Association of A vitamin D receptor polymorphism with sporadic breast cancer development.

Breast cancer is the leading cause of cancer death among Australian women and its incidence is annually increasing. Genetic factors are involved in the complex etiology of breast cancer. The seco-steroid hormone, 1.25 dihydroxy vitamin D3 can influence breast cancer cell growth in vitro. A number of studies have reported correlations between vitamin D receptor (VDR) gene polymorphisms and several diseases including prostate cancer and osteoporosis. In breast cancer, low vitamin D levels in serum are correlated with disease progression and bone metastases, a situation also noted in prostate cancer and suggesting the involvement of the VDR. In our study, 2 restriction fragment length polymorphisms (RFLP) in the 3' region (detected by Apa1 and Taq1) and an initiation codon variant in the 5' end of the VDR gene (detected by Fok1) were tested for association with breast cancer risk in 135 females with sporadic breast cancer and 110 cancer-free female controls. Allele frequencies of the 3' Apa1 polymorphism showed a significant association (p = 0.016; OR = 1.56, 95% CI = 1.09-2.24) while the Taq1 RFLP showed a similar trend (p = 0.053; OR = 1.45, 95% CI = 1.00-2.00). Allele frequencies of the Fok1 polymorphism were not significantly different (p = 0.97; OR = 0.99, 95% CI = 0.69-1.43) in the study population. Our results suggest that specific alleles of the VDR gene located near the 3' region may identify an increased risk for breast cancer and justify further investigation of the role of VDR in breast cancer.

1 alpha,25-dihydroxyvitamin D3 receptor as a mediator of transrepression of retinoid signaling.

The receptors for retinoic acid (RA) and for 1 alpha,25-dihydroxyvitamin D3 (VD), RAR, RXR, and VDR are ligand-inducible members of the nuclear receptor superfamily. These receptors mediate their regulatory effects by binding as dimeric complexes to response elements located in regulatory regions of hormone target genes. Sequence scanning of the tumor necrosis factor-alpha type 1 receptor (TNF alpha RI) gene identified a 3' enhancer region composed of two directly repeated hexameric core motifs spaced by 2 nucleotides (DR2). On this novel DR2-type sequence, but not on a DR5-type RA response element, VD was shown to act through its receptor, the vitamin D receptor (VDR), as a repressor of retinoid signalling. The repression appears to be mediated by competitive protein-protein interactions between VDR, RAR, RXR, and possibly their cofactors. This VDR-mediated transrepression of retinoid signaling suggests a novel mechanism for the complex regulatory interaction between retinoids and VD.

Identification of a vitamin D3 response element in the fibronectin gene that is bound by a vitamin D3 receptor homodimer.

Fibronectin (FN) is an important adhesive noncollagenous glycoprotein involved in maintenance of the extracellular matrix and cell adhesiveness, loss of which has been implicated in the metastatic potential of cells. Regulation of FN occurs at the transcriptional level by the active metabolite of vitamin D3, 1,25-dihydroxyvitamin D3 (1,25-(OH)2D3). Transient transfection of homologous and heterologous promoter reporter constructs into ROS 17/2.8 (rat osteosarcoma), NIH 3T3 (mouse fibroblast), and MCF-7 (human mammary carcinoma) cell lines showed a consistent two- to threefold induction of transcription when stimulated with 1,25-(OH)2D3. These heterologous promoter transfection studies with gel shift analysis locate a third, natural DR6-type vitamin D responsive element (VDRE) at nucleotide positions -171 to -154 in the murine FN promoter. Interestingly, this VDRE is also present in rat and human FN promoters. This study shows that 1,25-(OH)2D3 induces FN transcription from an existing elevated basal transcriptional activity by acting through two putative hexameric core binding motifs which bind VDR homodimers. Furthermore, the FN VDRE is the first homodimer-type VDRE that is not overlaid by a DR3-type structure.

rHox: a homeobox gene expressed in osteoblastic cells.

Homeodomain proteins are characterized by a conserved domain with a helix-turn-helix motif. These proteins act as regulatory factors in tissue differentiation and proliferation. However, their role in the regulation of osteoblast differentiation is unknown. In this study we have identified and characterized a homeobox gene in osteoblast-like cells. This gene, termed rHox, was isolated from a cDNA library derived from rat osteoblast-like cells. The nucleotide sequence of the 1,375 base pair (bp) cDNA contains a noncoding leader sequence of 329 bp, a 735 bp open reading frame, and 312 bp of 3' noncoding sequence. Sequence comparison demonstrates that rHox is identical to the mouse Pmx gene (also called MHox) at the amino acid level and 90% homologous at the nucleotide level. Both Southwestern blotting and gel shift analyses indicate that rHox has potential to bind both the collagen I alpha 1 and the osteocalcin promoters. Transfection experiments using an rHox expression vector showed a strong repression of target promoter activity, regardless of whether the target promoters contained homeodomain binding response elements. These data suggest that rHox is a potent negative regulator of gene expression, although the specific role of rHox in bone gene regulation remains to be determined.

G/C element contributes to the cell line-specific expression of the proximal osteocalcin promoter.

Sequential activation of cell type-specific genes occurs during osteoblast development. The promoter of one such gene, osteocalcin, has been widely studied, but the DNA sequences that govern osteoblast-specific expression have not been defined. The proximal osteocalcin promoter linked to pTKCAT directs strong promoter activity in osteoblast-like ROS17/2.8 cells and comparatively weak promoter activity in nonosteoblastic NIH3T3 cells. To identify sequences important in conferring cell-specific expression of the osteocalcin gene, a deletion series of the human proximal promoter was constructed and the activities assessed in ROS17/2.8 and NIH3T3 cells. These studies identified a 30 bp sequence within the proximal promoter (osteocalcin repressor element-1 [ORE-1]) which is responsible for repressing the transcriptional activity in NIH3T3 cells. In electrophoretic mobility shift assays from both NIH3T3 and ROS17/2.8 cells, a protein complex bound to the ORE-1 that was related to a complex which binds the G/C-rich repressor element in the collagen type I (alpha 1) promoter. In addition, there was a second complex from NIH3T3 cells but not ROS17/2.8 cells that bound the ORE-1 fragment. The presence of this additional factor in NIH3T3 cells parallels the observation that constructs carrying the ORE-1 sequence have repressed promoter activity relative to the analogous constructs lacking the ORE-1 when transfected into NIH3T3 and suggests that the NIH3T3-specific factor is a repressor. These data indicate that the G/C element in the ORE-1 contributes to the repression of osteocalcin gene transcription in a nonosteoblast cell line. The high homology between the ORE-1 sequence and a related sequence in the collagen type I (alpha 2) proximal promoter suggests that homologous regions in other osteoblast-expressed genes may function similarly.

Ketorolac versus acetaminophen or ibuprofen in controlling postoperative pain in patients with strabismus.

PURPOSE: Ketorolac is a new, parenteral, nonsteroidal, anti-inflammatory agent. The authors compare the effectiveness of a single intravenous dose of ketorolac with a single oral dose of either acetaminophen or ibuprofen in controlling postoperative pain in patients with strabismus. METHODS: A prospective, randomized, double-masked study was performed on 60 patients older than 12 years of age who were undergoing strabismus surgery. The patients were randomized into one of three single-dosage treatment groups: group 1 received oral acetaminophen (650 mg); group 2 received oral ibuprofen (600 mg); and group 3 received intravenous ketorolac (60 mg) intraoperatively and placebo capsules postoperatively. Pain and sedation levels were assessed at 2 and 5 hours after surgery by having the patient mark a standard 100-mm visual analog scale. RESULTS: The ketorolac-treated patients had significantly less pain at both the 2- and 5-hour intervals after surgery compared with either the acetaminophen or ibuprofen groups (P = 0.001). There was no difference in the level of sedation among any of the three treatment groups. CONCLUSION: Intravenous ketorolac given at the conclusion of surgery was more effective than either oral acetaminophen or oral ibuprofen given 30 to 45 minutes after strabismus surgery in controlling postoperative pain. Pain relief was achieved earlier by intravenous delivery than by oral agents. Greater pain relief with ketorolac was sustained 5 hours after surgery. This facilitates suture adjustment and earlier discharge. Similar pain control is possible for other ophthalmologic surgery. Because the oral medications used in this study were administered in capsules, the results may have been different if clinically available preparations had been tested.

The efficacy of botulinum neurotoxin A for the treatment of complete and partially recovered chronic sixth nerve palsy.

Esotropia from chronic sixth nerve palsy or paresis usually requires surgery. Chemodenervation of the antagonist medial rectus muscle, while popular for the treatment of acute sixth nerve palsies and pareses, has not been used extensively for chronic cases. In this study, 22 patients with sixth nerve palsies or partially recovered palsies of greater than 5 months duration were treated with chemodenervation. The etiologies of the sixth nerve palsies were trauma (n = 7), tumor (n = 4), infection/inflammation (n = 3), nerve compression from aneurysm or increased intracranial pressure (n = 4), congenital (n = 1), ischemia (n = 2), and idiopathic (n = 1). The mean preinjection deviation was 41 prism diopters. A total of 38 injections were administered (mean, 1.7 per patient). Each patient received an injection of 2.5 to 7.5 units (mean, 4.1) of botulinum neurotoxin A to the ipsilateral medial rectus muscle. Treatment success was assessed 6 months after the last injection. A course of chemodenervation significantly improved the alignment of 9 of the 22 patients (41%). The mean postinjection deviation was 8 delta. Seven patients (32%) had single binocular vision in primary position restored. These patients had a mean horizontal binocular field of 70 degrees (range, 40 degrees to 100 degrees). Thirteen patients (59%) had only modest improvement and required surgery. The data suggest that injection of botulinum neurotoxin A is a useful treatment for some patients with chronic sixth nerve weakness. A course of chemodenervation therapy compares less favorably with transposition surgery with concomitant neurotoxin injection for the treatment of these difficult problems.

Transcriptional activation of the human osteocalcin gene by basic fibroblast growth factor.

Basic fibroblast growth factor (bFGF) has been detected in bone cells and stimulates osteoblast proliferation; however, its role in the regulation of bone metabolism remains speculative. We demonstrated that the human osteocalcin promoter is activated by bFGF when transfected into rat osteoblastic (ROS 17/2.8) cells. This effect is concentration dependent, with a twofold induction at 10 ng/ml detected after 20 h. The bFGF response is independent of both the 1,25-dihydroxyvitamin D3 [1,25-(OH)2D3] and retinoic acid activation of the osteocalcin promoter. To identify the promoter sequences through which bFGF exerts its effect, we tested a series of promoter deletion constructs for their response to bFGF. Deletion of the upstream region between -673 and -588 bp results in a significant loss of induction. Gel-shift analysis demonstrates that proteins present in ROS 17/2.8 nuclear extracts bind specifically to these sequences. This region alone was unable to confer the bFGF response on a minimal osteocalcin or an heterologous promoter. However, sequences between -678 and -476 bp, which also includes the vitamin D response element (VDRE), were able to confer bFGF inducibility on both a minimal osteocalcin and a heterologous promoter. These data suggest that induction of the human osteocalcin promoter by bFGF requires the interaction of more than one sequence element.

Peak bone mass and osteoporosis prevention.

The incidence of osteoporotic fractures increases with advancing age. Despite advances in therapy, reversal of bone loss in established osteoporosis remains problematic and deformities and disability due to fractures often persist. Therefore the logical approach to osteoporosis treatment is preventive. Risk of fracture is determined largely by bone density, which is the end result of peak value achieved at skeletal maturity and subsequent age- and menopause-related bone loss. Thus the determinants of peak bone density and bone loss require full characterization. Environmental and lifestyle factors are important determinants of bone density, particularly physical activity and diet. For example, muscle strength and physical fitness predict bone density, so that regular moderate exercise may help maintain bone mass but probably does not reverse loss. Long-term calcium intake appears to be important for achievement and maintenance of peak bone density, especially in males. Smoking and excessive alcohol intake are deleterious to bone mass. Cultural norms in diet, lifestyle and physical activity obviously have an impact on bone density. Genetic factors have a strong role in determining the wide range in 'normal' peak bone mass. Moreover we have found strong genetic determinants of rates of change of bone mass in the lumbar spine and similar trends for sites in the femoral neck. We have shown previously that genetic factors influence bone turnover indices, particularly osteocalcin. Investigating these relationships with restriction fragment length polymorphisms, we have identified variants of the vitamin D receptor gene which predict osteocalcin levels and presumably bone turnover.(ABSTRACT TRUNCATED AT 250 WORDS)

Nonhypercalcemic 1,25-(OH)2D3 analogs potently induce the human osteocalcin gene promoter stably transfected into rat osteosarcoma cells (ROSCO-2).

1,25-Dihydroxyvitamin D3 [1,25-(OH)2D3] is the active hormonal form of vitamin D3 and has potent effects on bone and calcium regulation. Over the past decade it has become apparent that 1,25-(OH)2D3 has other effects on cellular proliferation that potentially could be developed for therapy in human malignancy. Since the hypercalcemic effects of 1,25-(OH)2D3 have limited that use in the human, novel nonhypercalcemic analogs of 1,25-(OH)2D3 have been synthesized. The molecular mechanism of this divergence in these antiproliferative and calcium-regulating actions is unexplained. We have previously examined the human bone-specific gene osteocalcin as a model of the molecular mechanisms of vitamin D action in bone and have shown that induction of the osteocalcin gene by 1,25-(OH)2D3 is mediated through an unique and complex palindromic region of the promoter similar to but distinct from those of other steroid hormone-responsive elements. Using an osteosarcoma cell line permanently transfected with the vitamin D-responsive promoter of the human osteocalcin gene linked to a "reporter" gene, we have shown that there is a dose-dependent induction of CAT activity by 1,25-(OH)2D3 and that the potencies of vitamin D metabolites and analogs are comparable to those found in other vitamin D bioassays. Furthermore, vitamin D analogs, including MC-903, 22-oxa-1,25-(OH)2D3, and delta 22-1,25S,26-trihydroxyvitamin D3, which effect cellular differentiation but lack hypercalcemic activity in vivo, exhibit osteocalcin promoter inductive actions virtually identical to those of 1,25-(OH)2D3. Consideration of these and other data support the hypothesis that the divergent effects of such analogs on differentiation and calcium homeostasis reflect pharmacokinetic differences in vivo rather than distinct 1,25-(OH)2D3-sensitive pathways.

1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene.

The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.

Nodulin-26, a peribacteroid membrane nodulin is expressed independently of the development of the peribacteroid compartment.

The peribacteroid membrane (pbm) of root nodules is derived from the plant cell plasma membrane but contains in addition several nodule-specific host proteins (nodulins). Antibodies raised against purified pbm of soybean were used to immunoprecipitate polysomes to isolate an RNA fraction that served as a template for the synthesis of a cDNA probe for screening a nodule-specific cDNA library. Clone p1B1 was found to encode a 26.5 kDa polypeptide (nodulin-26) which is immunoprecipitable specifically with the anti-pbm serum. Nodulin-26 has features of a transmembrane protein and its structure differs from that of nodulin-24 which appears to be a surface protein of pbm. The expression of these two pbm nodulins was examined in nodules induced by Bradyrhizobium japonicum Tn5 mutants that arrest nodule development at different stages of pbm biosynthesis. Nodules that do not show release of bacteria from the infection thread express nodulin-24 at a very low level. In contrast, the expression of nodulin-26 occurs fully in nodules that form infection threads only and is not affected by the release of bacteria from the threads.