BMPQ-1 binds selectively to (3+1) hybrid topologies in human telomeric G-quadruplex multimers.

A single G-quadruplex forming sequence from the human telomere can adopt six distinct topologies that are inter-convertible under physiological conditions. This presents challenges to design ligands that show selectivity and specificity towards a particular conformation. Additional complexity is introduced in differentiating multimeric G-quadruplexes over monomeric species, which would be able to form in the single-stranded 3' ends of telomeres. A few ligands have been reported that bind to dimeric quadruplexes, but their preclinical pharmacological evaluation is limited. Using multidisciplinary approaches, we identified a novel quinoline core ligand, BMPQ-1, which bound to human telomeric G-quadruplex multimers over monomeric G-quadruplexes with high selectivity, and induced the formation of G-quadruplex DNA along with the related DNA damage response at the telomere. BMPQ-1 reduced tumor cell proliferation with an IC50 of ∼1.0 µM and decreased tumor growth rate in mouse by half. Biophysical analysis using smFRET identified a mixture of multiple conformations coexisting for dimeric G-quadruplexes in solution. Here, we showed that the titration of BMPQ-1 shifted the conformational ensemble of multimeric G-quadruplexes towards (3+1) hybrid-2 topology, which became more pronounced as further G-quadruplex units are added.

Towards the Inhibition of Protein-Protein Interactions (PPIs) in STAT3: Insights into a New Class of Benzothiadiazole Derivatives.

Signal transducer and activator of transcription 3 (STAT3) is a validated anticancer target due to the relationship between its constitutive activation and malignant tumors. Through a virtual screening approach on the STAT3-SH2 domain, 5,6-dimethyl-1H,3H-2,1,3-benzothiadiazole-2,2-dioxide (1) was identified as a potential STAT3 inhibitor. Some benzothiadiazole derivatives were synthesized by employing a versatile methodology, and they were tested by an AlphaScreen-based assay. Among them, benzosulfamide 1 showed a significant activity with an IC50 = 15.8 ± 0.6 µM as a direct STAT3 inhibitor. Notably, we discovered that compound 1 was also able to interact with cysteine residues located around the SH2 domain. By applying mass spectrometry, liquid chromatography, NMR, and UV spectroscopy, an in-depth investigation was carried out, shedding light on its intriguing and unexpected mechanism of interaction.

Near-infrared dual bioluminescence imaging in mouse models of cancer using infraluciferin.

Bioluminescence imaging (BLI) is ubiquitous in scientific research for the sensitive tracking of biological processes in small animal models. However, due to the attenuation of visible light by tissue, and the limited set of near-infrared bioluminescent enzymes, BLI is largely restricted to monitoring single processes in vivo. Here we show, that by combining stabilised colour mutants of firefly luciferase (FLuc) with the luciferin (LH2) analogue infraluciferin (iLH2), near-infrared dual BLI can be achieved in vivo. The X-ray crystal structure of FLuc with a high-energy intermediate analogue, 5'-O-[N-(dehydroinfraluciferyl)sulfamoyl] adenosine (iDLSA) provides insight into the FLuc-iLH2 reaction leading to near-infrared light emission. The spectral characterisation and unmixing validation studies reported here established that iLH2 is superior to LH2 for the spectral unmixing of bioluminescent signals in vivo; which led to this novel near-infrared dual BLI system being applied to monitor both tumour burden and CAR T cell therapy within a systemically induced mouse tumour model.

Holliday Junctions Formed from Human Telomeric DNA.

Cells have evolved inherent mechanisms, like homologous recombination (HR), to repair damaged DNA. However, repairs at telomeres can lead to genomic instability, often associated with cancer. While most rapidly dividing cells employ telomerase, the others maintain telomere length through HR-dependent alternative lengthening of telomeres (ALT) pathways. Here we describe the crystal structures of Holliday junction intermediates of the HR-dependent ALT mechanism. Using an extended human telomeric repeat, we also report the crystal structure of two Holliday junctions in close proximity, which associate together through strand exchange to form a hemicatenated double Holliday junction. Our combined structural results demonstrate that ACC nucleotides in the C-rich lagging strand (5'-CTAACCCTAA-3') at the telomere repeat sequence constitute a conserved structural feature that constrains crossover geometry and is a preferred site for Holliday junction formation in telomeres.

A high-throughput fluorescence polarization assay for discovering inhibitors targeting the DNA-binding domain of signal transducer and activator of transcription 3 (STAT3).

Anti-cancer drug discovery efforts to directly inhibit the signal transducer and activator of transcription 3 (STAT3) have been active for over a decade following the discovery that 70% of cancers exhibit elevated STAT3 activity. The majority of research has focused on attenuating STAT3 activity through preventing homo-dimerization by targeting the SH2 or transcriptional activation domains. Such dimerization inhibitors have not yet reached the market. However, an alternative strategy focussed on preventing STAT3 DNA-binding through targeting the DNA-binding domain (DBD) offers new drug design opportunities. Currently, only EMSA and ELISA-based methods have been implemented with suitable reliability to characterize STAT3 DBD inhibitors. Herein, we present a new orthogonal, fluorescence polarization (FP) assay suitable for high-throughput screening of molecules. This assay, using a STAT3127-688 construct, was developed and optimized to screen molecules that attenuate the STAT3:DNA association with good reliability (Z' value > 0.6) and a significant contrast (signal-to-noise ratio > 15.0) at equilibrium. The assay system was stable over a 48 hour period. Significantly, the assay is homogeneous and simple to implement for high-throughput screening compared to EMSA and ELISA. Overall, this FP assay offers a new way to identify and characterize novel molecules that inhibit STAT3:DNA association.

A naphthalene diimide G-quadruplex ligand inhibits cell growth and down-regulates BCL-2 expression in an imatinib-resistant gastrointestinal cancer cell line.

Gastro-intestinal tumours (GISTs) are driven by aberrant expression of the c-KIT oncoprotein. They can be effectively treated by the kinase inhibitor imatinib, which locks the c-KIT kinase domain into an inactive conformation. However resistance to imatinib, driven by active-site mutations, is a recurrent clinical challenge, which has been only partly met by the subsequent development of second and third-generation c-KIT inhibitors. It is reported here that a tetra-substituted naphthalene diimide derivative, which is a micromolar inhibitor of cell growth in a wild-type patient-derived GIST cell line, has a sub-micromolar activity in two distinct patient-derived imatinib-resistant cell lines. The compound has been previously shown to down-regulate expression of the c-KIT protein in a wild-type GIST cell line. It does not affect c-KIT protein expression in a resistant cell line to the same extent, whereas it profoundly down-regulates the expression of the anti-apoptopic protein BCL-2. It is proposed that the mechanism of action involves targeting quadruplex nucleic acid structures, and in particular those in the BCL-2 gene and its RNA transcript. The BCL-2 protein is up-regulated in the GIST-resistant cell line, and is strongly down-regulated after treatment. The compound strongly stabilises a range of G-quadruplexes including a DNA one from the BCL-2 promoter and an RNA quadruplex from its 5'-UTR region. A reporter assay construct incorporating the 5'-UTR quadruplex sequence demonstrates down-regulation of BCL-2 expression.

Selectivity of major isoquinoline alkaloids from Chelidonium majus towards telomeric G-quadruplex: A study using a transition-FRET (t-FRET) assay.

BACKGROUND: Natural bioproducts are invaluable resources in drug discovery. Isoquinoline alkaloids of Chelidonium majus constitute a structurally diverse family of natural products that are of great interest, one of them being their selectivity for human telomeric G-quadruplex structure and telomerase inhibition. METHODS: The study focuses on the mechanism of telomerase inhibition by stabilization of telomeric G-quadruplex structures by berberine, chelerythrine, chelidonine, sanguinarine and papaverine. Telomerase activity and mRNA levels of hTERT were estimated using quantitative telomere repeat amplification protocol (q-TRAP) and qPCR, in MCF-7 cells treated with different groups of alkaloids. The selectivity of the main isoquinoline alkaloids of Chelidonium majus towards telomeric G-quadruplex forming sequences were explored using a sensitive modified thermal FRET-melting measurement in the presence of the complementary oligonucleotide CT22. We assessed and monitored G-quadruplex topologies using circular dichroism (CD) methods, and compared spectra to previously well-characterized motifs, either alone or in the presence of the alkaloids. Molecular modeling was performed to rationalize ligand binding to the G-quadruplex structure. RESULTS: The results highlight strong inhibitory effects of chelerythrine, sanguinarine and berberine on telomerase activity, most likely through substrate sequestration. These isoquinoline alkaloids interacted strongly with telomeric sequence G-quadruplex. In comparison, chelidonine and papaverine had no significant interaction with the telomeric quadruplex, while they strongly inhibited telomerase at transcription level of hTERT. Altogether, all of the studied alkaloids showed various levels and mechanisms of telomerase inhibition. CONCLUSIONS: We report on a comparative study of anti-telomerase activity of the isoquinoline alkaloids of Chelidonium majus. Chelerythrine was most effective in inhibiting telomerase activity by substrate sequesteration through G-quadruplex stabilization. GENERAL SIGNIFICANCE: Understanding structural and molecular mechanisms of anti-cancer agents can help in developing new and more potent drugs with fewer side effects. Isoquinolines are the most biologically active agents from Chelidonium majus, which have shown to be telomeric G-quadruplex stabilizers and potent telomerase inhibitors.

Crystal structure of a promoter sequence in the B-raf gene reveals an intertwined dimer quadruplex.

The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninterrupted run of six potassium ions in the central channel of the quadruplex. Analogy with previously reported promoter quadruplexes had initially suggested that in common with these a monomeric quadruplex was to be expected. The structure has a distorted G·C·G·C base quartet at one end and four flipped-out adenosine nucleosides at the other. The only loops in the structure are formed by the cytosine and by the three adenosines within the sequence, with all of the guanosines participating in G-quartet formation. Solution UV and circular dichroism data are in accord with a stable quadruple arrangement being formed. 1D NMR data, together with gel electrophoresis measurements, are consistent with a dimer being the dominant species in potassium solution. A single-chain intramolecular quadruplex has been straightforwardly constructed using molecular modeling, by means of a six-nucleotide sequence joining 3' and 5' ends of each strand in the dimer. A human genomic database search has revealed a number of sequences containing eight or more consecutive short G-tracts, suggesting that such intramolecular quadruplexes could be formed within the human genome.

Observation of unphosphorylated STAT3 core protein binding to target dsDNA by PEMSA and X-ray crystallography.

The STAT3 transcription factor plays a central role in a wide range of cancer types where it is over-expressed. Previously, phosphorylation of this protein was thought to be a prerequisite for direct binding to DNA. However, we have now shown complete binding of a purified unphosphorylated STAT3 (uSTAT3) core directly to M67 DNA, the high affinity STAT3 target DNA sequence, by a protein electrophoretic mobility shift assay (PEMSA). Binding to M67 DNA was inhibited by addition of increasing concentrations of a phosphotyrosyl peptide. X-ray crystallography demonstrates one mode of binding that is similar to that known for the STAT3 core phosphorylated at Y705.

Nanofiber-based delivery of therapeutic peptides to the brain.

The delivery of therapeutic peptides and proteins to the central nervous system is the biggest challenge when developing effective neuropharmaceuticals. The central issue is that the blood-brain barrier is impermeable to most molecules. Here we demonstrate the concept of employing an amphiphilic derivative of a peptide to deliver the peptide into the brain. The key to success is that the amphiphilic peptide should by design self-assemble into nanofibers wherein the active peptide epitope is tightly wrapped around the nanofiber core. The nanofiber form appears to protect the amphiphilic peptide from degradation while in the plasma, and the amphiphilic nature of the peptide promotes its transport across the blood-brain barrier. Therapeutic brain levels of the amphiphilic peptide are achieved with this strategy, compared with the absence of detectable peptide in the brain and the consequent lack of a therapeutic response when the underivatized peptide is administered.

Characterisation of ilomastat for prolonged ocular drug release.

We are developing tablet dosage forms for implantation directly into the subconjunctival space of the eye. The matrix metalloproteinase inhibitor, ilomastat, has previously been shown to be efficacious at suppressing scarring following glaucoma filtration surgery (GFS). We report on the physical characterisation of ilomastat which is being developed for ocular implantation. Since ilomastat is being considered for implantation it is necessary to examine its polymorphs and their influence on aspects of the in vitro drug release profile. X-ray powder diffraction identified two polymorphs of ilomastat from different commercial batches of the compound. Tablets were prepared from the two different polymorphs. Isothermal perfusion calorimetry was used to show that amorphous content is not increased during tablet formulation. The melting points of the two polymorphs are 188 and 208°C as determined by differential scanning calorimetry. Utilising single crystal X-ray diffraction, the structural conformations and packing arrangements of the different polymorphs were determined. The orthorhombic crystal crystallised as a monohydrate while the second monoclinic crystal form is non-solvated. Ilomastat tablets prepared from the two different solid forms exhibited similar drug release profiles in vitro under conditions mimicking the aqueous composition, volume and flow of the subconjunctival space after GFS. This suggests that a reproducible dose at each time point during release after implantation should be achievable in vivo with ilomastat tablets prepared from the two polymorphs identified.

Crystal structure of a c-kit promoter quadruplex reveals the structural role of metal ions and water molecules in maintaining loop conformation.

We report here the 1.62 Å crystal structure of an intramolecular quadruplex DNA formed from a sequence in the promoter region of the c-kit gene. This is the first reported crystal structure of a promoter quadruplex and the first observation of localized magnesium ions in a quadruplex structure. The structure reveals that potassium and magnesium ions have an unexpected yet significant structural role in stabilizing particular quadruplex loops and grooves that is distinct from but in addition to the role of potassium ions in the ion channel at the centre of all quadruplex structures. The analysis also shows how ions cluster together with structured water molecules to stabilize the quadruplex arrangement. This particular quadruplex has been previously studied by NMR methods, and the present X-ray structure is in accord with the earlier topology assignment. However, as well as the observations of potassium and magnesium ions, the crystal structure has revealed a highly significant difference in the dimensions of the large cleft in the structure, which is a plausible target for small molecules. This difference can be understood by the stabilizing role of structured water networks.

Structural basis for telomeric G-quadruplex targeting by naphthalene diimide ligands.

The folding of the single-stranded 3' end of the human telomere into G-quadruplex arrangements inhibits the overhang from hybridizing with the RNA template of telomerase and halts telomere maintenance in cancer cells. The ability to thermally stabilize human telomeric DNA as a four-stranded G-quadruplex structure by developing selective small molecule compounds is a therapeutic path to regulating telomerase activity and thereby selectively inhibit cancer cell growth. The development of compounds with the necessary selectivity and affinity to target parallel-stranded G-quadruplex structures has proved particularly challenging to date, relying heavily upon limited structural data. We report here on a structure-based approach to the design of quadruplex-binding ligands to enhance affinity and selectivity for human telomeric DNA. Crystal structures have been determined of complexes between a 22-mer intramolecular human telomeric quadruplex and two potent tetra-substituted naphthalene diimide compounds, functionalized with positively charged N-methyl-piperazine side-chains. These compounds promote parallel-stranded quadruplex topology, binding exclusively to the 3' surface of each quadruplex. There are significant differences between the complexes in terms of ligand mobility and in the interactions with quadruplex grooves. One of the two ligands is markedly less mobile in the crystal complex and is more quadruplex-stabilizing, forming multiple electrostatic/hydrogen bond contacts with quadruplex phosphate groups. The data presented here provides a structural rationale for the biophysical (effects on quadruplex thermal stabilization) and biological data (inhibition of proliferation in cancer cell lines and evidence of in vivo antitumor activity) on compounds in this series and, thus, for the concept of telomere targeting with DNA quadruplex-binding small molecules.

Molecular basis of structure-activity relationships between salphen metal complexes and human telomeric DNA quadruplexes.

The first X-ray crystal structures of nickel(II) and copper(II) salphen metal complexes bound to a quadruplex DNA are presented. Two structures have been determined and show that these salphen-metal complexes bind to human telomeric quadruplexes by end-stacking, with the metal in each case almost in line with the potassium ion channel. Quadruplex and duplex DNA binding is presented for these two and other related salphen complexes, all with side-chains terminating in pyrrolidino end-groups and differing patterns of substitution on the salphen core. The crystal structures are able to provide rationalizations for the structure-activity data, and in particular for the superior quadruplex-binding of the nickel complexes compared to that of the copper-containing ones. The complexes show significant antiproliferative activity for the compounds in a panel of cancer cell lines. They also show telomerase inhibitory activity in the telomerase TRAP-LIG assay.

The application of DNA and RNA G-quadruplexes to therapeutic medicines.

The intriguing structural diversity in folded topologies available to guanine-rich nucleic acid repeat sequences have made four-stranded G-quadruplex structures the focus of both basic and applied research, from cancer biology and novel therapeutics through to nanoelectronics. Distributed widely in the human genome as targets for regulating gene expression and chromosomal maintenance, they offer unique avenues for future cancer drug development. In particular, the recent advances in chemical and structural biology have enabled the construction of bespoke selective DNA based aptamers to be used as novel therapeutic agents and access to detailed structural models for structure based drug discovery. In this critical review, we will explore the important underlying characteristics of G-quadruplexes that make them functional, stable, and predictable nanoscaffolds. We will review the current structural database of folding topologies, molecular interfaces and novel interaction surfaces, with a consideration to their future exploitation in drug discovery, molecular biology, supermolecular assembly and aptamer design. In recent years the number of potential applications for G-quadruplex motifs has rapidly grown, so in this review we aim to explore the many future challenges and highlight where possible successes may lie. We will highlight the similarities and differences between DNA and RNA folded G-quadruplexes in terms of stability, distribution, and exploitability as small molecule targets. Finally, we will provide a detailed review of basic G-quadruplex geometry, experimental tools used, and a critical evaluation of the application of high-resolution structural biology and its ability to provide meaningful and valid models for future applications (255 references).

Rational design of substituted diarylureas: a scaffold for binding to G-quadruplex motifs.

The design and synthesis of a series of urea-based nonpolycyclic aromatic ligands with alkylaminoanilino side chains as telomeric and genomic G-quadruplex DNA interacting agents are described. Their interactions with quadruplexes have been examined by means of fluorescent resonance energy transfer melting, circular dichroism, and surface plasmon resonance-based assays. These validate the design concept for such urea-based ligands and also show that they have significant selectivity over duplex DNA, as well as for particular G-quadruplexes. The ligand-quadruplex complexes were investigated by computational molecular modeling, providing further information on structure-activity relationships. Preliminary biological studies using short-term cell growth inhibition assays show that some of the ligands have cancer cell selectivity, although they appear to have low potency for intracellular telomeric G-quadruplex structures, suggesting that their cellular targets may be other, possibly oncogene-related quadruplexes.

Structural basis of DNA quadruplex recognition by an acridine drug.

The crystal structure of a complex between the bimolecular human telomeric quadruplex d(TAGGGTTAGGGT)2 and the experimental anticancer drug BRACO-19, has been determined, to 2.5 A resolution. The binding site for the BRACO-19 molecule is at the interface of two parallel-folded quadruplexes, sandwiched between a G-tetrad surface and a TATA tetrad, and held in the site by networks of water molecules. The structure rationalizes the existing structure-activity data and provides a starting-point for the structure-based design of quadruplex-binding ligands

Crystal structures of PI3K-C2alpha PX domain indicate conformational change associated with ligand binding.

BACKGROUND: PX domains have specialized protein structures involved in binding of phosphoinositides (PIs). Through binding to the various PIs PX domains provide site-specific membrane signals to modulate the intracellular localisation and biological activity of effector proteins. Several crystal structures of these domains are now available from a variety of proteins. All PX domains contain a canonical core structure with main differences exhibited within the loop regions forming the phosphoinositide binding pockets. It is within these areas that the molecular basis for ligand specificity originates. RESULTS: We now report two new structures of PI3K-C2alpha PX domain that crystallised in a P3121 space group. The two structures, refined to 2.1 A and 2.5 A, exhibit significantly different conformations of the phosphoinositide-binding loops. Unexpectedly, in one of the structures, we have detected a putative-ligand trapped in the binding site during the process of protein purification and crystallisation. CONCLUSION: The two structures reported here provide a more complete description of the phosphoinositide binding region compared to the previously reported 2.6 A crystal structure of human PI3K-C2alpha PX where this region was highly disordered. The structures enabled us to further analyse PI specificity and to postulate that the observed conformational change could be related to ligand-binding.

Amide bond direction modulates G-quadruplex recognition and telomerase inhibition by 2,6 and 2,7 bis-substituted anthracenedione derivatives.

G-quadruplex structures of DNA represent a potentially useful target for anticancer drugs. Stabilisation of this arrangement at the ends of chromosomes may inhibit the action of telomerase, an enzyme involved in immortalization of cancer cells. Appropriately substituted amido anthracenediones are effective G-quadruplex stabilizers, but no information is available as yet on the possible modulation of G-quadruplex recognition and telomerase inhibition produced by the direction of the amide bond. To understand the basis of amido anthracenedione selectivity, we have synthesized a number of derivatives bearing the -CO-NH- or -NH-CO- group linked to the planar anthraquinone (AQ) moiety at 2,6 and 2,7 positions. The various isomers were tested in terms of telomerase inhibition, determined by the TRAP assay, G-quadruplex stabilisation measured by the increase in melting temperature of the appropriately folded oligonucleotide using FRET, and conformational and G4 binding properties examined by molecular modelling techniques. In all cases, enzymatic inhibition and G-quadruplex stabilization were directly related, which strongly supports the proposed molecular mechanism of telomerase interference. Interestingly, the AQ-NH-CO- arrangement performs invariantly better than the AQ-CO-NH- arrangement, showing a clear preference among isomeric derivatives. Theoretical calculations suggest that the former amide arrangement is co-planar with the aromatic system, whereas the latter is tilted by about 30 degrees when considering the most stable conformation. A more extended planar surface would allow more efficient stacking interactions with the quadruplex structure, hence more effective telomerase inhibition.

Crystallographic studies of quadruplex nucleic acids.

DNA quadruplexes are formed from guanine-rich repeats that self-associate into higher order four-stranded structures. These G-rich repeat sequences can be found in both telomeric regions as well as regions proximal to promoters of oncogenes. The compelling evidence that stabilizing these motifs by small molecule ligands can alter cell viability in certain cancer cell lines has led to identification of DNA quadruplex structures as therapeutic targets. Target-based design of selective ligands that target particular quadruplex topologies is heavily reliant on the availability of high-resolution structural information of the intended target. X-ray crystallography can provide this level of detail to atomic resolution. Recently drug discovery programs have refocused on the need for a fuller structural and molecular description of the target molecule. This review describes a crystallographic route to the determination of quadruplex topology, and high-resolution loop structures for target-based ligand design. The review also highlights the methods employed in the design of appropriate DNA sequences and crystallization techniques to solve these unusual DNA structures.