Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene.

An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.

Quantitative Acetylomics Uncover Acetylation-Mediated Pathway Changes Following Histone Deacetylase Inhibition in Anaplastic Large Cell Lymphoma.

Histone deacetylases (HDACs) target acetylated lysine residues in histone and non-histone proteins. HDACs are implicated in the regulation of genomic stability, cell cycle, cell death and differentiation and thus critically involved in tumorigenesis. Further, HDACs regulate T-cell development and HDAC inhibitors (HDACis) have been approved for clinical use in some T-cell malignancies. Still, the exact targets and mechanisms of HDAC inhibition in cancer are understudied. We isolated tumor cell lines from a transgenic mouse model of anaplastic large cell lymphoma (ALCL), a rare T-cell lymphoma, and abrogated HDAC activity by treatment with the HDACis Vorinostat and Entinostat or Cre-mediated deletion of Hdac1. Changes in overall protein expression as well as histone and protein acetylation were measured following Hdac1 deletion or pharmacological inhibition using label-free liquid chromatography mass spectrometry (LC-MS/MS). We found changes in overall protein abundance and increased acetylation of histones and non-histone proteins, many of which were newly discovered and associated with major metabolic and DNA damage pathways. For non-histone acetylation, we mapped a total of 1204 acetylated peptides corresponding to 603 proteins, including chromatin modifying proteins and transcription factors. Hyperacetylated proteins were involved in processes such as transcription, RNA metabolism and DNA damage repair (DDR). The DDR pathway was majorly affected by hyperacetylation following HDAC inhibition. This included acetylation of H2AX, PARP1 and previously unrecognized acetylation sites in TP53BP1. Our data provide a comprehensive view of the targets of HDAC inhibition in malignant T cells with general applicability and could have translational impact for the treatment of ALCL with HDACis alone or in combination therapies.

Quantitative Analysis of Posttranslational Modifications of Plant Histones.

Reshaping of the chromatin landscape under oxidative stress is of paramount importance for mounting an effective stress response. Unbiased systemic identification and quantification of histone marks is crucial for understanding the epigenetic component of plant responses to adverse environmental conditions. We describe a detailed method for isolation of plant histones and subsequent bottom-up proteomics approach for characterization of acetylation and methylation status. By performing label-free quantitative mass spectrometry analysis, relative abundances of histone marks can be statistically compared between experimental conditions.

Phosphorylation within Intrinsic Disordered Region Discriminates Histone Variant macroH2A1 Splicing Isoforms-macroH2A1.1 and macroH2A1.2.

Background: Gene expression in eukaryotic cells can be governed by histone variants, which replace replication-coupled histones, conferring unique chromatin properties. MacroH2A1 is a histone H2A variant containing a domain highly similar to H2A and a large non-histone (macro) domain. MacroH2A1, in turn, is present in two alternatively exon-spliced isoforms: macroH2A1.1 and macroH2A1.2, which regulate cell plasticity and proliferation in a remarkably distinct manner. The N-terminal and the C-terminal tails of H2A histones stem from the nucleosome core structure and can be target sites for several post-translational modifications (PTMs). MacroH2A1.1 and macroH2A1.2 isoforms differ only in a few amino acids and their ability to bind NAD-derived metabolites, a property allegedly conferring their different functions in vivo. Some of the modifications on the macroH2A1 variant have been identified, such as phosphorylation (T129, S138) and methylation (K18, K123, K239). However, no study to our knowledge has analyzed extensively, and in parallel, the PTM pattern of macroH2A1.1 and macroH2A1.2 in the same experimental setting, which could facilitate the understanding of their distinct biological functions in health and disease. Methods: We used a mass spectrometry-based approach to identify the sites for phosphorylation, acetylation, and methylation in green fluorescent protein (GFP)-tagged macroH2A1.1 and macroH2A1.2 expressed in human hepatoma cells. The impact of selected PTMs on macroH2A1.1 and macroH2A1.2 structure and function are demonstrated using computational analyses. Results: We identified K7 as a new acetylation site in both macroH2A1 isoforms. Quantitative comparison of histone marks between the two isoforms revealed significant differences in the levels of phosphorylated T129 and S170. Our computational analysis provided evidence that the phosphorylation status in the intrinsically disordered linker region in macroH2A1 isoforms might represent a key regulatory element contributing to their distinct biological responses. Conclusions: Taken together, our results report different PTMs on the two macroH2A1 splicing isoforms as responsible for their distinct features and distribution in the cell.

Trimethylacetic Anhydride-Based Derivatization Facilitates Quantification of Histone Marks at the MS1 Level.

Histone post-translational modifications (hPTMs) are epigenetic marks that strongly affect numerous processes, including cell cycling and protein interactions. They have been studied by both antibody- and MS-based methods for years, but the analyses are still challenging, mainly because of the diversity of histones and their modifications arising from high contents of reactive amine groups in their amino acid sequences. Here, we introduce use of trimethylacetic anhydride (TMA) as a new reagent for efficient histone derivatization, which is a requirement for bottom-up proteomic hPTM analysis. TMA can derivatize unmodified amine groups of lysine residues and amine groups generated at peptide N-termini by trypsin digestion. The derivatization is facilitated by microwave irradiation, which also reduces incubation times to minutes. We demonstrate that histone derivatization with TMA reliably provides high yields of fully derivatized peptides and thus is an effective alternative to conventional methods. TMA afforded more than 98% and 99% labeling efficiencies for histones H4 and H3, respectively, thereby enabling accurate quantification of peptide forms. Trimethylacetylation substantially improves chromatographic separation of peptide forms, which is essential for direct quantification based on signals extracted from MS1 data. For this purpose, software widely applied by the proteomics community can be used without additional computational development. Thorough comparison with widely applied propionylation highlights the advantages of TMA-based histone derivatization for monitoring hPTMs in biological samples.

Disruption of NAP1 genes in Arabidopsis thaliana suppresses the fas1 mutant phenotype, enhances genome stability and changes chromatin compaction.

Histone chaperones mediate the assembly and disassembly of nucleosomes and participate in essentially all DNA-dependent cellular processes. In Arabidopsis thaliana, loss-of-function of FAS1 or FAS2 subunits of the H3-H4 histone chaperone complex CHROMATIN ASSEMBLY FACTOR 1 (CAF-1) has a dramatic effect on plant morphology, growth and overall fitness. CAF-1 dysfunction can lead to altered chromatin compaction, systematic loss of repetitive elements or increased DNA damage, clearly demonstrating its severity. How chromatin composition is maintained without functional CAF-1 remains elusive. Here we show that disruption of the H2A-H2B histone chaperone NUCLEOSOME ASSEMBLY PROTEIN 1 (NAP1) suppresses the FAS1 loss-of-function phenotype. The quadruple mutant fas1 nap1;1 nap1;2 nap1;3 shows wild-type growth, decreased sensitivity to genotoxic stress and suppression of telomere and 45S rDNA loss. Chromatin of fas1 nap1;1 nap1;2 nap1;3 plants is less accessible to micrococcal nuclease and the nuclear H3.1 and H3.3 histone pools change compared to fas1. Consistently, association between NAP1 and H3 occurs in the cytoplasm and nucleus in vivo in protoplasts. Altogether we show that NAP1 proteins play an essential role in DNA repair in fas1, which is coupled to nucleosome assembly through modulation of H3 levels in the nucleus.

DNA Damage Changes Distribution Pattern and Levels of HP1 Protein Isoforms in the Nucleolus and Increases Phosphorylation of HP1ß-Ser88.

The family of heterochromatin protein 1 (HP1) isoforms is essential for chromatin packaging, regulation of gene expression, and repair of damaged DNA. Here we document that γ-radiation reduced the number of HP1α-positive foci, but not HP1ß and HP1γ foci, located in the vicinity of the fibrillarin-positive region of the nucleolus. The additional analysis confirmed that γ-radiation has the ability to significantly decrease the level of HP1α in rDNA promoter and rDNA encoding 28S rRNA. By mass spectrometry, we showed that treatment by γ-rays enhanced the HP1ß serine 88 phosphorylation (S88ph), but other analyzed modifications of HP1ß, including S161ph/Y163ph, S171ph, and S174ph, were not changed in cells exposed to γ-rays or treated by the HDAC inhibitor (HDACi). Interestingly, a combination of HDACi and γ-radiation increased the level of HP1α and HP1γ. The level of HP1ß remained identical before and after the HDACi/γ-rays treatment, but HDACi strengthened HP1ß interaction with the KRAB-associated protein 1 (KAP1) protein. Conversely, HP1γ did not interact with KAP1, although approximately 40% of HP1γ foci co-localized with accumulated KAP1. Especially HP1γ foci at the periphery of nucleoli were mostly absent of KAP1. Together, DNA damage changed the morphology, levels, and interaction properties of HP1 isoforms. Also, γ-irradiation-induced hyperphosphorylation of the HP1ß protein; thus, HP1ß-S88ph could be considered as an important marker of DNA damage.

Cell differentiation along multiple pathways accompanied by changes in histone acetylation status.

Post-translational modification of histones is fundamental to the regulation of basic nuclear processes and subsequent cellular events, including differentiation. In this study, we analyzed acetylated forms of histones H2A, H2B, and H4 during induced differentiation in mouse (mESCs) and human (hESCs) embryonic stem cells and during induced enterocytic differentiation of colon cancer cells in vitro. Endoderm-like differentiation of mESCs induced by retinoic acid and enterocytic differentiation induced by histone deacetylase inhibitor sodium butyrate were accompanied by increased mono-, di-, and tri-acetylation of histone H2B and a pronounced increase in di- and tri-acetylation of histone H4. In enterocytes, mono-acetylation of histone H2A also increased and tetra-acetylation of histone H4 appeared only after induction of this differentiation pathway. During differentiation of hESCs, we observed increased mono-acetylation and decreased tri-acetylation of H2B. Mono-, di-, and tri-acetylation of H4 were reduced, manifested by a significant increase in nonacetylated H4 histones. Levels of acetylated histones increased during induced differentiation in mESCs and during histone deacetylase (HDAC) inhibitor-induced enterocytic differentiation, whereas differentiation of human ESCs was associated with reduced acetylation of histones H2B and H4.

Epigenetic aspects of HP1 exchange kinetics in apoptotic chromatin.

Apoptotic bodies are the most condensed form of chromatin. In general, chromatin structure and function are mostly dictated by histone post-translational modifications. Thus, we have analyzed the histone signature in apoptotic cells, characterized by pronounced chromatin condensation. Here, H2B mono-acetylation, and H3K9 and H4 acetylation was significantly decreased in apoptotic cells, which maintained a high level of H3K9 methylation. This phenotype was independent of p53 function and distinct levels of anti-apoptotic Bcl2 protein. Interestingly, after etoposide treatment of leukemia and multiple myeloma cells, H3K9 and H4 hypoacetylation was accompanied by increased H3K9me2, but not H3K9me1 or H3K9me3. In adherent mouse fibroblasts, a high level of H3K9me3 and histone deacetylation in apoptotic bodies was likely responsible for the pronounced (∼40%) recovery of GFP-HP1α and GFP-HP1ß after photobleaching. HP1 mobility in apoptotic cells appeared to be unique because limited exchange after photobleaching was observed for other epigenetically important proteins, including GFP-JMJD2b histone demethylase (∼10% fluorescence recovery) or Polycomb group-related GFP-BMI1 protein (∼20% fluorescence recovery). These findings imply a novel fact that only certain subset of proteins in apoptotic bodies is dynamic.

A combined approach for the study of histone deacetylase inhibitors.

Overexpression of histone deacetylases (HDACs), with consequent hypoacetylation of histones, is reportedly associated with transcriptional repression of tumour suppressor genes. Thus, inhibition of HDACs has emerged as a promising strategy in cancer therapy. In order to monitor the effects of potential HDAC inhibitors, a multi-level approach consisting of preliminary screening (measurement of HDAC activity and semi-quantitative evaluation of histone H4 modification profile by MALDI-TOF MS) and detailed analysis of histone modification forms (using 2-D AUT/AU PAGE and LC-ESI-IT MS) has been used in this study. The data obtained provide a global insight into the effects of HDAC inhibitors on the histone acetylation status that participates in gene transcription control. Using two example inhibitors, valproic acid sodium salt and entinostat, we show that similar levels of HDAC inhibition induced by different agents can lead to distinct rates of histone hyperacetylation, suggesting that except for the direct inhibition of HDACs, additional molecular mechanisms amplifying the response are likely to be involved in the inhibitory process. The approach used in our study makes it possible not only to follow the dynamics of individual histone modification forms, but also of their combined occurrence in the N-terminal fragment.

Potential biomarkers for early detection of acute graft-versus-host disease.

Acute graft-versus-host disease (aGVHD) is the main complication of allogeneic hematopoietic stem cell transplantation (HCT), resulting in considerable morbidity and mortality. Currently, the diagnosis of aGVHD is largely made based on clinical parameters and invasive biopsies. For the past 20 years, researchers have been trying to find reliable biomarkers to enable early and accurate diagnosis of aGVHD. Although a number of potential aGVHD biomarkers have been published, as yet, no validated diagnostic test is available. Proteomics encompasses a broad range of rapidly developing technologies, which have shown tremendous promise for early detection of aGVHD. In this article, we review the current state of aGVHD biomarker discovery, provide a summary of the key proteins of interest and the most common analytical procedures for the clinic, as well as outlining the significant challenges faced in their use.