Bone marrow mesenchymal stem cell-derived exosomes effectively ameliorate the outcomes of rats with acute graft-versus-host disease.

Mesenchymal stem cells (MSCs) reveal multifaceted immunoregulatory properties, which can be applied for diverse refractory and recurrent disease treatment including acute graft-versus-host disease (aGVHD). Distinguishing from MSCs with considerable challenges before clinical application, MSCs-derived exosomes (MSC-Exos) are cell-free microvesicles with therapeutic ingredients and serve as advantageous alternatives for ameliorating the outcomes of aGVHD. MSC-Exos were enriched and identified by western blotting analysis, NanoSight, and transmission electron microscopy (TEM). Bone marrow-derived MSCs (denoted as MSCs) and exosomes (denoted as MSC-Exos) were infused into the aGVHD SD-Wister rat model via tail vein, and variations in general growth and survival of rats were observed. The level of inflammatory factors in serum was quantized by enzyme-linked immunosorbent assay (ELISA). The pathological conditions of the liver and intestine of rats were observed by frozen sectioning. The ratios of CD4+/CD8+ and Treg cell proportions in peripheral blood, together with the autophagy in the spleen and thymus, were analyzed by flow cytometry. After treatment with MSC-Exos, the survival time of aGVHD rats was prolonged, the clinical manifestations of aGVHD in rats were improved, whereas the pathological damage of aGVHD in the liver and intestine was reduced. According to ELISA, we found that MSC-Exos revealed ameliorative effect upon aGVHD inflammation (e.g., TNF-α, IL-2, INF-γ, IL-4, and TGF-ß) compared to the MSC group. After MSC-Exo treatment, the ratio of Treg cells in peripheral blood was increased, whereas the ratio of CD4+/CD8+ in peripheral blood and the autophagy in the spleen and thymus was decreased. MSC-Exos effectively suppressed the activation of immune cells and the manifestation of the inflammatory response in the aGVHD rat model. Our data would supply new references for MSC-Exo-based "cell-free" biotherapy for aGVHD in future.

Metabolomic landscape of overall and common cancers in the UK Biobank: A prospective cohort study.

Information about the NMR metabolomics landscape of overall, and common cancers is still limited. Based on a cohort of 83,290 participants from the UK Biobank, we used multivariate Cox regression to assess the associations between each of the 168 metabolites with the risks of overall cancer and 20 specific types of cancer. Then, we applied LASSO to identify important metabolites for overall cancer risk and obtained their associations using multivariate cox regression. We further conducted mediation analysis to evaluate the mediated role of metabolites in the effects of traditional factors on overall cancer risk. Finally, we included the 13 identified metabolites as predictors in prediction models, and compared the accuracies of our traditional models. We found that there were commonalities among the metabolic profiles of overall and specific types of cancer: the top 20 frequently identified metabolites for 20 specific types of cancer were all associated with overall cancer; most of the specific types of cancer had common identified metabolites. Meanwhile, the associations between the same metabolite with different types of cancer can vary based on the site of origin. We identified 13 metabolic biomarkers associated with overall cancer, and found that they mediated the effects of traditional factors. The accuracies of prediction models improved when we added 13 identified metabolites in models. This study is helpful to understand the metabolic mechanisms of overall and a wide range of cancers, and our results also indicate that NMR metabolites are potential biomarkers in cancer diagnosis and prevention.

APOB is a potential prognostic biomarker in hepatocellular carcinoma.

Hepatocellular carcinoma (HCC) is significantly associated with adverse prognostic outcomes. The development and progression of different types of human tumors are significantly influenced by APOB. Nevertheless, the significance and pathomechanisms of APOB in HCC have not been conclusively determined. We assessed APOB expression levels in HCC using three publicly available databases of TIMER2.0, UALCAN and Human Protein Atlas. To identify the biological function of APOB, we conducted enrichment analysis via LinkedOmics. Moreover, UALCAN was employed to assess the relationship between APOB expression and clinicopathological features among HCC patients. Additionally, the Kaplan-Meier plotter was utilized to investigate the prognostic relevance of APOB in HCC. To explore potential regulatory ncRNAs that could bind to APOB, we utilized StarBase and GEPIA. Furthermore, the correlation between APOB expression and immune cell infiltration, as well as immune checkpoint genes, was investigated using Spearman's correlation analysis in TISIDB, GEPIA, and TIMER2.0. The findings of our investigation showed a notable decrease in the expression levels of APOB among individuals diagnosed with HCC. Moreover, a noteworthy correlation was observed between the expression of APOB and immune checkpoint genes, alongside the occurrence of immune cell infiltration. The levels of APOB expression in HCC tissues also showed correlations with various clinicopathological features. According to Cox regression analysis, decreased APOB expression emerged as a potential autonomous predictor for OS, RFS, DSS, and PFS among HCC patients. Furthermore, we identified six potential pathways associated with non-coding RNA (ncRNA) as the most promising pathway for APOB in HCC. Our results illuminate the possible involvement of APOB in HCC and offer understanding into its governing mechanisms and medical importance.

Esophageal mycobiome landscape and interkingdom interactions in esophageal squamous cell carcinoma.

Background: The study purpose was to characterize the mycobiome and its associations with the expression of pathogenic genes in esophageal squamous cell carcinoma (ESCC). Methods: Patients with primary ESCC were recruited from two central hospitals. We performed internal transcribed spacer 1 (ITS1) ribosomal DNA sequencing analysis. We compared differential fungi and explored the ecology of fungi and the interaction of bacteria and fungi. Results: The mycobiota diversity was significantly different between tumors and tumor-adjacent samples. We further analysed the differences between the two groups, at the species level, confirming that Rhodotorula toruloides, Malassezia dermatis, Hanseniaspora lachancei, and Spegazzinia tessarthra were excessively colonized in the tumor samples, whereas Preussia persica, Fusarium solani, Nigrospora oryzae, Acremonium furcatum, Golovinomyces artemisiae, and Tausonia pullulans were significantly more abundant in tumor-adjacent samples. The fungal co-occurrence network in tumor-adjacent samples was larger and denser than that in tumors. Similarly, the more complex bacterial-fungal interactions in tumor-adjacent samples were also detected. The expression of mechanistic target of rapamycin kinase was positively correlated with the abundance of N. oryzae and T. pullulans in tumor-adjacent samples. In tumors, the expression of MET proto-oncogene, receptor tyrosine kinase (MET) had a negative correlation and a positive correlation with the abundance of R. toruloides and S. tessarthra, respectively. Conclusion: This study revealed the landscape of the esophageal mycobiome characterized by an altered fungal composition and bacterial and fungal ecology in ESCC.

The Landscape of Lipid Metabolism in Lung Cancer: The Role of Structural Profiling.

The aim of this study was to explore the relationship between lipids with different structural features and lung cancer (LC) risk and identify prospective biomarkers of LC. Univariate and multivariate analysis methods were used to screen for differential lipids, and two machine learning methods were used to define combined lipid biomarkers. A lipid score (LS) based on lipid biomarkers was calculated, and a mediation analysis was performed. A total of 605 lipid species spanning 20 individual lipid classes were identified in the plasma lipidome. Higher carbon atoms with dihydroceramide (DCER), phosphatidylethanolamine (PE), and phosphoinositols (PI) presented a significant negative correlation with LC. Point estimates revealed the inverse associated with LC for the n-3 PUFA score. Ten lipids were identified as markers with an area under the curve (AUC) value of 0.947 (95%, CI: 0.879-0.989). In this study, we summarized the potential relationship between lipid molecules with different structural features and LC risk, identified a panel of LC biomarkers, and demonstrated that the n-3 PUFA of the acyl chain of lipids was a protective factor for LC.

Dietary Inflammatory Nutrients and Esophageal Squamous Cell Carcinoma Risk: A Case-Control Study.

We conducted a case-control study (532 cases and 532 control) in Chinese adults to investigate the independent and interactive effects of dietary nutrients (pro- or anti-inflammation) on Esophageal Squamous Cell Carcinoma (ESCC) risk. Dietary data were collected using a food questionnaire survey that included 171 items. Two algorithms, the Least Absolute Shrinkage and Selector Operation (LASSO) and Bayesian Kernel Machine Regression (BKMR) were employed to select indicators and evaluate the interactive effect of nutrients' mixture on ESCC risk. Thirteen nutrients were selected, including three pro-inflammatory nutrients (protein, fat and carbohydrate) and ten anti-inflammatory nutrients (fiber, Vitamin A, riboflavin, niacin, Vitamin C, Fe, Se, MUFA, n-3 PUFA and n-6 PUFA). Single-exposure effects of fat, carbohydrate and fiber significantly contributed to ESCC risk. The pro-inflammatory nutrients' submodel discovered that the combined effect was statistically associated with increased ESCC risk. In addition, a higher fat level was significantly associated with ESCC risk. On the contrary, for fiber and riboflavin, the anti-inflammatory nutrients' submodel delineated a significant negative effect on the risk of ESCC. Our result implies that dietary nutrients and their inflammatory traits significantly impacted ESCC occurrence. Additional studies are warranted to verify our findings.

Development and Validation of a Prognostic Model for Esophageal Adenocarcinoma Based on Necroptosis-Related Genes.

Necroptosis is a newly developed cell death pathway that differs from necrosis and apoptosis; however, the potential mechanism of necroptosis-related genes in EAC and whether they are associated with the prognosis of EAC patients remain unclear. We obtained 159 NRGs from the Kyoto Encyclopedia of Genes and Genomes (KEGG) and performed differential expression analysis of the NRGs in 9 normal samples and 78 EAC tumor samples derived from The Cancer Genome Atlas (TCGA). Finally, we screened 38 differentially expressed NRGs (DE-NRGs). The results of the GO and KEGG analyses indicated that the DE-NRGs were mainly enriched in the functions and pathways associated with necroptosis. Protein interaction network (PPI) analysis revealed that TNF, CASP1, and IL-1B were the core genes of the network. A risk score model based on four DE-NRGs was constructed by Least Absolute Shrinkage and Selection Operator (LASSO) regression, and the results showed that the higher the risk score, the worse the survival. The model achieved more efficient diagnosis compared with the clinicopathological variables, with an area under the receiver operating characteristic (ROC) curve of 0.885. The prognostic value of this model was further validated using Gene Expression Omnibus (GEO) datasets. Gene set enrichment analyses (GSEA) demonstrated that several metabolism-related pathways were activated in the high-risk population. Single-sample GSEA (ssGSEA) provided further confirmation that this prognostic model was remarkably associated with the immune status of EAC patients. Finally, the nomogram map exhibited a certain prognostic prediction efficiency, with a C-index of 0.792 and good consistency. Thus, the prognostic model based on four NRGs could better predict the prognosis of EAC and help to elucidate the mechanism of necroptosis-related genes in EAC, which can provide guidance for the target prediction and clinical treatment of EAC patients.

Hypoxia-reinforced antitumor RNA interference mediated by micelleplexes with programmed disintegration.

The performance of polycation-mediated siRNA delivery is often hurdled by the multiple systemic and cellular barriers that pose conflicting requirements for materials properties. Herein, micelleplexes (MPs) capable of programmed disintegration were developed to mediate efficient delivery of siRNA against XIAP (siXIAP) in a hypoxia-reinforced manner. MPs were assembled from azobenzene-crosslinked oligoethylenimine (AO), acid-transformable diblock copolymer PPDHP with conjugated photosensitizer, and siXIAP. AO efficiently condensed siXIAP via electrostatic interaction, and PPDHP rendered additional hydrophobic interaction with AO to stabilize the MPs against salt. The hydrophilic PEG corona enhanced the serum stability of MPs to prolong blood circulation and promote tumor accumulation. After internalization into cancer cells, the endolysosomal acidity triggered shedding of PPDHP, exposing AO to induce endolysosomal escape. Then, light irradiation generated lethal amount of ROS, and concurrently aggravated intracellular hypoxia level to degrade AO into low-molecular weight segments, release siXIAP, and potentiate the XIAP silencing efficiency. Thus, siXIAP-mediated pro-apoptosis cooperated with generated ROS to provoke pronounced anti-cancer efficacy against Skov-3 tumors in vitro and in vivo. This study provides a hypoxia-instructed strategy to overcome the multiple barriers against anti-cancer siRNA delivery in a programmed manner. STATEMENT OF SIGNIFICANCE: The success of RNA interference (RNAi) heavily depends on delivery systems that can enable spatiotemporal control over siRNA delivery. Herein, we developed micelleplexes (MPs) constructed from hypoxia-degradable, azobenzene-crosslinked oligoethylenimine (AO) and acid-responsive, photosensitizer-conjugated diblock copolymer PPDHP, to mediate efficient anti-tumor siRNA (siXIAP) delivery via programmed disintegration. MPs possessed high salt/serum stability and underwent acid-triggered PPDHP detachment to promote endolysosomal escape. Then, light irradiation aggravated hypoxia to trigger AO degradation and intracellular siXIAP release, which cooperated with photodynamic therapy to eradicate tumor cells. This study presents a new example of hypoxia-degradable polycation to mediate hypoxia-reinforced RNAi, and it also renders an effective strategy to overcome the complicated extracellular/intracellular barriers against systemic siRNA delivery.

Analysis of multiple databases identifies crucial genes correlated with prognosis of hepatocellular carcinoma.

Despite advancements made in the therapeutic strategies on hepatocellular carcinoma (HCC), the survival rate of HCC patient is not satisfactory enough. Therefore, there is an urgent need for the valuable prognostic biomarkers in HCC therapy. In this study, we aimed to screen hub genes correlated with prognosis of HCC via multiple databases. 117 HCC-related genes were obtained from the intersection of the four databases. We subsequently identify 10 hub genes (JUN, IL10, CD34, MTOR, PTGS2, PTPRC, SELE, CSF1, APOB, MUC1) from PPI network by Cytoscape software analysis. Significant differential expression of hub genes between HCC tissues and adjacent tissues were observed in UALCAN, HCCDB and HPA databases. These hub genes were significantly associated with immune cell infiltrations and immune checkpoints. The hub genes were correlated with clinical parameters and survival probability of HCC patients. 147 potential targeted therapeutic drugs for HCC were identified through the DGIdb database. These hub genes could be used as novel prognostic biomarkers for HCC therapy.

Assessment of multiple environmental factors on the adsorptive and photocatalytic removal of gaseous formaldehyde by a nano-TiO2 colloid: Experimental and simulation studies.

Environmental factors affecting the photocatalytic oxidation of volatile organic compounds (VOCs) have previously been studied experimentally, but there are few theoretical studies, especially those on surface intermolecular forces. Because of this, it is unclear how multiple coexisting factors impact photocatalytic processes. Herein, comprehensive multi-factorial impact mechanisms of the photocatalytic oxidation of formaldehyde were assessed using experiments and density functional theory simulations. The influence of humidity, concentration, and intermediate formate was investigated using a nano-TiO2 colloid, followed by adsorption and photocatalytic simulations. The maximum photocatalytic reaction rate and degradation efficiency occurred at 50% humidity due to the initially enhanced and then weakened adsorption and photocatalysis of formaldehyde. This stemmed from the increased number of water molecules and the narrower TiO2 band gap at low humidities, as well as the competitive adsorption between formaldehyde and excess water molecules at high humidities. Upon increasing the formaldehyde concentration, its photocatalytic oxidation rate increased due to enhanced adsorption, but weakened photocatalysis decreased the photocatalytic efficiency. The intermediate formate enhanced the adsorption and inhibited photocatalysis and did not significantly change the photocatalytic oxidation rate of formaldehyde upon changing the irradiation time. These findings provide guidance for the photocatalytic oxidation of VOCs produced by industrial air pollution.

Impact of HBV infection on the association between HOTAIR SNPs and the risk of hepatocellular carcinoma: A mediation and interaction analysis.

Previous studies have demonstrated that single nucleotide polymorphisms (SNPs) rs12427129 and rs3816153 in HOX transcript antisense intergenic RNA (HOTAIR) might interact with hepatitis B virus (HBV) infection to increase the risk of hepatocellular carcinoma (HCC). However, it is unclear whether HBV infection is a potential mediator between HOTAIR rs12427129, rs3816153, and HCC. This study, including 1262 HCC cases and 1559 controls, aimed to use a four-way decomposition method to quantify the interaction and mediation effects of HBV infection in the association between rs12427129, rs3816153, and HCC. We found that rs12427129 and rs3816153 were associated with a risk of HBV infection among the controls (CC: CT+TT, adjusted odds ratio (OR)=1.77, 95% confidence interval (CI)=1.32-2.36 and GG: GT+TT, adjusted OR=0.63, 95% CI=0.48-0.82). The four-way decomposition revealed that rs12427129, rs3816153, and HBV infection had statistically significant reference interaction on HCC (excess risk (95% CI): -0.362 (-0.530, -0.195), p<0.001 and excess risk (95% CI): 0.433 (0.059, 0.808), p=0.023), and the proportion attributed to reference interaction were 110.82% and 125.27%, respectively. The pure indirect effect suggested that the rs3816153 GT + TT genotype can reduce the risk of HCC by 21.79% (excess risk (95% CI): -0.075 (-0.142, -0.009), p=0.026) when HBV infection as a mediator. Our findings suggested that HBV infection interacts or mediates with the association between rs12427129, rs3816153, and HCC. This would provide a new perspective for exploring the underlying biological mechanism between HOTAIR SNPs, HBV infection, and HCC.

The association of lncRNA SNPs and SNPs-environment interactions based on GWAS with HBV-related HCC risk and progression.

BACKGROUND: Long non-coding RNA (lncRNA) plays an essential role in hepatitis B virus-related hepatocellular carcinoma (HBV-related HCC) occurrence and development. Single nucleotide polymorphism (SNP) may affect HBV-related HCC susceptibility by altering the function of lncRNA. However, the relationship between lncRNA SNPs and HBV-related HCC occurrence and development is still unclear. METHODS: In the present study, based on HBV-related HCC genome-wide association studies, eight potentially functional SNPs from two lncRNAs were predicted using a set of bioinformatics strategies. In 643 HBV-related HCC patients, 549 CHB carriers, and 553 HBV natural clearance subjects from Southern Chinese, we evaluated associations between SNPs and HBV-related HCC occurrence or development with odds ratio (OR) and 95% confidence interval (CI) under credible genetic models. RESULTS: In HBV-related HCC patients, rs9908998 was found to significantly increase the risk of lymphatic metastasis under recessive model (Adjusted OR = 1.95, 95% CI = 1.20-3.17). Lnc-RP11-150O12.3 rs2275959, rs1008547, and rs11776545 with cancer family history may show significant multiplicative and additive interactions on HBV-related HCC susceptibility (all pAdjusted < .05). The associations of rs2275959, rs1008547, and rs11776545 with distant metastasis of HBV-related HCC patients were observed in additive model (Adjusted OR = 1.45, 95% CI = 1.06-1.97 for rs2275959; Adjusted OR = 1.45, 95% CI = 1.06-1.98 for rs1008547; Adjusted OR = 1.40, 95% CI = 1.03-1.91 for rs11776545). CONCLUSION: Taken together, lnc-ACACA-1 rs9908998, lnc-RP11-150O12.3 rs2275959, rs1008547, and rs11776545 might be predictors for HBV-related HCC risk or prognosis.

Genomic and clinical characteristics of MET exon14 alterations in a large cohort of Chinese cancer patients revealed distinct features and a novel resistance mechanism for crizotinib.

Background: Alterations in MET exon 14 (METex14) and its flanking intronic regions have been identified in a variety of cancers. Patients with METex14 alterations often benefit from MET inhibitors such as crizotinib. Given the unique mutation profiles of Chinese lung cancer patients, it is necessary to investigate the prevalence of METex14 alterations in a large cohort of cancer patients. Patients and methods: Cases carrying METex14 alterations were screened from 26,391 Chinese cancer patients by next-generation sequencing (NGS), and the clinicopathologic and molecular characteristics were reviewed. Results: Compared to Western population (~3%), the frequency of METex14 alterations is much lower in Chinese cancer patients (0.7%, n=184) and lung cancer patients (1.1%, n=175). Seventy-eight distinct METex14 alterations, including several novel alteration types were detected. Concurrent MET copy gain and non-exon14 MET mutations were also found. EGFR copy gain (11%) and mutations (8%), KRAS (5%) and PIK3CA (5%), appeared in a mutually exclusive pattern. Female patients contain much less TP53 mutations than male patients (65% vs. 24%, FDR = 0.01). Co-amplification of CDK4 and MDM2, CDK6 and EGFR were identified, which indicated cell cycle dysregulation and EGFR alteration are important co-occurring features in patients with METex 14 alteration. Of 9 tissue specimens having PD-L1 immunohistochemistry (IHC) results, 5 of them (55.5%) were found PD-L1 positive, which is comparable to other types of tumor. In 14 crizotinib-treated patients, the median progression free survival (mPFS) was 7 months. Upon resistance to crizotinib, two patients acquired secondary mutations in MET and one patient acquired BRAF p.K601E that can be a novel resistance mechanism. Conclusion: Chinese cancer patients have a relatively lower frequency of METex14 alterations compared to Western patients. Patients with METex14 alterations showed distinct molecular characteristics and the representative case study showed responses to MET tyrosine kinase inhibitor (TKI).

Mapping Intellectual Structure for the Long Non-Coding RNA in Hepatocellular Carcinoma Development Research.

Background: Emerging research suggests that long non-coding RNAs (lncRNAs) play an important role in a variety of developmental or physiological processes of hepatocellular carcinoma (HCC). Various differentially expressed lncRNAs have been identified in HCC. Thus, a deeper analysis of recent research concerning lncRNA and HCC development could provide scientists with a valuable reference for future studies. Methods: Related publications were retrieved from the Web of Science Core Collection database. CiteSpace version 5.6.R4 was employed to conduct bibliometric analysis. Several network maps were constructed to evaluate the collaborations between different countries, institutions, authors, journals, and keywords. Results: A total of 2,667 records were initially found from the year of 2010-2020. The annual related publications output had increased dramatically during these years. Although China was the most prolific country in terms of research publication, the United States played a leading role in collaborative network. The Nanjing Medical University was the most productive institute in the field of lncRNAs in HCC development. Gang Chen was the most prolific researcher, while Yang F was the most frequently co-cited author. Oncotarget, Cell, and Oncogene were the most highly co-cited journals. The most recent burst keywords were interaction, database, and pathway. Conclusion: This study provides a comprehensive overview for the field of lncRNAs in HCC development based on bibliometric and visualized methods. The results would provide a reference for scholars focusing on this field.

Association of tagSNPs at lncRNA MALAT-1 with HCC Susceptibility in a Southern Chinese Population.

As a long non-coding RNA (lncRNA) and a transcriptional regulator, Metastasis associated lung adenocarcioma transcript-1 (MALAT-1) has been reported to be associated with proliferation and metastasis of hepatocellular carcinoma (HCC). However, the effects of MALAT-1 single nucleotide polymorphisms (SNPs) on HCC remains poorly understood. This study, including 624 HCC cases and 618 controls, aimed to explore the potential associations between three common tagSNPs at MALAT-1 and HCC risk in a Southern Chinese population. No significant associations were observed between the three tagSNPs and HCC risk under any genetic models after adjusting for potential confounders. Additionally, there were no any significant associations in the stratified analysis, combined effect analysis, and multifactor dimensionality reduction (MDR) analysis. Unification analysis of mediation and interaction on HCC risk further showed that four decomposition of total effects ((controlled direct effect (CDE), the reference interaction effect (INTref), the mediated interaction effect (INTmed), or the pure indirect effect (PIE)) were also not significant. Neither was the association between the MALAT-1 SNPs and progression factors of HCC, including TNM staging, metastasis, and cancer embolus; Overall, this study suggested that tagSNPs rs11227209, rs619586, and rs3200401 at MALAT-1 were not significantly associated with HCC susceptibility. Nevertheless, large population-based studies are warranted to further explore the role of MALAT-1 SNPs in HCC incidence and development.

Correction to: Expression of Concern: Knockdown of eIF3d inhibits cell proliferation through G2/M phase arrest in non-small cell lung cancer.

The original version of this article contained an error in the shRNA sequence. The correct shRNA sequence should read as "TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT".

DNA methylation-regulated and tumor-suppressive roles of miR-487b in colorectal cancer via targeting MYC, SUZ12, and KRAS.

Human colorectal cancer (CRC), characterized by its high morbidity and lethality, seriously threatens human health and lives. MicroRNA-487b (miR-487b) is currently reported to be aberrantly expressed in several tumors, but the detailed functions and underlying mechanisms of miR-487b in CRC remain unclear. Here, we found that miR-487b is downregulated in CRC cell lines and is markedly decreased in tumor specimens derived from CRC patients. MiR-487b inhibits cell proliferation, migration and invasion and promotes the apoptosis of CRC cells in vitro. Statistical analysis of clinical samples indicates that miR-487b may serve as a biomarker for early CRC diagnosis. Inverse correlations between the expression levels of MYC, SUZ12, and KRAS and that of miR-487b exist in vitro and in CRC patient tissue specimens. Further experiments demonstrated the regulatory effects of miR-487b on MYC, SUZ12, and KRAS, and the disruption of these genes partially restores the miR-487b inhibitor-induced phenotype. Additionally, miR-487b promoter region is in a DNA hypermethylated condition and the DNA methyltransferase inhibitor 5-aza-2'-deoxycytidine (5-Aza) increases the levels of miR-487b but suppresses the expression of MYC, SUZ12, and KRAS in a time- and concentration-dependent manner in CRC cells. Collectively, miR-487b is regulated by DNA methylation and it functions as a tumor suppressor in CRC mainly through targeting MYC, SUZ12, and KRAS. Our study provides insight into the regulatory network in CRC cells, offering a new target for treating CRC patients.

SNP-SNP and SNP-environment interactions of potentially functional HOTAIR SNPs modify the risk of hepatocellular carcinoma.

HOX transcript antisense intergenic RNA (HOTAIR) has been widely regarded as a functional lncRNA contributing to multiple cancers. However, few studies have examined the effect of single nucleotide polymorphisms (SNPs) in HOTAIR on the occurrence and development of hepatocellular carcinoma (HCC). In this study, three potentially functional HOTAIR SNPs (rs17105613, rs12427129, and rs3816153) were selected using bioinformatic tools. A case-control study including 1262 cases and 1559 controls was conducted to explore the association of HOTAIR SNPs with the risk of HCC in a Southern Chinese population. We found that SNPs rs12427129 and rs3816153 were associated with the risk of HCC in dominant genetic models (CC: CT + TT, adjusted odds ratio (OR) = 0.72, 95% confidence interval (CI) = 0.57-0.90 and GG: GT + TT, adjusted OR = 1.30, 95%CI = 1.08-1.57). Additionally, SNP-environment interactions for rs12427129, rs3816153, and HBsAg status were found to enhance the risk of HCC, with FDR-P as an additive interaction equal to 0.0006 and 0.0144, respectively. In multifactor dimensionality reduction (MDR) analysis, the three-factor model (HBsAg status, rs12427129 and rs3816153) yielded the highest test accuracy of 77.74% (permutation P < 0.001). Interestingly, the effect of rs12427129 and rs3816153 on the risk of HCC could be modified by HBsAg status, while the rs12427129 CT/TT genotype could antagonize the detrimental effect of rs3816153 GT/TT genotype on HCC. Our findings suggest that rs12427129 and rs3816153, including their SNP-SNP and SNP-environment interaction with HBsAg status, potentially play important roles on the susceptibility to HCC.

MYSM1 Is Essential for Maintaining Hematopoietic Stem Cell (HSC) Quiescence and Survival.

BACKGROUND Histone H2A deubiquitinase MYSM1 has recently been shown to be essential for hematopoiesis and hematopoietic stem cell (HSC) function in both mice and humans. However, conventional MYSM1 knockouts cause partial embryonic lethality and growth retardation, and it is difficult to convincingly remove the effects of environmental factors on HSC differentiation and function. MATERIAL AND METHODS MYSM1 conditional knockout (cKO) mice were efficiently induced by using the Vav1-cre transgenic system. The Vav-Cre MYSM1 cKO mice were then analyzed to verify the intrinsic role of MYSM1 in hematopoietic cells. RESULTS MYSM1 cKO mice were viable and were born at normal litter sizes. At steady state, we observed a defect in hematopoiesis, including reduced bone marrow cellularity and abnormal HSC function. MYSM1 deletion drives HSCs from quiescence into rapid cycling, and MYSM1-deficient HSCs display impaired engraftment. In particular, the immature cycling cKO HSCs have elevated reactive oxygen species (ROS) levels and are prone to apoptosis, resulting in the exhaustion of the stem cell pool during stress response to 5-FU. CONCLUSIONS Our study using MYSM1 cKO mice confirms the important role of MYSM1 in maintaining HSC quiescence and survival.