Leyss et Fr.) Karst. on murine splenic lymphocytes and peritoneal macrophages in vitro. METHODS: Mixed lymphocyte culture reaction (MLR), lymphocyte proliferation in the presence or absence of mitogen, and the cytotoxic activity of splenic natural killer (NK) cells were detected with MTT assay in vitro. The percentage of phagocytosis of neutral red (NR) by mouse peritoneal macrophages was detected by colorimetric assay. Splenic T-lymphocyte subpopulations were measured with flow cytometry(FCM). IL-2, IFN-gamma and TNF-alpha in the culture supernatants were detected by ELISA and biological assay. Nitric oxide (NO) production was examined by Griess reaction. RESULTS: At the concentration range of 0.2-12.8 mg/L, Gl-SP and Gl-BSP were shown to increase lymphocyte proliferation in the presence or absence of mitogen, enhance NK cytotoxic activity, augment the production of TNF-alpha and NO in Gl-SP- or Gl-BSP-activated macrophages, as well the percentage of phagocytosis of NR by macrophages in vitro. Both Gl-SP and Gl-BSP could promote MLR, however, at the dose of 12.8 mg/L, Gl-BSP showed higher activity than Gl-SP in the proliferation of lymphocytes. These two kinds of polysaccharide could significantly increase the secretion of IL-2 and IFN-gamma in doublejway MLR at the concentrations of 0.2-12.8 mg/L, but Gl-BSP had stronger effects than Gl-SP at the same concentrations. Both Gl-SP and Gl-BSP could increase the ratio of T-lymphocyte subpopulations in double-way MLR. At the concentrations of 0.2-12.8 mg/L or 3.2-12.8 mg/L, Gl-BSP demonstrated more significant activity in increasing the percentage of the CD4(+) or CD8(+) subset than Gl-SP. At the concentrations of 0.2-0.8 mg/L, the ratio of the CD4(+) and CD8(+) subset in the Gl-BSP treated group was higher than that of the Gl-SP treated group. CONCLUSION: Gl-SP and Gl-BSP have similar immunomodulatory effects in vitro, as though the immunomodulatory effects of Gl-BSP are stronger than that of Gl-SP.