RESUMO
BACKGROUND: Female sex has been associated with worse outcomes after groin hernia repair (GHR), including a higher rate of chronic pain and recurrence. Most of the studies in GHR are performed in males, and the recommendations for females extrapolate from these studies, even though females have anatomy intricacies. The round ligament of the uterus (RLU) is associated with pelvic stabilization and plays a role in sensory function. Transection of the RLU during GHR is controversial as it can allow easier mesh placement but can favor genitourinary complications and chronic pain. As no previous meta-analysis compared preserving versus transecting the RLU during minimally invasive (MIS) GHR, we aim to perform a systematic review and meta-analysis evaluating surgical outcomes comparing the approaches. METHODS: Cochrane Central, Embase, and PubMed databases were systematically searched for studies comparing transection versus preservation of the RLU in MIS groin hernia surgeries. Outcomes assessed were operative time, bleeding, surgical site events, hospital stay, chronic pain, paresthesia, recurrence rates, and genital prolapse rates. Statistical analysis was performed using RevMan 5.4.1. Heterogeneity was assessed with I2 statistics. A review protocol for this meta-analysis was registered at PROSPERO (CRD 42023467146). RESULTS: 1738 studies were screened. A total of six studies, comprising 1131 women, were included, of whom 652 (57.6%) had preservation of the RLU during MIS groin hernia repair. We found no statistical difference regarding chronic pain, paresthesia, recurrence rates, and postoperative complications. We found a longer operative time for the preservation group (MD 6.84 min; 95% CI 3.0-10.68; P = 0.0005; I2 = 74%). CONCLUSION: Transecting the RLU reduces the operative time during MIS GHR with no difference regarding postoperative complication rates. Although transection appears safe, further prospective randomized studies with long-term follow-up and patient-reported outcomes are necessary to define the optimal management of RLU during MIS GHR.
Assuntos
Hérnia Inguinal , Herniorrafia , Humanos , Feminino , Herniorrafia/métodos , Hérnia Inguinal/cirurgia , Duração da Cirurgia , Ligamentos Redondos/cirurgia , Laparoscopia/métodos , Procedimentos Cirúrgicos Minimamente Invasivos/métodos , Procedimentos Cirúrgicos Minimamente Invasivos/efeitos adversos , Complicações Pós-Operatórias/etiologia , Complicações Pós-Operatórias/epidemiologia , RecidivaRESUMO
PURPOSE: We aimed to perform a systematic review and meta-analysis comparing postoperative outcomes in inguinal hernia repair with TIPP versus Lichtenstein technique. METHODS: Cochrane Central, Scopus, and PubMed were systematically searched for studies comparing TIPP and Lichtenstein´s technique for inguinal hernia repair. Outcomes assessed were operative time, bleeding, surgical site events, hospital stay, the Visual Analogue Pain Score, chronic pain, paresthesia rates, and recurrence. Statistical analysis was performed using RevMan 5.4.1. Heterogeneity was assessed with I2 statistics and random-risk effect was used if I2 > 25%. RESULTS: 790 studies were screened and 44 were thoroughly reviewed. A total of nine studies, comprising 8428 patients were included, of whom 4185 (49.7%) received TIPP and 4243 (50.3%) received Lichtenstein. We found that TIPP presented less chronic pain (OR 0.43; 95% CI 0.20-0.93 P = 0.03; I2 = 84%) and paresthesia rates (OR 0.27; 95% CI 0.07-0.99; P = 0.05; I2 = 63%) than Lichtenstein group. In addition, TIPP was associated with a lower VAS pain score at 14 postoperative day (MD - 0.93; 95% CI - 1.48 to - 0.39; P = 0.0007; I2 = 99%). The data showed a lower operative time with the TIPP technique (MD - 7.18; 95% CI - 12.50, - 1.87; P = 0.008; I2 = 94%). We found no statistical difference between groups regarding the other outcomes analyzed. CONCLUSION: TIPP may be a valuable technique for inguinal hernias. It was associated with lower chronic pain, and paresthesia when compared to Lichtenstein technique. Further long-term randomized studies are necessary to confirm our findings. Study registration A review protocol for this meta-analysis was registered at PROSPERO (CRD42023434909).
Assuntos
Dor Crônica , Hérnia Inguinal , Humanos , Dor Crônica/etiologia , Dor Crônica/cirurgia , Dor Pós-Operatória/etiologia , Dor Pós-Operatória/cirurgia , Hérnia Inguinal/cirurgia , Parestesia/cirurgia , Herniorrafia/efeitos adversos , Herniorrafia/métodos , Telas Cirúrgicas , Recidiva , Resultado do TratamentoRESUMO
A new blueberry virus was discovered using high-throughput sequencing. Using sequence identity values, phylogenetics, and serological and biological properties, we propose the virus, putatively named blueberry virus S (BluVS), to be a distinct species within the genus Carlavirus (family Betaflexiviridae). The genome was analyzed in depth, and an infectious clone was developed to initiate studies on virus pathogenicity. Agroinfiltration of the binary vector construct produced severe systemic symptoms in Nicotiana occidentalis. Back-inoculation using sap from agroinfiltrated N. occidentalis produced identical symptoms to the recipient plants (N. occidentalis), and virus purification yielded flexuous carlavirus-like particles. However, unlike blueberry scorch virus (BlScV), BluVS caused symptomless infection in Chenopodium quinoa and reacted weakly to BlScV antibodies in an enzyme-linked immunosorbent assay. Collectively, the results provide evidence for the distinct speciation of BluVS. The availability of an infectious clone provides tools for future studies on the biology of the virus.
Assuntos
Mirtilos Azuis (Planta) , Carlavirus , Carlavirus/genética , Doenças das Plantas , Genoma Viral/genética , GenômicaRESUMO
Three members of subgroup 1 of the genus Ilarvirus: blackberry chlorotic ringspot (BCRV), strawberry necrotic shock (SNSV), and tobacco streak viruses (TSV), may infect Rubus and Fragaria species. All cause symptoms similar to those previously attributed to infection by TSV alone. Although similarities exist among the genomic sequences of the three, phylogenetic analysis shows them to be distinct viruses. These viruses and Parietaria mottle virus, the other currently accepted member of subgroup 1, appear to have evolved from a common ancestral virus, share conserved motifs in the products of the genomic RNAs, and constitute a distinct subgroup within the genus.
Assuntos
Genoma Viral , Ilarvirus/classificação , Ilarvirus/genética , Filogenia , Doenças das Plantas/virologia , RNA Viral/genética , Análise de Sequência de DNA , Fragaria/virologia , Dados de Sequência Molecular , Rosaceae/virologiaRESUMO
Periodontitis is a serious disease that affects up to 50% of an adult population. It is a chronic condition involving inflammation of the periodontal ligament and associated tissues leading to eventual tooth loss. Some evidence suggests that trace metals, especially zinc and copper, may be involved in the onset and severity of periodontitis. Thus we have used synchrotron X-ray fluorescence imaging on cross sections of diseased and healthy teeth using a microbeam to explore the distribution of trace metals in cementum and adhering plaque. The comparison between diseased and healthy teeth indicates that there are elevated levels of zinc, copper and nickel in diseased teeth as opposed to healthy teeth. This preliminary correlation between elevated levels of trace metals in the cementum and plaque of diseased teeth suggests that metals may play a role in the progress of periodontitis.
Assuntos
Cálcio/metabolismo , Cobre/metabolismo , Cemento Dentário/química , Periodontite/metabolismo , Zinco/metabolismo , Adulto , Placa Dentária/química , Feminino , Humanos , Chumbo/metabolismo , Masculino , Mercúrio/metabolismo , Níquel/metabolismo , Espectrometria por Raios X , SíncrotronsRESUMO
Blackberry chlorotic ringspot virus (BCRV), genus Ilarvirus, has been found in Rubus sp. in Scotland (2) and rose in the United States (4). The possibility that BCRV infects other hosts in the United States was explored. We tested 18 accessions of Fragaria sp. and 30 of Rubus sp. maintained at the National Clonal Germplasm Repository in Corvallis, OR. Ilarviruses had been detected in these plants by reverse transcription (RT)-PCR, ELISA, or had caused symptoms typical of ilarviruses on indicator plants. The accessions were tested by RT-PCR with primers F (5'-GTTTCCTGTGCTCCTCA-3') and R (5'-GTCACACCGAGGTACT-3') (4) that amplify a 519 to 522 nt (depending on the isolate) region of the RNA 3 of BCRV. The virus was detected in two accessions of black raspberry (Rubus occidentalis L.): RUB433, cv. Lowden and RUB 9012, cv. New Logan. The sequences of the fragments amplified from these accessions (GenBank Accession Nos. EF041817 and EF041818, respectively) had 97% nt sequence identity to each other and 95 and 88% nt identity to the rose and Scottish isolates (GenBank Accession Nos. DQ329378 and DQ091195, respectively). Chenopodium quinoa indicator plants inoculated with isolate RUB 433 developed mild chlorotic spots on the inoculated leaves 4 days after inoculation. RT-PCR and sequencing of the amplicons verified BCRV infection of C. quinoa. RUB 9012 was used for the characterization of Black raspberry latent virus (BRLV), later thought to be an isolate of Tobacco streak virus (TSV). This accession was recently found to be infected with Strawberry necrotic shock virus (SNSV) but not TSV (3). It is possible that BRLV may be a mixture of SNSV and BCRV. SNSV is one of the most abundant viruses of Rubus sp. in the Pacific Northwest (1), and the finding of another ilarvirus, BCRV, may account in part for the rapid decline of Rubus sp. observed in several fields in Oregon and Washington. To our knowledge, this is the first report of BCRV infecting Rubus sp. outside the United Kingdom. References: (1) A. B. Halgren. Ph.D. Diss. Oregon State University, Corvallis, OR, 2006. (2) A. T. Jones et al. Ann. Appl. Biol. 149:125, 2006. (3) I. E. Tzanetakis et al. Arch. Virol. 149:2001, 2004. (4) I. E. Tzanetakis et al. Plant Pathol. 55:568, 2006.
RESUMO
Molecular characterization of eight distinct, difficult-to-clone RNA plant viruses was accomplished after the development of a reverse transcriptase-based first- and second-strand cDNA synthesis method. Double-stranded (ds) RNA templates isolated from strawberry and blackberry and several herbaceous hosts (mint, pea and tobacco) were cloned using this method. Templates, combined with random primers, were denatured with methyl mercuric hydroxide. Reverse transcriptase was added followed by the addition of RNase H. The resulting dsDNA was then digested with restriction endonucleases to produce shorter fragments that could be cloned efficiently into a T-tailed vector after adding an A-overhang using Taq polymerase. This procedure resulted in a high number of cloned fragments and allowed insert sizes up to three kilobase-pairs. Unlike traditional cDNA construction methods, there is no need for additional enzymes/steps for second-strand synthesis, PCR amplification or prior sequence information. Synthesis and cloning of cDNA derived from dsRNA templates is much more efficient than with previously described methods. This procedure also worked well for cloning gel-purified dsRNA and with single-stranded RNA templates.
Assuntos
DNA Complementar/biossíntese , Vírus de Plantas/isolamento & purificação , RNA de Cadeia Dupla/genética , Reação em Cadeia da Polimerase Via Transcriptase Reversa/métodos , Moldes GenéticosRESUMO
Fragaria (strawberry) and Rubus species (blackberry, wild blackberry, red raspberry and black raspberry) were thought to be infected with distinct isolates of Tobacco streak virus (TSV). Employing serology and nucleic acid hybridization it has been shown that these isolates form a cluster distinct from other strains of TSV. In this study we have cloned and sequenced the complete RNA 3 of an isolate of TSV from strawberry (Fragaria) as well as the coat protein (CP) gene of 14 additional isolates of TSV originating from Fragaria and Rubus species. Our data suggest that the isolates of TSV that infect Fragaria and Rubus belong to a distinct virus for which we propose the name Strawberry necrotic shock virus (SNSV). The RNA 3 of SNSV contains 2248 nucleotides, 43 more than the type isolate of TSV from white clover (TSV-WC), with a CP gene that is 669 nucleotides long, in contrast to the 714-7 nucleotides of the TSV CP sequences found in the database. The movement protein gene of SNSV is 897 nucleotides in length, 27 more than that of the TSV-WC isolate of TSV. The CP genes of the 15 Fragaria and Rubus isolates that we studied form two distinct phylogenetic clusters that share about 95% amino acid sequence identity, while they only share 60-65% amino acid sequence identity with TSV-WC.
Assuntos
Fragaria/virologia , Ilarvirus/classificação , Ilarvirus/isolamento & purificação , Rosaceae/virologia , Sequência de Aminoácidos , Anticorpos Antivirais/imunologia , Proteínas do Capsídeo/genética , DNA Complementar , Ilarvirus/genética , Ilarvirus/imunologia , Dados de Sequência Molecular , Hibridização de Ácido Nucleico , Filogenia , RNA Viral/genética , Alinhamento de Sequência , Análise de Sequência de DNA , Homologia de Sequência de AminoácidosRESUMO
During efforts to characterize strawberry pallidosis disease, we identified a single strawberry plant that indexed positive for pallidosis disease by grafting but it was not infected with the Strawberry pallidosis associated virus (SPaV) based on reverse transcription-polymerase chain reaction (1). Leaves of this plant were grafted onto Fragaria vesca UC-4 and UC-5 and F. virginiana UC-10 and UC-11 indicator plants. The F. vesca plants remained asymptomatic, while the F. virginiana plants gave typical pallidosis symptoms that included marginal leaf chlorosis and epinasty. The combination of these symptoms on F. virginiana and lack of symptoms on F. vesca is used to define pallidosis disease (1). We extracted dsRNA from the original plant, and synthesized and cloned cDNA as previously described (2). Sequence analysis revealed several clones that corresponded to the published sequence of the Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene (HSP70h). We transferred the isolate to Nicotiana benthamiana by using the whitefly vector, Trialeuroides vaporariorum, and then reisolated and cloned dsRNA from the infected N. benthamiana. Here we present the complete sequence of the HSP70h and minor coat protein (CPm) genes of the strawberry isolate of BPYV (GenBank Accession Nos. AY 267369 and AY 268107, respectively). Oligonucleotide primers BP CPm F (5' TTCATATTAAGGATGCGCAGA 3') and BP CPm R (5' TGAAAG- ATGTCCACTAATGATA 3') were designed to amplify a 334-nucleotide fragment of the CPm gene of the strawberry isolate of BPYV. Using this primer set, we were able to verify the presence of BPYV in 1- to 3-year-old plants from the major strawberry producing areas of the United States, including California, Oregon, and the Mid-Atlantic States. Infection rates were highest near Watsonville, CA where more than 20% of plants tested were infected with BPYV. To our knowledge, this is the first report of BPYV infecting strawberry. BPYV and the closely related SPaV (2) pose new concerns for the U.S. strawberry industry. Studies are currently underway to determine the effects of these two viruses on strawberry vigor and productivity. References: (1) N. W. Frazier and L. L. Stubbs. Plant Dis. Rep. 53:524, 1969. (2) I. E. Tzanetakis et al. (Abstr.) Phytopathology 92:S82, 2002.
RESUMO
Raspberry bushy dwarf virus (RBDV), genus Idaeovirus, has been reported in commercial Rubus spp. from North and South America, Europe, Australia, New Zealand, and South Africa. Infection can cause reduced vigor and drupelet abortion leading to crumbly fruit and reduced yields (3,4). In recent years, Rubus germplasm in the form of seed, was obtained on several collection trips to The People's Republic of China to increase the diversity of Rubus spp. in the USDA-ARS National Clonal Germplasm Repository, (Corvallis, OR). Before planting in the field, seedlings were tested for the presence of RBDV, Tomato ringspot virus, and Tobacco streak virus using triple-antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA) (antiserum produced by R. R. Martin). One symptomless plant of R. multibracteatus H. Lev. & Vaniot (PI 618457 in USDA-ARS GRIN database), from Guizhou province in China, tested positive for RBDV (RBDV-China). After mechanical transmission on Chenopodium quinoa Willd., this isolate produced typical symptoms of RBDV (3). To determine if RBDV-China was a contaminant during the handling of the plants, or if the source was a seedborne virus, the coat protein gene was sequenced and compared to published sequences of RBDV. RNA was extracted from leaves of R. multibracteatus and subjected to reverse transcription-polymerase chain reaction (RT-PCR) using primers that flank the coat protein gene. Products from four separate PCR reactions were sequenced directly or were cloned into the plasmid vector pCR 2.1 (Invitrogen, Carlsbad, CA) and then sequenced. The coding sequence of the coat protein gene of RBDV-China was 87.5% (722/825) identical to that isolated from black raspberry (Genbank Accession No. s55890). The predicted amino acid sequences were 91.6% (251/274) identical. Previously, a maximum of five amino acid differences had been observed in the coat proteins of different RBDV strains (1). The 23 differences observed between RBDV-China and the isolate from black raspberry (s55890) confirm that the RBDV in R. multibracteatus is not a greenhouse contaminant but is indeed a unique strain of RBDV. In addition, monoclonal antibodies (MAbs) to RBDV (2) were tested against RBDV-China. In these tests, MAb D1 did not detect RBDV-China, whereas MAb R2 and R5 were able to detect the strain. This is the first strain of RBDV that has been clearly differentiated by MAbs using standard TAS-ELISA tests. Although RBDV is common in commercial Rubus spp. worldwide, to our knowledge, this is the first report of RBDV in R. multibracteatus, and the first report of RBDV from China. The effects of this new strain of RBDV could be more or less severe, or have a different host range than previously studied strains. It is more divergent from the type isolate than any other strain that has been studied to date. Phylogenetic analysis of coat protein genes of RBDV may be useful in understanding the evolution and spread of this virus. References: (1) A. T. Jones et al. Eur. J. Plant Pathol. 106:623, 2000. (2) R. R. Martin. Can. J. Plant. Pathol. 6:264, 1984. (3) A. F. Murant. Raspberry Bushy Dwarf. Page 229 in: Virus Diseases of Small Fruits. R. H. Converse, ed. U.S. Dep. Agric. Agric. Handb. 631, 1987. (4) B. Strik and R. R. Martin. Plant Dis. 87:294, 2003.
RESUMO
GEM231 is a mixed-backbone oligonucleotide targeting the regulatory subunit alpha of type I protein kinase A, which plays an important role in growth and maintenance of malignancies. Preclinically, GEM231 inhibited human cancer xenografts either alone or synergistically with chemotherapeutic agents and has demonstrated an improved metabolic stability and safety profile compared to the first-generation compounds. Objectives of this study were to define the safety profile and pharmacokinetics of GEM231 administered as 2-h IV infusions twice weekly in patients with refractory solid tumors. Fourteen patients (13 evaluable for safety) received escalating doses of GEM231 at 20-360 mg/m2 (2.5-9 mg/kg). Tumor histologies included non-small cell lung cancer, renal cell cancer, sarcoma, and others. The plasma pharmacokinetics of GEM231 were linear and predictable. Maximum plasma concentration (Cmax) reached 50-70 microg/ml (8-13 microM) at dose 360 mg/m2 and 27-32 microg/ml at dose 240 mg/m2. The plasma half-life was about 1.5 h. The only clinical toxicities were transient grade I-II fever and fatigue at doses > or = 240 mg/m2. There was no treatment-related complement activation or thrombocytopenia at any dose level, except with the first dose in one patient who had pre-existing borderline thrombocytopenia. Transient activated partial thrombin time prolongation occurred at doses > or =160 mg/m2. Dose-limiting toxicities included transient activated partial thrombin time prolongation (one of three patients at 360 mg/m2) and cumulative reversible transaminase elevation (three of three patients at 360 mg/m2 and three of six patients at 240 mg/m2 during weeks 3-10). One patient with colon cancer had stabilization of a previously rising carcinoembryonic antigen. Thus, in this first clinical evaluation of a mixed-backbone oligonucleotide in cancer patients, high plasma concentrations of GEM231 were well tolerated without significant acute toxicities, but prolonged treatment was associated with reversible transaminitis. Although 240 mg/m2 by 2-h infusion twice weekly was safe for a 4-week treatment duration, alternative dosing schedules are being tested to minimize the cumulative toxicity, which will be essential to extend the duration of therapy at the highest GEM231 dose tested.
Assuntos
Proteínas Quinases Dependentes de AMP Cíclico/antagonistas & inibidores , Neoplasias/tratamento farmacológico , Oligonucleotídeos Antissenso/farmacocinética , Idoso , Alanina Transaminase/sangue , Alanina Transaminase/efeitos dos fármacos , Área Sob a Curva , Sequência de Bases , Carcinoma Pulmonar de Células não Pequenas/tratamento farmacológico , Carcinoma Pulmonar de Células não Pequenas/metabolismo , Carcinoma de Células Renais/tratamento farmacológico , Carcinoma de Células Renais/metabolismo , Subunidade RIalfa da Proteína Quinase Dependente de AMP Cíclico , Proteínas Quinases Dependentes de AMP Cíclico/genética , Diarreia/induzido quimicamente , Relação Dose-Resposta a Droga , Resistencia a Medicamentos Antineoplásicos , Fadiga/induzido quimicamente , Feminino , Febre/induzido quimicamente , Humanos , Infusões Intravenosas , Neoplasias Renais/tratamento farmacológico , Neoplasias Renais/metabolismo , Neoplasias Pulmonares/tratamento farmacológico , Neoplasias Pulmonares/metabolismo , Masculino , Taxa de Depuração Metabólica , Pessoa de Meia-Idade , Neoplasias/metabolismo , Oligonucleotídeos Antissenso/efeitos adversos , Oligonucleotídeos Antissenso/química , Tempo de Tromboplastina Parcial , Sarcoma/tratamento farmacológico , Sarcoma/metabolismo , Fatores de Tempo , Resultado do TratamentoRESUMO
In a 1998 virus survey (2) conducted on 23 commercial strawberry (Fragaria × ananassa Duchesne) production farms in the state of Maryland, leaf samples from 1,100 randomly sampled plants were sent to the U.S. Department of Agriculture laboratory in Corvallis, OR, for testing by enzyme-linked immunosorbant assays (ELISA). The viruses identified were Strawberry mild yellow edge, Strawberry crinkle, Strawberry veinbanding, Strawberry mottle, and Tomato ringspot viruses, all of which are known in the eastern United States. Tobacco streak virus (TSV) also was identified in 17 of the samples: 12 originated from a 1-year-old planting of 'Sweet Charlie' and 5 from another farm, of which 4 were from a 2-year-old 'Sweet Charlie' planting and 1 was from a 2-year-old 'Delmarvel' planting. Triple antibody sandwich ELISA was used to detect TSV following the procedures described by Finn and Martin (1), except that leaves from test plants were homogenized (1:20, wt/vol, in blocking buffer) and flat bottom microtiter plates (Nunc, Roskilde, Denmark) and goat anti-mouse (polyvalent) alkaline phosphatase conjugate were used in the assays. The absorbance of each well at 405 nm (A405) was read in an ELISA plate reader. Reactions were considered positive if the A405 values were greater than five times the values of healthy samples. The A405 values of healthy samples ranged from 0.0 to 0.04, with values greater than 0.20 considered positive for TSV. An independent determination of TSV was made in plants shipped from Florida to Maryland in 1999. In this instance, leaf samples from 'Sweet Charlie' plants were sent by the Maryland Department of Agriculture to Agdia Inc. (Elkhart, IN), where samples tested positive for TSV. References: (1) C. E. Finn and R. R. Martin. Plant Dis. 80:769, 1996. (2) S. C. Hokanson, et al. Adv. Strawberry Res. In press.
RESUMO
BACKGROUND: Incubating blood with phosphoenolpyruvate decreases hemoglobin oxygen affinity (HOA). This study compared transfusion with phosphoenolpyruvate-treated blood and conventionally stored blood on oxygen consumption in acutely anemic dogs. METHODS: Dogs underwent isovolemic hemodilution (hematocrit = 10%). After 1 hour they were transfused to a hematocrit of 18% with control or phosphoenolpyruvate treated blood. Cardiac output, co-oxymetry, and hemoglobin P50 measurements allowed calculation of oxygen consumption during anemia, and posttransfusion. RESULTS: Hemodilution doubled cardiac output. Transfusion with phosphoenolpyruvate-treated blood allowed greater O2 consumption than control (8.31+/-2.1 and 3.73+/-0.11 cc/kg/mm). There were no differences in arterial or venous PO2 or pH; there were marked differences in HOA, measured by posttransfusion P50 (21+/-3 versus 47+/-4), and mixed venous O2 saturation. CONCLUSIONS: Decreased HOA results in increased O2 consumption in dogs subjected to anemic hypoxia. Phosphoenolpyruvate-treated blood provides increased oxygen consumption at a similar hematocrit when compared with untreated banked blood.
Assuntos
Transfusão de Sangue , Eritrócitos/efeitos dos fármacos , Hemorragia/terapia , Consumo de Oxigênio , Fosfoenolpiruvato/farmacologia , Doença Aguda , Animais , Preservação de Sangue , Débito Cardíaco , Cães , Hematócrito , Hemodiluição , Hemodinâmica , Hemoglobinas/análise , Hemorragia/sangue , Hemorragia/metabolismo , Hemorragia/fisiopatologia , Oxigênio/sangue , Oxiemoglobinas/análiseRESUMO
Lung volumes forced expiratory flow rates and carbon monoxide diffusing capacity (apnea) were measured in 397 non-smoking, nonatopic, asymptomatic subjects (219 women, 178 men). The equipments and methods for measurements met the ATS criteria. The linear regression of the different variables according to age and height allowed the elaboration of a new set of predictive equations (Quebec). When comparing the different reference values used in North America and Europe, it is found that those of Miller and associates as well as those recommended by the CECA provide the best description of the Quebec situation. However, we would eventually prefer the reference values of Miller and associates over those of the CECA, because they better fit the current ATS criteria and also provide references for smokers. Lung volumes and forced expiratory flow rates of 97 non-smoking, nonatopic, asymptomatic manual workers were measured in the same conditions and submitted to the same comparisons. Quebec predictive values as well as those of Miller and associates isolated the same individuals in the so called abnormal zone. We therefore conclude that Quebec's standards should be preferred in the Province of Quebec pulmonary function laboratories.
Assuntos
Doenças Respiratórias/diagnóstico , Espirometria/estatística & dados numéricos , Adulto , Idoso , Feminino , Fluxo Expiratório Forçado , Humanos , Masculino , Pessoa de Meia-Idade , Quebeque , Valores de ReferênciaRESUMO
Leaves of symptomless Fragaria ananassa Duch cv. Cacanská raná were grafted onto Fragaria vesca indicator clones. Thirty-five of 72 grafted indicator plants developed leaf mottle symptoms. Isometric virus-like particles were observed in purified preparations from symptomatic leaves of F. vesca. The latter were mechanically inoculated to herbaceous host plants. A virus was successfully purified from Nicotiana occidentalis 37 B symptomatic plants by differential and sucrose density gradient centrifugations and a polyclonal antiserum to the virus was prepared. On the basis of serological reactions, symptomatology on herbaceous hosts and electron microscopy studies the virus was identified as tobacco necrosis virus (TNV) D-strain. This is the first isolation of TNV from strawberry leaves and its first finding on strawberry in the Czech Republic. The new experimental hosts N. aucalis, N. bentamiana, N. occidentalis 37 B (systemic hosts), and Ammobium alatum, N. bigelovi, Petunia hybrida (local hosts) for TNV are reported. These results may not exclude the presence of strawberry mottle virus as a causal agent of mottle symptoms in the tested plant samples. Further research is necessary to clarify the aetiology of the strawberry mottle.
Assuntos
Vírus de Plantas/isolamento & purificação , Plantas Comestíveis/virologia , Animais , República Tcheca , Ensaio de Imunoadsorção Enzimática , Microscopia Eletrônica , Doenças das Plantas/virologia , Folhas de Planta/virologia , Vírus de Plantas/classificação , Vírus de Plantas/imunologia , Vírus de Plantas/ultraestrutura , CoelhosRESUMO
A system for the expression and purification of histidine-tagged proteins from plants has been developed using a tobacco etch potyvirus (TEV)-derived gene vectors. The vectors offered a convenient polylinker and a choice of histidine tagging at the recombinant proteins' N or C termini. These vectors were utilized for expression of proteins encoded by beet yellows closterovirus (BYV). Approximately 4 micrograms/g of 20-kDa BYV protein was readily isolated from plants systemically infected by hybrid TEV. In contrast, only minute quantities of 22-kDa BYV capsid protein (CP) histidine-tagged at its N or C terminus could be purified. Rapid degradation of the recombinant CP has been implicated in its failure to accumulate in infected plants. Fusion with TEV HC-Pro stabilized the histidine-tagged BYV CP and facilitated purification of the fusion product from infected plants. This same fusion approach was successfully used with the 24-kDa minor BYV CP. The recombinant proteins were recognized by histidine-tag-specific monoclonal antibody in immunoblot analysis. These results demonstrate the utility of a designed series of TEV vectors for expression, detection, and purification of the recombinant proteins and suggest that intrinsic protein stability is a major factor in a recovery of recombinant proteins from plants.
Assuntos
Closterovirus/metabolismo , Histidina , Plantas/virologia , Potyvirus/genética , Proteínas Virais/biossíntese , Proteínas Virais/isolamento & purificação , Sequência de Aminoácidos , Sequência de Bases , Capsídeo/biossíntese , Capsídeo/isolamento & purificação , Vetores Genéticos , Dados de Sequência Molecular , Proteínas Recombinantes/biossíntese , Proteínas Recombinantes/isolamento & purificaçãoRESUMO
BACKGROUND: Preoperative endoscopic retrograde cholangiopancreatography (ERCP) with laparoscopic cholecystectomy (ERCP/LC) should reduce hospital stay when compared with laparoscopic cholecystectomy/intraoperative cholangiogram (LC/IOC) and selective common bile duct exploration (CBDE). METHOD: Retrospective review of 82 patients with gallstone pancreatitis. RESULTS: Thirty-one patients had preoperative ERCP/LC and 51 patients underwent LC/IOC. Nineteen percent in the ERCP/LC group developed postprocedure pancreatitis. The presence of choledocholithiasis was associated with an increased incidence of post-ERCP pancreatitis (38%) and an increased length of stay ([LOS] 24 versus 10 days). The development of post-ERCP pancreatitis markedly increased LOS to 30 days. Six percent in the LC/IOC group developed postoperative pancreatitis. The mean LOS was 10.1 days. Open CBDE increased the LOS to 14.5 days. Postoperative pancreatitis increased the LOS to 23 days. The LOS of patients with choledocholithiasis who underwent uncomplicated ERCP/ES or LC/IOC with open CBDE was similar. CONCLUSIONS: The development of postprocedure pancreatitis is a more important determinant of hospital stay than an open operative procedure. LC/IOC with its lower incidence of postprocedure pancreatitis resulted in a shorter hospital LOS even when open CBDE was performed.
Assuntos
Colangiopancreatografia Retrógrada Endoscópica , Colecistectomia Laparoscópica , Cálculos Biliares/cirurgia , Pancreatite/cirurgia , Colangiografia , Ducto Colédoco/cirurgia , Feminino , Cálculos Biliares/complicações , Humanos , Tempo de Internação , Masculino , Pessoa de Meia-Idade , Pancreatite/etiologia , Estudos RetrospectivosRESUMO
A tobacco etch virus (TEV)-based expression vector has been used for insertion of several ORFs derived from the unrelated beet yellows virus (BYV). Hybrid TEV variants expressing the BYV capsid protein, 20-kDa protein, or HSP70 homolog systemically infected Nicotiana tabacum and stably retained BYV sequences. In contrast, insertion of the ORF encoding BYV leader proteinase (L-Pro) resulted in severely impaired systemic transport and accumulation of recombinant TEV. Progeny of this virus underwent various deletions affecting the L-Pro sequence and mitigating the defects in virus spread. Model experiments involving several spontaneous and engineered mutants indicated that the central domain of BYV L-Pro was responsible for the defect in hybrid virus accumulation, whereas full-size L-Pro was required for maximal debilitation of systemic transport. Strikingly, BYV L-Pro expression did not debilitate systemic infection of hybrid TEV in Nicotiana benthamiana plants. No major defects in replication or encapsidation of recombinant RNA were revealed in N. tabacum protoplasts. These results indicated that BYV L-Pro specifically interfered with TEV systemic transport and accumulation in a host-dependent manner and suggested a potential utility of closterovirus L-Pro as an inhibitor of potyvirus infection. In addition, it was demonstrated that the 107-amino-acid-residues-long N-terminal part of the TEV helper component proteinase is not essential for systemic infection.
Assuntos
Closterovirus/metabolismo , Regulação Viral da Expressão Gênica , Nicotiana/virologia , Plantas Tóxicas , Potyvirus/metabolismo , Proteínas Virais/genética , Replicação Viral/genética , Closterovirus/genética , Genes Virais , Potyvirus/genética , Proteínas Recombinantes/genética , Proteínas Recombinantes/metabolismo , Proteínas Virais/metabolismoRESUMO
BACKGROUND: Diagnostic peritoneal lavage (DPL) is used to diagnose intra-abdominal injury in patients with stab wounds and blunt trauma. Because exploratory celiotomy is routinely performed on patients with gunshot wounds to the abdomen, DPL is rarely employed. However, several studies have questioned routine exploration and have drawn attention to the associated morbidity of negative celiotomy. Diagnostic peritoneal lavage is an easily performed and inexpensive test that may be useful in this situation. OBJECTIVE: To evaluate the performance of DPL in the diagnosis of intra-abdominal injury in hemodynamically stable patients with gunshot wounds to the abdomen. DESIGN: A prospective clinical trial. SETTING: Two urban trauma centers. PATIENTS: Patients with gunshot wounds to the abdomen and a systolic blood pressure of at least 90 mm Hg. INTERVENTIONS: Clinical predication of intra-abdominal injury in the emergency department and DPL performed in the operating room before the initiation of celiotomy. Injuries found during the celiotomy were recorded. MAIN OUTCOME MEASURES: The results of the clinical evaluation and DPL were compared with the findings of the celiotomy. RESULTS: Forty-four patients were enrolled into the study. Intra-abdominal injury was present in 32 (73%) of these patients. The senior surgery resident correctly predicted the presence of intra-abdominal injury in 36 (82%) of the patients (sensitivity = 90.0%, specificity = 58.3%, positive predictive value = 85.3%, negative predictive value = 63.6%, phi = 0.52, P < .01) in the emergency department before DPL and celiotomy were performed. Diagnostic peritoneal lavage correctly identified the presence or absence of intra-abdominal injury in 40 (91%) of the patients (positive predictive value = 96.7%, negative predictive value = 78.6%, phi = 0.79, P < .01). CONCLUSIONS: Clinical judgment is highly accurate in separating patients with tangential gunshot wounds to the abdomen from those with intra-abdominal injury but may miss patients with intra-abdominal hemorrhage. Diagnostic peritoneal lavage is highly predictive of the presence of intra-abdominal injury. The return of gross blood on aspiration or a lavage red blood cell count greater than 10 x 10(9)/L should prompt an urgent celiotomy. Missed injuries are rare and most likely to be bowel perforations. Diagnostic peritoneal lavage is an objective test that may augment clinical judgment in selecting hemodynamically stable patients with potential tangential gunshot wounds for observation and is especially useful in identifying intra-abdominal hemorrhage.