Whole-transcriptome profiling reveals potential biomarkers for the reversal of thymic epithelial cell senescence by umbilical cord mesenchymal stem cells.

BACKGROUND: Reduced numbers and dysfunction of thymic epithelial cells (TECs) are important factors of thymic degeneration. Previous studies have found that umbilical cord mesenchymal stem cells (UCMSCs) reverse the structure and function of the senescent thymus in vivo. However, the transcriptomic regulation mechanism is unclear. METHODS: TECs were cultured with H2O2 for 72 hours to induce senescence. UCMSCs were cocultured with senescent TECs for 48 hours to detect SA-ß-gal, P16 and Ki67. The cocultured TECs were collected for lncRNA, mRNA and miRNA sequencing to establish a competitive endogenous regulatory network (ceRNA). And RT-qPCR, immunofluorescence staining, and western blot were used to identified key genes. RESULTS: Our results showed that H2O2 induced TEC aging and that UCMSCs reversed these changes. Compared with those in aged TECs, 2260 DE mRNAs, 1033 DE lncRNAs and 67 DE miRNAs were differentially expressed, and these changes were reversed by coculturing the cells with UCMSCs. Differential mRNA enrichment analysis of ceRNA regulation revealed that the PI3K-AKT pathway was a significant signaling pathway. UCMSC coculture upregulated VEGFA, which is the upstream factor of the PI3K-AKT signaling pathway, and the expression of the key proteins PI3K and AKT. Thus, the expression of the cell cycle suppressor P27, which is downstream of the PI3K-AKT signaling pathway, was downregulated, while the expression of the cell cycle regulators CDK2 and CCNE was upregulated. CONCLUSION: UCMSC coculture upregulated the expression of VEGFA, activated the PI3K-AKT signaling pathway, increased the expression of CDK2 and CCNE, decreased the expression of P27, and promoted the proliferation of TECs.

Mechanisms of Stem Cells and Their Secreted Exosomes in the Treatment of Autoimmune Diseases.

Stem cells play a therapeutic role in many diseases by virtue of their strong self-renewal and differentiation abilities, especially in the treatment of autoimmune diseases. At present, the mechanism of the stem cell treatment of autoimmune diseases mainly relies on their immune regulation ability, regulating the number and function of auxiliary cells, anti-inflammatory factors and proinflammatory factors in patients to reduce inflammation. On the other hand, the stem cell- derived secretory body has weak immunogenicity and low molecular weight, can target the site of injury, and can extend the length of its active time in the patient after combining it with the composite material. Therefore, the role of secretory bodies in the stem cell treatment of autoimmune diseases is increasingly important.

Cellular and molecular mechanisms of highly active mesenchymal stem cells in the treatment of senescence of rhesus monkey ovary.

BACKGROUND: Recent studies have shown that umbilical cord mesenchymal stem cells have an anti-aging effect in ovaries, but the cellular and molecular mechanisms of HA-MSC ovarian anti-aging remain to be studied. Therefore, we conducted a 10X Genomics single-nucleus transcriptome sequencing experiment on the ovaries of macaque monkeys after HA-MSC treatment. METHODS: The results of cell subgroup classification were visualized by 10X Genomics single nuclear transcriptome sequencing. The aging model of hGCs was established, and the migration ability of the cells was determined after coculture of HA-MSCs and aging hGCs. The genes screened by single nuclear transcriptional sequencing were verified in vitro by qPCR. RESULTS: Compared with the aging model group, the number of cell receptor pairs in each subgroup of the HA-MSC-treated group increased overall. Treatment with 200 µmol/L H2O2 for 48 h was used as the optimum condition for the induction of hGC senescence. After coculture of noncontact HA-MSCs with senescent hGCs, it was found that HA-MSCs can reverse the cell structure, proliferation ability, senescence condition, expression level of senescence-related genes, and expression level of key genes regulating the senescence pathway in normal hGCs. CONCLUSIONS: HA-MSC therapy can improve the tissue structure and secretion function of the ovary through multiple cellular and molecular mechanisms to resist ovarian aging. In vitro validation experiments further supported the results of single-cell sequencing, which provides evidence supporting a new option for stem cell treatment of ovarian senescence.

Increased Expression of Pluripotent Factors in Human Umbilical Cord Mesenchymal Stem Cells Transfected with Three tRF Molecules.

tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.

Mechanism of Thymus Rejuvenation in Elderly Macaques.

Senile thymus atrophy is an important factor leading to decreased immune function. Repairing the atrophic thymus tissue structure, rebuilding immune function, and replenishing the number of exogenous stem cells may be ideal methods. In this study, bone marrow mesenchymal stem cells were intravenously infused into elderly macaques. We found that thymus volume was substantially increased, some thymus tissue regeneration was observed, the degree of thymus tissue fibrosis decreased, collagen fiber deposition decreased, cortical and medulla structures emerged gradually, the number of apoptotic cells decreased significantly, and the expression of apoptosis-related proteins decreased. For the effects of stem cell therapy on aging-related genes, we performed transcriptomic analysis of thymus tissue. The results show the expression pattern of the tissue transcriptome tended to be similar to the thymus expression pattern in young macaques compared with the elderly group, reverse aging-related proteins. Based on the results, it is suggested that stem cell therapy is an ideal method to prevent or reverse the aging of the thymus.

Lack of tumorigenesis and protumorigenic activity of human umbilical cord mesenchymal stem cells in NOD SCID mice.

BACKGROUND: The tumorigenesis of infused umbilical cord mesenchymal stem cells (UC-MSCs) is being preclinically evaluated. METHODS: We observed tumor formation in NOD SCID mice after a single subcutaneous injection of hUC-MSCs and the effect of these cells on tumor growth in tumor-bearing mice. Three generations (P5, P7, and P10) of hUC-MSCs (1 × 107) from two donors (hUC-MSC1 and hUC-MSC2) were inoculated subcutaneously into NOD SCID mice. Subcutaneous transplantation models were established in NOD SCID mice with human cervical cancer HeLa cells (solid tumor) and human B cell lymphoma Raji cells (hematological tumor). Then, the animals were euthanized, gross dissection was performed, and tissues were collected. Various organs were observed microscopically to identify pathological changes and tumor metastasis. RESULTS: In the tumorigenesis experiment, no general anatomical abnormalities were observed. In the tumor promotion experiment, some animals in the HeLa groups experienced tumor rupture, and one animal died in each of the low- and medium-dose hUC-MSC groups. The results may have occurred due to the longer feeding time, and the tumor may have caused spontaneous infection and death. Pathological examination revealed no metastasis to distant organs in any group. In the Raji tumor model, some animals in each group experienced tumor rupture, and one animal in the medium-dose hUC-MSC group died, perhaps due to increased tumor malignancy. Thus, hUC-MSCs neither promoted nor inhibited tumor growth. No cancer cell metastasis was observed in the heart, liver, spleen, lungs, kidneys or other important organs, except that pulmonary venule metastasis was observed in 1 animal in the model group. CONCLUSIONS: Injected hUC-MSCs were not tumorigenic and did not significantly promote or inhibit solid or hematological tumor growth or metastasis in NOD SCID mice.

Establishment of a Systemic Inflammatory Response Syndrome Model and Evaluation of the Efficacy of Umbilical Cord Mesenchymal Stem Cell Transplantation.

Based on the characteristics of modern weapon injury, a repetitive model of traumatic systemic inflammatory response syndrome (SIRS) and an evaluation system were established. The models were treated with GFP-labeled tree shrew umbilical cord mesenchymal stem cells (UCMSCs). Forty out of 50 tree shrews were used to make a unilateral femoral comminuted fracture. Lipopolysaccharide was injected intravenously to create a traumatic SIRS model. The other 10 shrews were used as normal controls. After the model was established for 10 days, 20 tree shrews were injected intravenously with GFP-labeled UCMSCs, and 18 tree shrews were not injected as the model control group. The distribution of GFP-labeled cells in vivo was measured at 2 and 10 days after injection. Twenty days after treatment, the model group, the normal control group, and the treatment group were taken to observe the pathological changes in each tissue, and blood samples were taken for the changes in liver, renal, and heart function. Distribution of GFP-positive cells was observed in all tissues at 2 and 10 days after injection. After treatment, the HE staining results of the treatment group were close to those of the normal group, and the model group had a certain degree of lesions. The results of liver, renal, and heart function tests in the treatment group were returned to normal, and the results in the model group were abnormally increased. UCMSCs have a certain effect on the treatment of traumatic SIRS and provide a new technical solution for modern weapon trauma treatment.

The effects of BMMSC treatment on lung tissue degeneration in elderly macaques.

BACKGROUND: Age-associated lung tissue degeneration is a risk factor for lung injury and exacerbated lung disease. It is also the main risk factor for chronic lung diseases (such as COPD, idiopathic pulmonary fibrosis, cancer, among others). So, it is particularly important to find new anti-aging treatments. METHODS: We systematically screened and evaluated elderly senile multiple organ dysfunction macaque models to determine whether BMMSCs inhibited lung tissue degeneration. RESULTS: The average alveolar area, mean linear intercept (MLI), and fibrosis area in the elderly macaque models were significantly larger than in young rhesus monkeys (p < 0.05), while the capillary density around the alveoli was significantly low than in young macaque models (p < 0.05). Intravenous infusion of BMMSCs reduced the degree of pulmonary fibrosis, increased the density of capillaries around the alveoli (p < 0.05), and the number of type II alveolar epithelium in elderly macaques (p < 0.05). In addition, the infusion reduced lung tissue ROS levels, systemic and lung tissue inflammatory levels, and Treg cell ratio in elderly macaque models (p < 0.05). Indirect co-cultivation revealed that BMMSCs suppressed the expression of senescence-associated genes, ROS levels, apoptosis rate of aging type II alveolar epithelial cells (A549 cells), and enhanced their proliferation (p < 0.05). CONCLUSIONS: BMMSC treatment inhibited age-associated lung tissue degeneration.

Transplantation of chicken egg white extract-induced rabbit PBMCs as a treatment for renal ischemia-reperfusion injury in rabbits.

Ischemia-reperfusion injury is an important contributor to acute kidney injury and a major factor affecting early functional recovery after kidney transplantation. We conducted this experiment to investigate the protective effect of induced multipotent stem cell transplantation on renal ischemia-reperfusion injury. Forty rabbits were divided into four groups of 10 rabbits each. Thirty rabbits were used to establish the renal ischemia-reperfusion injury model, and ten rabbits served as the model group and were not treated. Among the 30 rabbits with renal ischemia-reperfusion injury, 10 rabbits were treated with induced peripheral blood mononuclear cells (PBMCs), and 10 other rabbits were treated with noninduced PBMCs. After three weekly treatments, the serum creatinine levels, urea nitrogen levels and urine protein concentrations were quantified. The kidneys were stained with hematoxylin-eosin (HE), periodic acid-Schiff (PAS) and Masson's trichrome and then sent for commercial metabolomic testing. The kidneys of the rabbits in the model group showed different degrees of pathological changes, and the recovery of renal function was observed in the group treated with induced cells. The results indicate that PBMCs differentiate into multipotent stem cells after induction and exert a therapeutic effect on renal ischemia-reperfusion injury.

Effect and mechanism of human umbilical cord mesenchymal stem cells in treating allergic rhinitis in mice.

A model of allergic rhinitis (AR) in BALB/c mice was established and evaluated to provide experimental subjects for further research. Preparation of human umbilical cord mesenchymal stem cells (hUCMSCs), including isolation, expansion culture, passaging, cryopreservation, and preparation of cell suspensions, provided materials for experimental research and clinical treatment. The mouse AR model was established by ovalbumin (OVA) intraperitoneal injection and the nasal stimulation induction method, and the model had a good effect and high repeatability. GFP-labeled hUCMSCs had good effects and were stable cells that could be used for tracking in animals. Transplantation of hUCMSCs by intraperitoneal and tail vein injections had a specific effect on the AR model of mice, and tail vein injection had a better effect. Tracking of hUCMSCs in vivo showed that the three groups of mice had the greatest number of hUCMSCs in the nose at week 2. The mouse AR model was used to evaluate the efficacy of hUCMSC transplantation via multiple methods for AR. The distribution of hUCMSCs in vivo was tracked by detecting green fluorescent protein (GFP), and the treatment mechanism of hUCMSCs was elucidated. This study provides technical methods and a theoretical basis for the clinical application of hUCMSCs.

Umbilical cord mesenchymal stem cells protect thymus structure and function in aged C57 mice by downregulating aging-related genes and upregulating autophagy- and anti-oxidative stress-related genes.

BACKGROUND: To study the effect of allogeneic umbilical cord mesenchymal stem cell transplantation on the structure and function of the thymus in aged C57 mice and provide a new method for the treatment of senile thymic atrophy. RESULTS: The changes in the thymus cortex and medulla volume and the lymphocyte ratio were analyzed by immunofluorescence. For thymus tissue sections, immunohistochemical staining was performed to detect p16, p53, SOD, becline1, LC3b, p62, sirt1, and sirt3. Changes in CK5, CK8, CD4 and CD8 expression were observed. Treatment with mUCMSCs could promote hair regeneration in aging mice and regenerate the thymus structure. CONCLUSIONS: mUCMSCs inhibited senescence of the thymus and promoted structural and functional thymus regeneration by downregulating the senescence genes p53 and p16 and upregulating the SOD, Sirt1 and Sirt3 genes, but the mechanism requires further research. METHODS: C57 mice were obtained and met the requirements of thymic aging. mUCMSCs were infused via the tail vein at a dose of 1×107 cells/kg twice per week for 3 weeks. Six weeks after the last transplantation, the thymus was weighed, and the thymus-to-body weight ratio was calculated. The thymus tissue was stained with HE.

Mechanism and therapeutic effect of umbilical cord mesenchymal stem cells in inflammatory bowel disease.

Inflammatory bowel disease (IBD) is a persistent and chronic disease that is characterized by destructive gastrointestinal (GI) inflammation. Researchers are trying to identify and develop new and more effective treatments with no side effects. Acute and chronic mouse models of IBD were established using dextran sulfate sodium (DSS) solution. To evaluate the efficacy and mechanism, umbilical cord mesenchymal stem cells (UCMSCs) were obtained from Kunming (KM) mice and humans. In the chronic IBD study, the survival rates of the normal control, model, mouse UCMSC (mUCMSC) and human UCMSC (hUCMSC) groups were 100%, 40%, 86.7%, and 100%, respectively. The histopathological scores of the normal control, intraperitoneal injection, intravenous treatment, and model groups were 0.5 ± 0.30, 5.9 ± 1.10, 8.7 ± 1.39, and 8.8 ± 1.33 (p = 0.021). UCMSCs promoted the expression of the intestinal tight junction protein occludin, downregulated the protein expression of the autophagy marker LC3A/B in colon tissue, and upregulated the expression of VEGF-A and VEGFR-1 at the injured site. This study provides an experimental model for elucidating the therapeutic effects of UCMSCs in IBD. We provide a theoretical basis and method for the clinical treatment of IBD using UCMSCs.

MicroRNA-155 affects oxidative damage through regulating autophagy in endothelial cells.

MicroRNA-155 (miRNA-155) is a typical multifunctional miRNA, which serves a crucial role in the regulation of numerous vessel cells. However, its effects on dysfunctional endothelial cells have not been completely elucidated. In order to investigate the signaling pathway of miRNA-155-induced cell injury, H2O2 was used to establish an oxidative stress cell model, and miR-155 was transfected into H2O2-treated cells. The CCK8 assay was then employed to examine the effect of miR-155 on the cell proliferations of H2O2-treated cells, and the expressions of Microtubule Associated Protein 1 Light Chain 3 (LC3) and Sequestosome 1 (P62) were detected to examine the effect of miR-155 on the autophagy of Human umbilical vein endothelial cells, and then the formation of intracellular autophagosomes was observed. The results indicated that endothelial cell proliferation was promoted, and oxidant-induced injury was decreased when the expression of miR-155 was inhibited. In addition, the results also demonstrated that when the miR-155 inhibitor was used, the expression of LC3 was increased and the expression of P62 was decreased. This suggests that modulated miR-155 can prevent oxidative damage in endothelial cells, by regulating the level of autophagy. Furthermore, the present study also demonstrated that miR-155 regulated autophagy via promotion of the expression of the autophagy-related gene, Autophagy Related 5 (ATG5). In conclusion, the attenuated expression of miR-155 can decrease oxidant-induced injury and promote cell proliferation via upregulating autophagy, which subsequently affects the expression of ATG5. The present study provides a novel insight into microRNAs as potential therapeutics for the treatment of heart disease.

Relationship between senescence in macaques and bone marrow mesenchymal stem cells and the molecular mechanism.

The relationship between bone marrow mesenchymal stem cells (BMSCs) and aging, as well as the antiaging effects of BMSCs, was observed. An aging macaque BMSC model was established. We isolated BMSCs from young and aged macaques and used RT-PCR and Western blot to confirm the aging-related mRNAs and their expression, revealing that TERT, SIRT1 and SIRT6 expression was decreased in the aged BMSCs. The morphology, immunophenotype, differentiation potential, proliferation potential, and antiaging effects of aged and young BMSCs on 293T cells were compared. The expression of aging-related genes and the difference between the secreted cytokines in natural aging and induced aging BMSCs were observed. The transcriptome of peripheral blood mononuclear cells from macaques was analyzed by high-throughput sequencing. Finally, the transcriptional characteristics and regulatory mechanisms of gene transcription in aging macaques were investigated.

Efficacy and mechanisms underlying the effects of allogeneic umbilical cord mesenchymal stem cell transplantation on acute radiation injury in tree shrews.

Umbilical cord mesenchymal stem cells (UC-MSCs) exert strong immunomodulatory effects and can repair organs. However, their roles in radiation injury remain unclear. We show that in tree shrews with acute radiation injury, injected UC-MSCs significantly improved survival rates, reduced lung inflammation and apoptosis, prevented pulmonary fibrotic processes, recovered hematopoiesis, and increased blood counts. A protein microarray analysis showed that serum levels of the anti-inflammatory cytokines IL-10 and IL-13 and the growth factors BMP-5, BMP-7, HGF, insulin, NT-4, VEGFR3, and SCF were significantly higher, while those of the inflammatory cytokines IL-2, TIMP-2, TNF-α, IFN-γ, IL-1ra, and IL-8 and the fibrosis-related factors PDGF-BB, PDGF-AA, TGF-ß1, IGFBP-2, and IGFBP-4 were significantly lower in UC-MSC-injected animals. A transcriptome analysis of PBMCs showed that the mRNA expression of C1q was upregulated, while that of HLA-DP was downregulated after UC-MSC injection. These results confirm the immunohistochemistry results. eGFP-labeled UC-MSCs were traced in vivo and found in the heart, liver, spleen, lungs, kidneys, thymus, small intestine and bone marrow. Our findings suggest that UC-MSC transplantation may be a novel therapeutic approach for treating acute radiation injury.

Telomere shortening activates TGF-ß/Smads signaling in lungs and enhances both lipopolysaccharide and bleomycin-induced pulmonary fibrosis.

Telomere shortening is associated with idiopathic pulmonary fibrosis (IPF), a high-morbidity and high-mortality lung disease of unknown etiology. However, the underlying mechanisms remain largely unclear. In this study, wild-type (WT) mice with normal telomeres and generation 3 (G3) or G2 telomerase RNA component (TERC) knockout Terc-/- mice with short telomeres were treated with and without lipopolysaccharide (LPS) or bleomycin by intratracheal injection. We show that under LPS induction, G3 Terc-/- mice develop aggravated pulmonary fibrosis as indicated by significantly increased α-SMA, collagen I and hydroxyproline content. Interestingly, TGF-ß/Smads signaling is markedly activated in the lungs of G3 Terc-/- mice, as indicated by markedly elevated levels of phosphorylated Smad3 and TGF-ß1, compared with those of WT mice. This TGF-ß/Smads signaling activation is significantly increased in the lungs of LPS-treated G3 Terc-/- mice compared with those of LPS-treated WT or untreated G3 Terc-/- mice. A similar pattern of TGF-ß/Smads signaling activation and the enhancing role of telomere shortening in pulmonary fibrosis are also confirmed in bleomycin-induced model. Moreover, LPS challenge produced more present cellular senescence, apoptosis and infiltration of innate immune cells, including macrophages and neutrophils in the lungs of G3 Terc-/- mice, compared with WT mice. To our knowledge, this is the first time to report telomere shortening activated TGF-ß/Smads signaling in lungs. Our data suggest that telomere shortening cooperated with environment-induced lung injury accelerates the development of pulmonary fibrosis, and telomere shortening confers an inherent enhancing factor to the genesis of IPF through activation of TGF-ß/Smads signaling.

Role of Bone Marrow Mesenchymal Stromal Cells in Attenuating Inflammatory Reaction in Lipopolysaccaride-induced Acute Kidney Injury of Rats Associated with TLR4-NF-κB Signaling Pathway Inhibition.

Bone marrow mesenchymal stromal cells (BMSCs) have positive therapeutic effects on inflammation associated diseases. However, the underlying mechanism is largely unknown. This study was conducted to investigate whether BMSCs could alleviate the inflammation reaction in lipopolysaccaride (LPS)-induced acute kidney injury (septic-AKI) of rats via inhibition of toll-like receptors (TLR4)-nuclear factor-kappa B (NF-κB) signaling pathway. The septic-AKI rat model was established by injecting the 1ml/mg LPS through the femoral vein. Based on this model, rats were subjected to BMSC transplantation, PDTC (a kind of NF-κB inhibitor) administration alone, and combined treatment of the first two together. Results showed that LPS treatment caused the increases of the concentration of blood urea nitrogen (BUN) and serum creatinine (SCr), accompanied by tissue injury and the up-regulation of TLR4 and NF-κB, that was its key downstream signaling molecule, in both mRNA and protein level. Notably, it has been found that BMSCs transplantation significantly reversed the already upregulated concentration of BUN and SCr, dramatically attenuated the event of the tissue injury, and prominently reduced mortality after AKI. These were paralleled by down-regulation of the level of TLR4 and NF-κB. These effects of BMSCs transplantation were similar to those of PDTC treatment. Importantly, the effects in the combination therapy of BMSCs transplantation and PDTC group were much stronger than those of either BMSCs or PDTC used alone. These findings suggest that BMSCs transplantation contributes to therapeutic effects in LPS-induced AKI rat model, and that the most obvious effects occurred in the combined treatment group, with BMSCs and PDTC together, which was tightly associated with inhibition of the TLR4-NF-κB signaling pathway.

Chronic Toxicity Test in Cynomolgus Monkeys For 98 Days with Repeated Intravenous Infusion of Cynomolgus Umbilical Cord Mesenchymal Stem Cells.

BACKGROUND/AIMS: Stem cell-based therapy is attractive in many clinical studies, but current data on the safety of stem cell applications remains inadequate. This study observed the safety, immunological effect of cynomolgus monkey umbilical cord mesenchymal stem cells (mUC-MSCs) injected into cynomolgus monkeys, in order to evaluate the safety of human umbilical cord mesenchymal stem cells (hUC-MSCs) prepared for human clinical application. METHODS: Eighteen cynomolgus monkeys were divided into three groups. Group 1 is control group, Group 2 is low-dose group, Group 3 is high-dose group. After repeated administrations of mUC-MSCs, cynomolgus monkeys were observed for possible toxic reactions. RESULTS: During the experiment, no animal died. There were no toxicological abnormalities in body weight, body temperature, electrocardiogram, coagulation and pathology. In the groups 2 and 3, AST and CK transiently increased, and serum inorganic P slightly decreased. All animals were able to recover at 28 days after the infusion was stopped. In the groups 2 and 3, CD3+ and IL-6 levels significantly increased, and recovery was after 28 days of infusion. There were no obvious pathological changes associated with the infusion of cells in the general and microscopic examinations. CONCLUSIONS: The safe dosage of repeated intravenous infusion of mUC-MSCs in cynomolgus monkeys is 1.0 × 107/kg, which is 10 times of that in clinical human use.

Transplantation of induced mesenchymal stem cells for treating chronic renal insufficiency.

Discovering a new cell transplantation approach for treating chronic renal insufficiency is a goal of many nephrologists. In vitro-cultured peripheral blood mononuclear cells (PBMCs) were reprogrammed into induced mesenchymal stem cells (iMSCs) by using natural inducing agents made in our laboratory. The stem cell phenotype of the iMSCs was then identified. Unilateral ureteral obstruction (UUO) was used to create an animal model of chronic renal insufficiency characterized by renal interstitial fibrosis. The induced and non-induced PBMCs were transplanted, and the efficacy of iMSCs in treating chronic renal insufficiency was evaluated using a variety of methods. The ultimate goal was to explore the effects of iMSC transplantation on the treatment of chronic renal insufficiency, with the aim of providing a new therapeutic modality for this disease.

Umbilical cord mesenchymal stem cells are able to undergo differentiation into functional islet-like cells in type 2 diabetic tree shrews.

Islet transplantation is arguably one of the most promising strategies to treat patients suffering with diabetes mellitus. However, a combination of a lack of donors and chronic immune rejection limit clinical applications. Here, we evaluated the efficacy of cell therapy using islet-like cells differentiated from umbilical cord mesenchymal stem cells (UC-MSCs) of tree shrews for the treatment of type 2 diabetes. Enhanced green fluorescent protein (eGFP) labeled UC-MSCs were directly injected into type 2 diabetic tree shrews, where UC-MSC differentiated into functional islet-like cells and alleviated disease severity, as evidenced by improved biochemical features and reduced concentrations of inflammatory cytokines. We also demonstrated that in vitro culture of UC-MSCs for six days in a high-glucose environment (40 mmol/L or 60 mmol/L glucose) resulted in significant gene methylation. The potency of UC-MSCs differentiated into insulin-secreting cells was attributed to the activation of Notch signal pathways. This study provides evidence that cell therapy of islet-like cells differentiated from UC-MSCs is a feasible, simple and inexpensive approach in the treatment of type 2 diabetes.