Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Spatially resolved transcriptomics revealed local invasion-related genes in colorectal cancer.

Objective: Local invasion is the first step of metastasis, the main cause of colorectal cancer (CRC)-related death. Recent studies have revealed extensive intertumoral and intratumoral heterogeneity. Here, we focused on revealing local invasion-related genes in CRC. Methods: We used spatial transcriptomic techniques to study the process of local invasion in four CRC tissues. First, we compared the pre-cancerous, cancer center, and invasive margin in one section (S115) and used pseudo-time analysis to reveal the differentiation trajectories from cancer center to invasive margin. Next, we performed immunohistochemical staining for RPL5, STC1, AKR1B1, CD47, and HLA-A on CRC samples. Moreover, we knocked down AKR1B1 in CRC cell lines and performed CCK-8, wound healing, and transwell assays to assess cell proliferation, migration, and invasion. Results: We demonstrated that 13 genes were overexpressed in invasive clusters, among which the expression of CSTB and TM4SF1 was correlated with poor PFS in CRC patients. The ribosome pathway was increased, while the antigen processing and presentation pathway was decreased along CRC progression. RPL5 was upregulated, while HLA-A was downregulated along cancer invasion in CRC samples. Pseudo-time analysis revealed that STC1, AKR1B1, SIRPA, C4orf3, EDNRA, CES1, PRRX1, EMP1, PPIB, PLTP, SULF2, and EGFL6 were unpregulated along the trajectories. Immunohistochemic3al staining showed the expression of STC1, AKR1B1, and CD47 was increased along cancer invasion in CRC samples. Knockdown of AKR1B1 inhibited CRC cells' proliferation, migration, and invasion. Conclusions: We revealed the spatial heterogeneity within CRC tissues and uncovered some novel genes that were associated with CRC invasion.

Response of occurrence in microplastics and its adsorped cadmium capacity to simulated agricultural environmental scenarios in sludge-amended soil.

Large amounts of microplastics (MPs) enter the soil along with the amendment of sludge to soil. However, it is still unclear about the response of MPs occurrence and the adsorption behaviors of cadmium (Cd)on MPs to typical agricultural environmental scenarios. In present work, three kinds of MPs (polyethylene, polypropylene, and polystyrene) were chosen to investigate that response in three agricultural environmental scenarios with sludge-amended soil, including dry-wet alteration (7 d, five cycles), microbial addition (Bacillus subtilis, 0.05 g/g soil), and Ultraviolet (UV) irradiation (340 nm, 4 × 15 W, 4 d). The results showed that there was the highest adsorption capacity of Cd on MPs (36.21, 45.15, 12.43 µg/g for PE, PP, PS, respectively) after UV irradiation exceeding those from MPs triggered by other two scenarios). UV irradiation caused an increase in the abundance of Streptomyces, an expansion in specific surface area, a significant change in surface morphologies, an improvement in crystallinity or the formation of new crystals, and an enhancement in C-O and CO content, and then resulted in the incremental adsorption capacity of Cd on MPs. The findings are important of significance for controlling the environmental risks from sludge MPs via carrying heavy metals in the soil-plant systems.

Transcriptional regulation of NDUFA4L2 by NFIB induces sorafenib resistance by decreasing reactive oxygen species in hepatocellular carcinoma.

Sorafenib is one a first-line therapeutic drugs for advanced hepatocellular carcinoma (HCC). However, only 30% of patients benefit from sorafenib due to drug resistance. We and other groups have revealed that nuclear factor I B (NFIB) regulates liver regeneration and carcinogenesis, but its role in drug resistance is poorly known. We found that NFIB was more upregulated in sorafenib-resistant SMMC-7721 cells compared to parental cells. NFIB knockdown not only sensitized drug-resistant cells to sorafenib but also inhibited the proliferation and invasion of these cells. Meanwhile, NFIB promoted the proliferation and invasion of HCC cells in vitro and facilitated tumor growth and metastasis in vivo. Knocking down NFIB synergetically inhibited tumor growth with sorafenib. Mechanically, gene expression profiling and subsequent verification experiments proved that NFIB could bind with the promoter region of a complex I inhibitor NDUFA4L2 and promote its transcription. Transcriptional upregulation of NDUFA4L2 by NFIB could thus inhibit the sorafenib-induced reactive oxygen species accumulation. Finally, we found that NFIB was highly expressed in HCC tissues, and high NFIB expression level was associated with macrovascular invasion, advanced tumor stage, and poor prognosis of HCC patients (n = 156). In summary, we demonstrated that NFIB could transcriptionally upregulate NDUFA4L2 to enhance both intrinsic and acquired sorafenib resistance of HCC cells by reducing reactive oxygen species induction.

The prevalence of chronic medication therapy problems and pharmacists' interventions among hospitalized perioperative patients: a retrospective observational study.

BACKGROUND: Inadequate preoperative management of chronic medications can place perioperative patients at risk and cause unnecessary delays in surgical procedures. This study aims to investigate the prevalence of chronic medication therapy problems (CMTPs) in hospitalized perioperative patients and assess the relevance of pharmacists' interventions. METHODS: We conducted a retrospective study of pharmacist-led preoperative management of chronic medications in hospitalized adult patients from November 2018 to April 2019. The recorded drug-related problems (DRPs) were retrospectively reviewed and categorized according to the Pharmaceutical Care Network Europe classification V9.1 and were analyzed with a multinomial regression model to identify risk factors. RESULTS: A total of 254 DRPs were recorded, with an average of 0.52 DRPs per patient. Treatment safety (66.9%) was the most common DRP. The most frequent causes of perioperative DRPs and nonperioperative DRPs were drug selection (72.9%) and patient related (50.8%), respectively. Of the 292 documented interventions, 71.6% were fully accepted by the clinicians and patients. The majority (68.9%) of the recorded problems were completely resolved. The number of comorbidities (OR = 3.815) and the number of chronic medications taken (OR = 1.539) were risk factors for the occurrence of DRPs. CONCLUSION: The findings of this study suggest that pharmacist-led chronic medication therapy management in surgical wards may be an effective method to help reduce medication-related surgical risks and optimize the medication therapies used for the long-term treatment of chronic diseases.

Influence of sludge treatment methods on behaviors of microplastics adsorbed cadmium and its driving factors.

The complicated contamination of microplastics (MPs) and heavy metals in sludge has garnered substantial attention in recent years; however, research on the behavior of MPs loading of heavy metals in sludge after sludge treatment methods is limited. Four representative sludge treatment methods were selected herein: anaerobic digestion, thermal drying, thermal hydrolysis (TH), and aerobic composting. Before and after sludge treatment, the chemical bonding of MPs, cadmium (Cd) adsorption properties, and metabolic changes in the microbial community succession was analyzed, and the factors influencing differences in Cd sorption by sludge MPs were explored. The results revealed that Cd adsorption by MPs occurs as multilayer physical adsorption that can be well fitted by Freundlich isotherms. Compared with the other three treatments, TH led to the most significant effect on the chemical bonding properties of the MPs, with a more than two-fold increase in C-O single bonds and CO double bonds, as well as adsorption of the highest amount of Cd at 767 µg/g. In addition, sludge conductivity and water content also affected Cd sorption capacity, with correlation coefficients of 0.405 and -0.384. Pedobacter, Flavobacterium, Lysobacter, and Sphingobacterium in the sludge presented a high degree of coupling with adsorption capacity, it was inferred that the above dominant species of bacteria may affect the adsorption of Cd by microplastics through the production of extracellular enzyme forms.

Negative pressure promotes macrophage M1 polarization after Mycobacterium tuberculosis infection via the lncRNA XIST/microRNA-125b-5p/A20/NF-κB axis.

Experiments have demonstrated the regulation of long noncoding RNA (lncRNA) in tuberculosis (TB), and negative pressure treatment has been associated with the alleviation of TB. Here, we investigated the interaction of negative pressure and the lncRNA X-inactive specific transcript (XIST) in modulating Mycobacterium tuberculosis (MTB) infection. Initially, we established an in vitro cell model of MTB infection and an in vivo mouse model of MTB infection, followed by treatment with negative pressure. Then, we examined the expression of XIST, followed by analysis of the downstream miRNA of XIST. XIST was overexpressed or underexpressed through cell transfection to examine its effects on macrophage polarization via the miR-125b-5p/A2 axis. The MTB models were characterized by upregulated XIST and downregulated miR-125b-5p. XIST bound to miR-125b-5p, leading to its downregulation, and thus causing higher MTB survival in an ESAT-6-dependent manner. Additionally, negative pressure treatment decreased MTB-driven XIST expression through downregulation of A20 (an NF-κB repressor) via miR-125b-5 expression, promoting the M1 polarization program in macrophages through activation of the NF-κB pathway. In summary, negative pressure treatment after MTB infection can promote the polarization of macrophages to the proinflammatory M1 phenotype by regulating the XIST/miR-125b-5p/A20/NF-κB axis.

Effects of typical sludge treatment on microplastics in China-Characteristics, abundance and micro-morphological evidence.

Microplastics (MPs) are emerging pollutants that are enriched in sludge. They enter soil through sludge soil amendment, landfill, and discard, which will cause inescapable environmental pollution risks. Sludge treatment technology commonly used in China include anaerobic digestion (AD), thermal drying (TD), thermal hydrolysis (TH) and aerobic composting (AC). In this study, characteristics of MPs in sewage sludge from four representative large cities in China (Zhengzhou, Chongqing, Guangzhou, and Guilin) were analyzed. Effects of four representative sludge treatment technology on sludge MPs were also studied. In addition, the amount of MPs input to soil from sludge in China was estimated. The abundance range of sludge MPs of representative cities in China was 1448-11,125 n∙kg-1 DW. Previous studies indicate that this abundance range is low among other domestic cities and is close to that of European countries. MPs were predominantly fiber-shaped, accounting for 46.66%; 56.5% MPs were white and transparent, and 62.5% were polypropylene and polyethylene. The abundance of MPs in the sludge increased after TH, indicating that MPs broke into smaller particles. However, the other three treatment methods had no significant influence on the abundance of MPs. Scanning electron microscopy analysis showed that the micro-morphology of sludge MPs surface were rougher after AD, and MPs cracked following TD and TH. Furthermore, broken edges were more blurred after TH, and surfaces of MPs were damaged and eroded after AC. The input quantities of MPs in sludge to soil was deduced to be 1013 particles per year. These results are important for controlling the potential risk of sludge MPs in China.

Cytisine Exerts an Anti-Epileptic Effect via α7nAChRs in a Rat Model of Temporal Lobe Epilepsy.

Background and Purpose: Temporal lobe epilepsy (TLE) is a common chronic neurological disease that is often invulnerable to anti-epileptic drugs. Increasing data have demonstrated that acetylcholine (ACh) and cholinergic neurotransmission are involved in the pathophysiology of epilepsy. Cytisine, a full agonist of α7 nicotinic acetylcholine receptors (α7nAChRs) and a partial agonist of α4ß2nAChRs, has been widely applied for smoking cessation and has shown neuroprotection in neurological diseases. However, whether cytisine plays a role in treating TLE has not yet been determined. Experimental Approach: In this study, cytisine was injected intraperitoneally into pilocarpine-induced epileptic rats for three weeks. Alpha-bungarotoxin (α-bgt), a specific α7nAChR antagonist, was used to evaluate the mechanism of action of cytisine. Rats were assayed for the occurrence of seizures and cognitive function by video surveillance and Morris water maze. Hippocampal injuries and synaptic structure were assessed by Nissl staining and Golgi staining. Furthermore, levels of glutamate, γ-aminobutyric acid (GABA), ACh, and α7nAChRs were measured. Results: Cytisine significantly reduced seizures and hippocampal damage while improving cognition and inhibiting synaptic remodeling in TLE rats. Additionally, cytisine decreased glutamate levels without altering GABA levels, and increased ACh levels and α7nAChR expression in the hippocampi of TLE rats. α-bgt antagonized the above-mentioned effects of cytisine treatment. Conclusion and Implications: Taken together, these findings indicate that cytisine exerted an anti-epileptic and neuroprotective effect in TLE rats via activation of α7nAChRs, which was associated with a decrease in glutamate levels, inhibition of synaptic remodeling, and improvement of cholinergic transmission in the hippocampus. Hence, our findings not only suggest that cytisine represents a promising anti-epileptic drug, but provides evidence of α7nAChRs as a novel therapeutic target for TLE.

3D Finite Element Analysis of the Modular Prosthesis with Tooth Mechanism of the Femoral Shaft.

OBJECTIVES: To evaluate the mechanical properties and provide a theoretical basis of a diaphyseal prosthesis with tooth mechanism using the finite element analysis method from the point of view of biomechanics. METHODS: A 3D digital femur model was generated based on a 28-year-old healthy man's femoral computed tomography (CT) data in Mimics 17.0 and the customized diaphyseal prostheses with/without tooth mechanism were designed in SolidWorks 2016. The 3D femur model after 8 cm osteotomy in the middle of its shaft and the prostheses with/without tooth mechanism was imported into Abaqus 2016 and the finite element analysis models were established. Three biomechanical tests (compression test, torsion test, and 3P-bending test) under broken load were simulated in FEA to evaluate the performance of the prostheses. RESULTS: The stress distributions of the two prostheses were similar and the maximum von Mises stresses placed on them were very close in each test. The maximum von Mises stresses on the prosthesis with tooth mechanism were 31.55, 319.7, and 447.4 MPa, respectively, and those on the prosthesis without tooth mechanism were 26.26, 300.4, and 455.2 MPa, respectively, in the compression, torsion, and 3P-bending tests. The maximum von Mises stresses on them were far below the ultimate tensile strength or ultimate compressive strength of the titanium alloy. CONCLUSIONS: The diaphyseal prosthesis with tooth mechanism is helpful to adjust the rotation of the long bone during operation. Compared with the conventional diaphyseal prosthesis (without tooth mechanism), the diaphyseal prosthesis with tooth mechanism also has a good biomechanical performance and does not increase the risk of prosthetic failure.

[Expression and Clinical Sgnificance of IL-6, IL-6R and MCL-1 in Patients with Multiple Myeloma].

OBJECTIVE: To study the expression level and clinical significance of serum interleukin-6 (IL-6), its receptor (IL-6R) and myeloid cell leukemin-1(MCL-1) in patients with multiple myeloma（MM）. METHODS: Ninety-eight cases of MM treated in our hospital from January 2014 to January 2019 were selected, and the patients were divided into three groups according to their DS stage: stage I (27 cases), stage II (34 cases) and stage III (37 cases). The expression levels of IL-6, IL-6R and MCL-1 in patients at different DS stages were compared, and the prognostic-related factors were analyzed. RESULTS: The expression levels of IL-6 and MCL-1 in patients rised with DS stages, and the difference showed statistical significance (P<0.05), but the level of IL-6R in three groups showed no significant difference (P>0.05). The prognosis of patients with different levels of IL-6 and MCL-1 was compared and the results were as follows, the median survival time of 41 patients with IL-6≥80 pg/ml was 33.0 months, and that of 57 patients with IL-6 <80 pg/ml was 33.5 months, which showed no significant difference (P>0.05). The median survival time of 45 patients with MCL-1≥200 pg/ml was 30.5 months, and that of 53 patients with MCL-1 <200 pg/ml was 37.0 months, and their difference was statistically significant (P<0.05). Sex, age, ß2-MG and Hb not significantly correlated with prognosis of patients (P>0.05), however, DS stage, IL-6 and MCL-1 correlated with prognosis of patients（r=2.261，r=1.754，r=1.905）. CONCLUSION: The levels of IL-6 and MCL-1 in patients with multiple myeloma correlate with the DS stage and prognosis of patients.

The synergistic anti-tumor effect of schisandrin B and apatinib.

The synergistic anti-tumor effect of schisandrin B (Sch.B) and apatinib was investigated in vitro. The CCK-8 assay revealed that Sch.B enhanced the inhibition of apatinib on cell proliferation by arresting cell cycle in G0/G1 phase. Sch.B also potentiated the suppression of apatinib on cell migration and invasion, by means of wound-healing and transwell invasion assay. Flow cytometry results showed that Sch.B enhanced apoptosis induced by apatinib. The results were confirmed by western blot analysis of the proteins MMP-9, and Bax caspase-9, and -12. These results suggest that combining apatinib and Sch.B is an effective therapeutic strategy for preventing GC progression. [Formula: see text].

Interaction and coexistence characteristics of dissolved organic matter with toxic metals and pesticides in shallow groundwater.

The long-term and large-scale utilization of fertilizers and pesticides in facility agriculture leads to groundwater pollution. However, the coexistence and interactions between organic fertilizers (i.e., organic matter), toxic metals, and pesticides in shallow groundwater have seldom been studied. Thus, the study sought to characterize said interactions via fluorescence, ultraviolet-visible spectroscopy (UV-Vis), and Fourier-transform infrared spectroscopy coupled with two-dimensional correlation spectroscopy and chemometric techniques. The results indicated that groundwater DOM was comprised of protein-, polysaccharide-, and lignin-like substances derived from organic fertilizers. Protein-like substances accounted for the binding of Co, Ni, and Fe, while polysaccharide- and lignin-like substances were mainly responsible for Cr and Mo complexation. Moreover, lignin- and polysaccharide-like substances played a key role in the binding of pesticides (i.e., dichlorodiphenyltrichloroethane [DDT], endosulfan, γ-hexachlorocyclohexane [γ-HCH], monocrotophos, chlorpyrifos, and chlorfenvinphos), rendering the conversion of γ-HCH to ß-hexachlorocyclohexane (ß-HCH) and the degradation of DDT to dichlorobenzene dichloroethylene (DDE) ineffective. However, the presence of protein-like substances in groundwater benefited the degradation and conversion of γ-HCH and α-endosulfan. Redundancy analyses showed that lignin- and polysaccharide-like matter had the most impacts on the coexistence of DOM with toxic metals and pesticides.

[Expressions of Sry-related High Mobility Group Box 9 and Gastrokine-1 in Gastric Cancer and Their Relationships with Prognosis].

Objective To explore the expressions of Sry-related high mobility group box 9(SOX9)and gastrokine-1(GKN1) in gastric cancer tissues and their relationships with clinicopathologic features and prognosis of patients.Methods Immunohistochemistry was used to detect the expressions of SOX9 and GKN1 in 70 cases of gastric cancer tissues and corresponding paracancerous tissues including 27 cases of intestinal metaplasia and 43 cases of normal gastric mucosa. The relationships of SOX9 and GKN1 expressions with clinicopathological features and prognosis were analyzed in gastric cancer tissues.Results The high expression rates of SOX9 in gastric cancer tissues,intestinal metaplasia,and normal gastric mucosa were 92.9%(65/70),77.8%(21/27),and 55.8%(24/43),respectively(χ 2=21.722,P<0.001). Positive nuclear and cytoplasmic staining was observed. The high nuclear expression rate of SOX9 in gastric cancer tissues was 67.1%,which was significantly higher than those of intestinal metaplasia(37.0%,P=0.007)and normal gastric mucosa(23.3%,P<0.001). The high cytoplasmic expression rate of GKN1 in normal gastric mucosa was 76.7%,which was significantly higher than those of intestinal metaplasia(44.4%,P=0.006)and gastric cancer tissues(37.1%,P<0.001). Univariate analysis demonstrated that the nuclear expression of SOX9 in gastric cancer was associated with the degree of tissue differentiation(P=0.007),while the cytoplasmic expression of GKN1 was associated with both the degree of tissue differentiation(P=0.002)and whether the pathological type was a signet-ring cell carcinoma(P=0.009). Furthermore,the nuclear expression of SOX9 was negatively correlated with the expression of GKN1 in gastric cancer(χ 2=15.424,P<0.001). The 5-year survival rates of patients with high or low nuclear expression of SOX9 were 33.8% and 67.5%,respectively(P=0.016).The 5-year survival rates of patients with high or low expression of GKN1 were 60.0% and 35.6%,respectively(P=0.044). Further research indicated that 5-year survival rate of patients with high nuclear expression of SOX9 and low expression of GKN1 was 28.8%. Cox multivariate regression analysis showed that TNM stage(stage Ⅱ:HR=7.435,95%CI:1.313-42.096,P=0.023;stage Ⅲ:HR=12.214,95%CI:2.677-55.721,P=0.001)and nuclear expression level of SOX9(HR=3.297,95%CI:1.199-9.065,P=0.021)were independent risk factors for the prognosis of gastric cancer patients.Conclusions Changes in the expressions of SOX9 and GKN1 may be associated with the malignant biological behavior of gastric cancer. SOX9 may be a potential prognostic factor. The combined detection of SOX9 and GKN1 expression and the further study of their molecular mechanism may provide new clues for early diagnosis,targeted therapy,and prognostic prediction of gastric cancer.

Hydroxyapatite reduces potential Cadmium risk by amendment of sludge compost to turf-grass grown soil in a consecutive two-year study.

Recycling of sludge compost to soil as conditioner is generally regarded as the best means of disposal. However, concerns regarding heavy metal residues and sludge toxicity have recently received increasing public attention. Cadmium (Cd) is a mobile metal commonly found in sludge; therefore, the risk posed by Cd contaminated sludge should be carefully assessed. In this report, the effects of addition of hydroxyapatite (HAP) with sludge compost amendment on potential Cd risk were investigated. The results of consecutive two years showed that exchangeable Cd content in treatment of sludge compost with 1.5% HAP decreased by 6.0% compared with single sludge compost treatment, and residual Cd increased by 7.6%. Compared with single sludge compost, the incremental rate of exchangeable Cd dropped by 38.3% and the reductive rate of residual Cd increased by 37.7% in response to 1.5% HAP addition, indicating that HAP played a role of decreasing Cd phytoavailability. The HAP reduced the amount of Cd uptaken by turf-grass in both root and leaf. Moreover, HAP remarkably improved the quality of turf grass grown in amended soil, including leaf greenness, green maintainable period and root strength. However, HAP did not attenuate the downward mobility of Cd. Taken these together, these findings indicated that HAP can be used as a potential candidate to control surface Cd risk of sludge compost amended soil rather than that from leachate.

A novel ASBT inhibitor, IMB17-15, repressed nonalcoholic fatty liver disease development in high-fat diet-fed Syrian golden hamsters.

The manipulation of bile acid (BA) homeostasis by blocking the ileal apical Na+-dependent bile salt transporter (ASBT/SLC10A2) may have therapeutic effects in nonalcoholic fatty liver disease. We developed a novel ASBT inhibitor, an N-(3,4-o-dichlorophenyl)-2-(3-trifluoromethoxy) benzamide derivative referred to as IMB17-15, and investigated its therapeutic effects and the molecular mechanisms underlying the effects. Syrian golden hamsters were challenged with high-fat diet (HFD) to induce NAFLD and were subsequently administered 400 mg/kg IMB17-15 by gavage daily for 21 days. Serum, liver, and fecal samples were collected for further analysis. Plasma concentration-time profiles of IMB17-15 were also constructed. The human hepatocyte cell line HL-7702 was treated with Oleic acid (OA) with or without IMB17-15. Western blotting and real-time PCR were used to study the molecular mechanisms of IMB17-15. We found that IMB17-15 inhibited ASBT and subsequently suppressed ileal farnesoid X receptor (FXR) and FXR-activated fibroblast growth factor15/19 (FGF15/19) expression, which reduced the hepatic phosphorylated extracellular regulated protein kinase (ERK) and c-Jun N-terminal kinase (JNK) levels and upregulated the cholesterol 7α-hydroxylase (CYP7A1) activity. Additionally, IMB17-15 stimulated adenosine monophosphate (AMP)-activated protein kinase (AMPKα) phosphorylation and enhanced peroxisome proliferator activated receptor α (PPARα) expression and thus promoted triglyceride (TG) oxidation and high-density lipoprotein cholesterol (HDL-c) metabolism through an ASBT-independent mechanism. In conclusion, a novel ASBT inhibitor known as IMB17-15 protected hamsters against HFD-induced NFALD by manipulating BA and lipid homeostasis. IMB17-15 also reduced lipid deposition in human hepatic cell lines, indicating that it may be useful as a therapy for NAFLD patients.

A corn straw-based diet increases release of inflammatory cytokines in peripheral blood mononuclear cells of dairy cows.

Recent studies have shown that diet can affect the body's immunity. Roughage of dairy cows consists of a variety of plant materials which make different contributions to health. This study investigated the effect of different roughages on the immunity of dairy cows. Serum, peripheral blood mononuclear cells (PBMCs), and milk samples were collected from 20 multiparous mid-lactation cows fed mixed forage (MF)- or corn straw (CS)-based diets. Expression profile analysis was used to detect the differentially expressed genes (DEGs) from PBMCs. The results showed that milk protein in the MF group increased to 3.22 g/100 ml, while that of the CS group milk was 2.96 g/100 ml; by RNA sequencing, it was found that 1615 genes were differentially expressed between the CS group and the MF group among the 24 027 analyzed probes. Gene ontology (GO) and pathway analysis of DEGs suggested that these genes (especially genes coding cytokines, chemokine and its receptors) are involved in the immune response. Results were confirmed at the protein level via detecting the levels of interleukin-2 (IL-2), IL-6, IL-10, IL-12, leptin (LEP), interferon-γ (IFN-γ), transforming growth factor-ß1 (TGF-ß1), and tumor necrosis factor-α (TNF-α) in peripheral blood by enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay analysis. Our data supported the conclusions that the protein content in milk of the MF group was higher than that of the CS group, the CS-based diets induced more release of cytokines than the MF-based diets in dairy cows' PBMCs, and milk protein content may be affected by cytokines.

[Effects of simulated 100 m Trimix conventional diving on oxidative stress and inflammatory reaction in rabbits].

OBJECTIVE: To investigate the effects of simulated 100 m Trimix conventional diving on tissue inflammatory cytokines in rabbits. METHODS: Eight New Zealand rabbits were performed a simulated 100 m Trimix conventional diving program which was established according to the Haldane theory. The expression levels of interferon-gamma(IFN-γ), tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), interleukin-8 (IL-8), myeloperoxidase(MPO) and matrix metallo proteinase-9 (MMP-9) in rabbits lung and brain tissues were detected by Elisa after diving decompression. The tissue wet/dry ratio was calculated. The serum levels of superoxide dismutase (SOD),glutathione(GSH), catalase(CAT), malondiadehyde(MDA) and lipid peroxide(LPO) were detected by Elisa method in rabbits before and after diving. RESULTS: The expressions of IFN-γ, TNF-α, IL-6, IL-8, MPO and MMP-9 in simulated diving group rabbits were significantly increased compared with the intact group(P<0.05, P<0.01); the simulated diving rabbits tissues wet/dry ratio had no significant changes compared with the intact group. After diving, the activities of SOD and GSH were decreased significantly (P<0.01), while the contents of CAT, MDA and LPO were increased significantly (P<0.01). CONCLUSIONS: The simulated 100 m Trimix conventional diving had significant impact on oxidative stress and inflammatory reaction in rabbits, the results of wet/dry ratio showed that the diving rabbits had no tissue edema after decompression.

Isaria cicadae conidia possess antiproliferative and inducing apoptosis properties in gynaecological carcinoma cells.

Isaria cicadae is an entomogenous fungus that has been used as a traditional Chinese medicinal materials to treat different diseases, including cancer. However, Isaria cicadae conidia for inhibitory activity against breast cancer cells growth are still not systematically studied. The present aim was to elucidate the phytochemical composition of Isaria cicadae conidia and to explore relevant anti-cancer potential in gynaecological carcinoma MCF-7 and Hela cells. Isaria cicadae conidia were identified by UPLC-ESI-Q-TOF-MS: high performance liquid chromatography-electrospray/quadrupole time of flight tandem mass spectrometry technology. Eight main compounds were identified which are nucleosides, cordycepic acid, cordycepin, beauvericin and myriocin by MS fragmentation ions. The nuclear morphology indicated the typical characteristics of apoptosis by Hoechst staining. Annexin V/PI staining revealed that the number of apoptotic cells was increased by Isaria cicadae conidia treatment. Furthermore, Isaria cicadae conidia also induced the caspase-mediated mitochondrial apoptosis pathway. The findings suggest that the full-scale active ingredients highlight the significance of Isaria cicadae conidia as potential anti-cancer agent in China.

Reduction in greenhouse gas emissions from sludge biodrying instead of heat drying combined with mono-incineration in China.

Sludge is an important source of greenhouse gas (GHG) emissions, both in the form of direct process emissions and as a result of indirect carbon-derived energy consumption during processing. In this study, the carbon budgets of two sludge disposal processes at two well-known sludge disposal sites in China (for biodrying and heat-drying pretreatments, both followed by mono-incineration) were quantified and compared. Total GHG emissions from heat drying combined with mono-incineration was 0.1731 tCO2e t-1, while 0.0882 tCO2e t-1 was emitted from biodrying combined with mono-incineration. Based on these findings, a significant reduction (approximately 50%) in total GHG emissions was obtained by biodrying instead of heat drying prior to sludge incineration. IMPLICATIONS: Sludge treatment results in direct and indirect greenhouse gas (GHG) emissions. Moisture reduction followed by incineration is commonly used to dispose of sludge in China; however, few studies have compared the effects of different drying pretreatment options on GHG emissions during such processes. Therefore, in this study, the carbon budgets of sludge incineration were analyzed and compared following different pretreatment drying technologies (biodrying and heat drying). The results indicate that biodrying combined with incineration generated approximately half of the GHG emissions compared to heat drying followed by incineration. Accordingly, biodrying may represent a more environment-friendly sludge pretreatment prior to incineration.